ID: 1045137158

View in Genome Browser
Species Human (GRCh38)
Location 8:99233498-99233520
Sequence CTTGATAAGAATGCTGATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045137155_1045137158 13 Left 1045137155 8:99233462-99233484 CCTGGGTTGGGATGAAGAGATTC 0: 3
1: 1
2: 2
3: 10
4: 156
Right 1045137158 8:99233498-99233520 CTTGATAAGAATGCTGATGCGGG 0: 1
1: 0
2: 1
3: 15
4: 194
1045137154_1045137158 19 Left 1045137154 8:99233456-99233478 CCACAGCCTGGGTTGGGATGAAG 0: 3
1: 1
2: 4
3: 17
4: 221
Right 1045137158 8:99233498-99233520 CTTGATAAGAATGCTGATGCGGG 0: 1
1: 0
2: 1
3: 15
4: 194
1045137153_1045137158 20 Left 1045137153 8:99233455-99233477 CCCACAGCCTGGGTTGGGATGAA 0: 3
1: 1
2: 0
3: 19
4: 161
Right 1045137158 8:99233498-99233520 CTTGATAAGAATGCTGATGCGGG 0: 1
1: 0
2: 1
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045137158 Original CRISPR CTTGATAAGAATGCTGATGC GGG Intronic
902557914 1:17257911-17257933 CGTGATAAGAGTGCAGAGGCTGG + Intronic
902878132 1:19353166-19353188 CTTGCTGAGGGTGCTGATGCTGG + Intronic
903997648 1:27317699-27317721 CTTACTAAGAAGGCTGAGGCAGG + Intergenic
907992612 1:59597467-59597489 CTTGATTAGAATTCTGAAGTAGG - Intronic
909061099 1:70880391-70880413 TTTTTTAAGAATGCTGAGGCTGG + Intronic
909113981 1:71511052-71511074 CTTGATAATTTTGCAGATGCAGG + Intronic
911121911 1:94304710-94304732 TTTCTTAAGGATGCTGATGCAGG + Intergenic
911168686 1:94747429-94747451 CTTGGTAAGAATGTTGCTGAGGG - Intergenic
911813562 1:102313581-102313603 CTTGACTAAAATGCTAATGCTGG - Intergenic
914373560 1:147051935-147051957 CTGGATAAGAGTGATGATGCGGG - Intergenic
916330665 1:163612643-163612665 CTTAAAAAGAATGCTGCTGATGG + Intergenic
918641307 1:186844384-186844406 CATTATAAGAATGATGATGATGG + Intronic
918980432 1:191550983-191551005 CTTGATTAGAGTCCTGCTGCTGG + Intergenic
921061316 1:211587265-211587287 ATTGCTGAGAATGATGATGCAGG - Intergenic
921667245 1:217887776-217887798 CTCCCTGAGAATGCTGATGCTGG + Intergenic
922433719 1:225582259-225582281 CTTTACAAGAATCATGATGCTGG - Intronic
922506543 1:226129331-226129353 CTTGATAAAAAGGATGATTCTGG + Intergenic
923470399 1:234285262-234285284 CTGGATAAGGATGTTGATGGGGG - Intronic
924548686 1:245053999-245054021 CGTGCAAAGAAGGCTGATGCGGG - Intronic
924908196 1:248479905-248479927 CTGGATAAGAGGGCTGATTCAGG + Intergenic
924915909 1:248568179-248568201 CTGGATAAGAGGGCTGATTCAGG - Intergenic
1066368637 10:34800306-34800328 CTTGATAATAATGTTAATACTGG + Intronic
1067526376 10:47041461-47041483 CTTTATAAGGAAGCTGGTGCTGG - Intergenic
1071344933 10:84683867-84683889 TTTAATAAGAATGCACATGCTGG - Intergenic
1071345023 10:84684463-84684485 GTTGGGAAGAAAGCTGATGCAGG + Intergenic
1074071325 10:110072708-110072730 CTTGATAAAAATGCTGACCATGG - Intronic
1075150133 10:119921419-119921441 CATGATCAGAAGGCTGAGGCGGG - Intronic
1075408995 10:122213601-122213623 CCTGATAAGCAGGCAGATGCTGG - Intronic
1075546704 10:123360499-123360521 CTTGGTAATACTGCTGAGGCTGG + Intergenic
1078801728 11:14651554-14651576 GTTGATAAGAATGTGGATCCAGG - Intronic
1078868582 11:15322823-15322845 TTGGAAAAGAATGCTGATGTTGG + Intergenic
1079266682 11:18939851-18939873 CTTGATAAAGTTTCTGATGCTGG + Intergenic
1079377404 11:19905927-19905949 CTTGATAAGTTTGGTGAAGCAGG + Intronic
1079704088 11:23591376-23591398 CTTGATAAAAATTTAGATGCTGG - Intergenic
1081003572 11:37704244-37704266 AAGGATAAGAATTCTGATGCTGG - Intergenic
1081608424 11:44542627-44542649 AATGATAACAATGCTGATGATGG - Intergenic
1084600669 11:70143555-70143577 CTTGTTCAGAATGCAGATTCCGG + Intronic
1085883732 11:80498314-80498336 CTTGTTAGAAATGCTGATTCCGG + Intergenic
1086841523 11:91690791-91690813 CTTGATAAGAAAGATAAGGCAGG + Intergenic
1087926851 11:103928890-103928912 CTTGAGATAAATACTGATGCTGG + Intronic
1089403917 11:118181719-118181741 CTTGTTAAAAATGCAGATTCGGG - Intergenic
1089797959 11:120998554-120998576 CAGGAGAAGAATGCTGTTGCAGG + Intergenic
1093246014 12:16737487-16737509 GTTGATAATAATGGTGATGGTGG - Intergenic
1093393346 12:18650592-18650614 CTTGATATGAGAGCTGATACGGG + Intergenic
1094178660 12:27567806-27567828 CTTGATCTGAATGCTGAGCCAGG - Intronic
1095446529 12:42288031-42288053 CTGGATAAGAGTGATGATGCGGG - Intronic
1097686330 12:62694297-62694319 CGTGATGAGAATACTGTTGCTGG - Intronic
1098744202 12:74214869-74214891 CTAGCTAAGAAGGCTGATGAAGG - Intergenic
1099715082 12:86281738-86281760 CATGATAAGAATGCAGAATCAGG - Intronic
1100340658 12:93676726-93676748 CTAGATAAGATTGCTGATTGTGG - Intergenic
1101222863 12:102658736-102658758 TTTGATAAAAATGCTGATAGTGG - Intergenic
1101869213 12:108549154-108549176 CTTGATCAGACTGCTCAGGCTGG - Exonic
1104290801 12:127464893-127464915 CCTGATAAAACTGTTGATGCTGG - Intergenic
1104407367 12:128529257-128529279 CTAGGCAAGAATGCTGATGGGGG - Intronic
1105838041 13:24227864-24227886 CTATATAAGAATTCTGAGGCCGG - Intronic
1106201766 13:27543971-27543993 GGTGCTGAGAATGCTGATGCTGG - Intergenic
1106463893 13:29995794-29995816 CTTGTTAGAAATGCTGATTCTGG - Intergenic
1106834615 13:33620581-33620603 CTTGAAAAGAATGCATATTCTGG - Intergenic
1107446344 13:40473104-40473126 CCTGATAAGAAACCTCATGCCGG + Intergenic
1107997106 13:45871784-45871806 CTTGATAAACATGGAGATGCAGG - Intergenic
1108110073 13:47061294-47061316 CTTGAGAAGAATGCATATGCTGG + Intergenic
1108472291 13:50779605-50779627 CTTGATAAGCATGGGGCTGCAGG - Intronic
1109099985 13:58171352-58171374 CCTGATAAAAATACTGATTCTGG - Intergenic
1110405554 13:75146323-75146345 CTTGATAAGGATGCTGAAGTAGG - Intergenic
1111196935 13:84887541-84887563 ATTGATAGGAATTATGATGCAGG + Intergenic
1111652372 13:91108173-91108195 CTTGAGAAGAATTCTGATGCCGG + Intergenic
1112779978 13:102889754-102889776 CTTGGTAAGATTGGGGATGCAGG - Intergenic
1114934475 14:27516009-27516031 CTTGATAAGAGTGGTGGTTCGGG + Intergenic
1119867269 14:77984213-77984235 CTTGTTAAAAATGCAGATTCTGG - Intergenic
1120442222 14:84556320-84556342 CATGATATGAATGCTTATGGTGG + Intergenic
1120592510 14:86392290-86392312 CTAGCTAAGAATGGTGATGAAGG - Intergenic
1122741309 14:103872881-103872903 CTTAACAACAATGCAGATGCAGG - Intergenic
1125367024 15:38928489-38928511 TTGGATAGGAATGGTGATGCTGG + Intergenic
1125809728 15:42527780-42527802 CAGAATAAGAAGGCTGATGCTGG - Intronic
1126504011 15:49381431-49381453 CATGCTAAGGATGCTGAAGCAGG + Intronic
1126821375 15:52507326-52507348 CTGGTTAAGAATGTTGATGATGG + Intronic
1132629867 16:911937-911959 CAGCATAAGAATGCGGATGCGGG + Intronic
1134278743 16:12799975-12799997 CTGGATAAGAATGGGGATGCTGG - Intronic
1137280353 16:46971903-46971925 CCTGATAAGAATCCAAATGCAGG - Exonic
1138788724 16:59876693-59876715 CTTGAAAAGAATATTGAAGCAGG + Intergenic
1138914709 16:61449490-61449512 CTTGATAGGAAAGCTGTTGGTGG - Intergenic
1139392611 16:66614444-66614466 CTGGATAAGAATGCGGACCCGGG - Intergenic
1140770102 16:78195486-78195508 CATGTTAAGATTGCAGATGCAGG + Intronic
1141156344 16:81599807-81599829 CTTGACAACAATGCTAAGGCGGG - Intronic
1142021818 16:87788057-87788079 CTTCATAAGATTGCTGATAAGGG + Intergenic
1143306251 17:5949265-5949287 TTTGAAAAGAATGCAGATTCTGG - Intronic
1144734011 17:17544887-17544909 CTTGGTAAGAATGCTGCAGCTGG - Intronic
1144749604 17:17639326-17639348 CTTTATAAGAATGGGGAAGCAGG + Intergenic
1148520854 17:48273812-48273834 CTTGTTAATAATGCAGATTCAGG + Intronic
1153309248 18:3661893-3661915 CTTGAGAAGACTGCTGGTGAAGG + Intronic
1155331762 18:24725973-24725995 CGTGATAAGGATGCTGCTGAGGG - Intergenic
1156735956 18:40260294-40260316 CTTGATAAGAATGCATATTTAGG - Intergenic
925549304 2:5053092-5053114 GTTGGAAAGAATGCTGATGCAGG - Intergenic
925800535 2:7595077-7595099 TCTGTTAATAATGCTGATGCTGG - Intergenic
926019309 2:9481478-9481500 CTGGATAGGAATGCTGAGGGAGG + Intronic
926041155 2:9674289-9674311 TTGGATAAGAATGGTGATTCTGG + Intergenic
927587319 2:24319445-24319467 CTTGATAAGGCTCCTGATGGGGG - Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
929006293 2:37396635-37396657 TTTGTTAAAAATGCTGATTCTGG + Intergenic
930047517 2:47186197-47186219 CTTGAATAAAATGCTGATCCTGG - Intergenic
931182964 2:59921777-59921799 CTTAATAATATTGTTGATGCTGG - Intergenic
931737411 2:65209053-65209075 GTGGATAATAATGCAGATGCTGG + Intergenic
934509530 2:94926231-94926253 CTTGTTAATATTGCTGAGGCTGG - Intergenic
935799866 2:106684681-106684703 CTTGAAAAGAATGCATATTCTGG + Intergenic
938366781 2:130740874-130740896 CTTGAAGAGAATGCGCATGCAGG - Intergenic
939134741 2:138279891-138279913 CTTGTTAAAAATGCTGGTTCTGG - Intergenic
941516877 2:166491255-166491277 CTTGATAGAAATGCAGAAGCTGG - Intronic
945021558 2:205577935-205577957 ATTGATAAGAATACTGCTGATGG + Intronic
945861774 2:215131217-215131239 TTTGATAAGCATGGTGATGGTGG + Intronic
947368074 2:229417135-229417157 CTGGATAAGAGGGCTGAAGCTGG - Intronic
947875990 2:233468643-233468665 CCTGAGAAGAATCGTGATGCTGG - Intronic
1169082993 20:2808741-2808763 CTTGTTAAAAATGCAGATTCTGG - Intergenic
1170764077 20:19275286-19275308 CTTGCAGGGAATGCTGATGCAGG - Intronic
1172368777 20:34370870-34370892 TTAGATAAGAAAGCTGAGGCTGG + Intronic
1174295887 20:49544798-49544820 CTGGTTAAGAATTCAGATGCTGG - Intronic
1175192042 20:57217794-57217816 ATTAATAAAAATGCAGATGCTGG + Intronic
1175746012 20:61457781-61457803 GTTGATGACAGTGCTGATGCTGG + Intronic
1175746062 20:61458155-61458177 GTTGATGACAGTGCTGATGCTGG + Intronic
1175746073 20:61458254-61458276 GTTGATGACAGTGCTGATGCTGG + Intronic
1177539181 21:22469324-22469346 CTTGATAGTAATGCAGATGCAGG - Intergenic
1177807978 21:25893792-25893814 CTAGATAAGACTCCTGATGAAGG + Intronic
1179098029 21:38332996-38333018 CTTGATCAGAAGGTTGATGAAGG - Intergenic
1181905184 22:26188833-26188855 CTATAAAAGAATACTGATGCTGG - Intronic
1184001453 22:41677226-41677248 GTTAATAAGAATGATGAGGCTGG + Intronic
1185145054 22:49128822-49128844 CTTGAGAAGGATGATGATGGTGG - Intergenic
950162578 3:10771473-10771495 CTGGATAAGAAGACTGAAGCTGG - Intergenic
952467299 3:33603041-33603063 ATTGATGTGAATGCTGCTGCAGG - Exonic
952724607 3:36570482-36570504 CTTGAAAAGAATGTTTATTCTGG + Intergenic
955089696 3:55737322-55737344 CTGGATATTAATGCTGCTGCCGG - Intronic
955636011 3:61030268-61030290 CTTGTTAAAAATGCAGATTCTGG - Intronic
961373592 3:126448031-126448053 CTGGATGAGAAAGCTGAGGCAGG - Intronic
961396500 3:126595864-126595886 CTTGTTCAGAAGGCTGAGGCAGG + Intronic
962165597 3:133044613-133044635 CTTGATAAAAATGCAGGTTCGGG - Intronic
962173723 3:133129912-133129934 CTTCAAAAGATCGCTGATGCAGG + Intronic
962173725 3:133129956-133129978 CTTCAAAAGATCGCTGATGCAGG - Intronic
964289596 3:155162710-155162732 CTTGATAGGAATGTTTATGTGGG + Intronic
967275694 3:187772418-187772440 GTTGATCAGAATGCTGCTGTGGG - Intergenic
969094349 4:4720626-4720648 CTAGATGAGGATGCTGAAGCTGG - Intergenic
969832065 4:9805914-9805936 CTGGTGAAGAATGCTGAGGCAGG + Intronic
969954080 4:10870380-10870402 CCTGATAAGAATCCAGATGTGGG + Intergenic
970760773 4:19483689-19483711 TTTAATAAGAATGCTGGTGCAGG + Intergenic
971865978 4:32173081-32173103 AGAGATAAGAATGCTGATGTCGG + Intergenic
974311895 4:60223125-60223147 ATTGAAAAGAATGCAGATACAGG + Intergenic
974325139 4:60404478-60404500 ATTGATGGGAATGCTGAGGCCGG - Intergenic
976546527 4:86342088-86342110 ATTGACAAGAACACTGATGCAGG + Intronic
976694664 4:87906267-87906289 CTTTTGCAGAATGCTGATGCTGG + Intergenic
978496579 4:109366044-109366066 CTTTGAAAGAATGCTGAGGCTGG - Intergenic
978885956 4:113766674-113766696 CCTGAAAATAAGGCTGATGCTGG - Intergenic
979304140 4:119122801-119122823 CTTGATGGGAATGGTGATGGTGG + Intergenic
981288108 4:143043983-143044005 CTTGATTAGAATGCATCTGCTGG - Intergenic
981427394 4:144619176-144619198 CTTGAAAAGACTGAGGATGCAGG - Intergenic
983922148 4:173357566-173357588 ATTGCTAATAAAGCTGATGCTGG - Intergenic
986327658 5:6688676-6688698 CTTGATCAGGAGGCTGAGGCAGG + Intergenic
987142106 5:14957133-14957155 CTTTATAAGAAACCTAATGCTGG + Intergenic
988868105 5:35357631-35357653 TCTGATAAGAATGCTGAAGCTGG + Intergenic
989416403 5:41182435-41182457 CTTGATTAAAATGCTGAGTCTGG + Intronic
990033830 5:51295212-51295234 CTTCATAAGGATGGTGATACAGG + Intergenic
993047075 5:82880223-82880245 CTTTATAGGAAGCCTGATGCTGG + Intergenic
993486889 5:88497779-88497801 CTGGGTATGAGTGCTGATGCAGG - Intergenic
994945205 5:106378995-106379017 CTATAAAAGAATGCTGAGGCTGG - Intergenic
995017850 5:107332008-107332030 CTTTATGGAAATGCTGATGCTGG - Intergenic
998110938 5:139502156-139502178 CATGATCAAAAAGCTGATGCTGG + Intergenic
1000687397 5:164269387-164269409 CTTTTTAAAAATGCTGATGCTGG + Intergenic
1001804795 5:174574220-174574242 CTTGTTATGAATGGTGGTGCTGG - Intergenic
1002915919 6:1527572-1527594 CCTGATGAGAATGCTGATCTGGG + Intergenic
1004185391 6:13416991-13417013 TATGATAAGAATGATGATGATGG - Intronic
1006535886 6:34698371-34698393 CTCCATCAGAATGCTGATTCAGG + Intergenic
1006994032 6:38241113-38241135 CTTAATAGAAATTCTGATGCTGG - Intronic
1009670504 6:66742307-66742329 CTTGTAAAGAATTCTGAAGCGGG - Intergenic
1010655955 6:78511215-78511237 CTAGTCAAGCATGCTGATGCTGG + Intergenic
1010830335 6:80520054-80520076 CTTGAACAGAAGGCTGATACAGG - Intergenic
1012472301 6:99585941-99585963 CTAGCTAAGATTGCTGATGAAGG - Intergenic
1012580355 6:100861542-100861564 CTGGATGAAAATGCTGATACTGG - Intronic
1014130403 6:117824972-117824994 CTAGCTAAGAACGCTGATGATGG - Intergenic
1016361956 6:143276846-143276868 CTTGGAAAGAAAACTGATGCAGG - Intronic
1017693386 6:156989762-156989784 CTTGTCAAGAGTGCTGATGGCGG + Intronic
1019896634 7:3988282-3988304 ACTGATAGGACTGCTGATGCAGG - Intronic
1021498226 7:21299729-21299751 ATTGATAAAAATGCTGATTTAGG - Intergenic
1023262865 7:38375640-38375662 CTGGAGAAGAAGGCTGCTGCGGG + Intergenic
1024097793 7:45998585-45998607 CTTGAGAAGAATGCATATTCTGG - Intergenic
1026385842 7:69846873-69846895 CTAGATTAGAAAGCTGATGTGGG - Intronic
1029008168 7:97231736-97231758 ATTGAAAAGAATGGTGAAGCTGG + Intergenic
1029357871 7:100066151-100066173 GTTGATGAGAAGGCTGATACCGG - Intronic
1033228608 7:139579873-139579895 CTTGCTAAGAATACTGATTCCGG - Intronic
1036704317 8:11035279-11035301 CTTGATGATGCTGCTGATGCTGG - Intronic
1038121203 8:24617797-24617819 CTTGCTGAGAATGCAGCTGCTGG - Intergenic
1038633907 8:29270299-29270321 CTTGAAGAGAATGGTGATGATGG - Intergenic
1038939773 8:32291648-32291670 CTTGAGAGGAAGGCTGAGGCAGG - Intronic
1038966150 8:32574715-32574737 CTTTACAAGAAGCCTGATGCTGG - Intronic
1040632071 8:49225628-49225650 CTTGATAAGAATGCATATTCTGG - Intergenic
1041099886 8:54385467-54385489 ATGGATAAGAATGCTCATGGTGG - Intergenic
1045137158 8:99233498-99233520 CTTGATAAGAATGCTGATGCGGG + Intronic
1049996069 9:1035240-1035262 CTTGAAAAGGATTCTGAGGCTGG - Intergenic
1051521639 9:17995803-17995825 CTGGATAAAAATGCTGGTGCTGG + Intergenic
1051989205 9:23130751-23130773 CTTGAAAAGAATGTTGTTCCTGG - Intergenic
1056347714 9:85716122-85716144 GTTGATAAGAATGGTGTTGGTGG - Intronic
1057454145 9:95192081-95192103 CTTTTTAAGAATGAAGATGCAGG + Intronic
1057521001 9:95760312-95760334 CTTGTTAAAAATGAAGATGCAGG + Intergenic
1058274153 9:103019066-103019088 CTTGACAAGAAAACTGATGAAGG - Intergenic
1058896875 9:109408061-109408083 CTTGTTAAAAATGCAGATTCCGG + Intronic
1059411290 9:114133906-114133928 GATGATAAGAATGGTGATGAAGG + Intergenic
1059888631 9:118775758-118775780 CTTGACAAGAATGGTTTTGCTGG + Intergenic
1186087334 X:6004566-6004588 TTTGATAGGAATGGTGAAGCAGG + Intronic
1189048350 X:37617501-37617523 CTTGATAAGAATGCAGAAGAGGG - Intronic
1193691203 X:84645658-84645680 CTTTATAAAAATGCTGCTGTTGG + Intergenic
1194706150 X:97178125-97178147 CTTGGGGGGAATGCTGATGCAGG + Intronic
1194885547 X:99311645-99311667 ATTGATAATAATGATGATGGTGG + Intergenic
1199290821 X:146103412-146103434 CTTGATGAGACTGTTGATTCTGG - Intergenic
1199339457 X:146659863-146659885 CTTGCTAAGAAGGCTGAGGGGGG + Intergenic
1199613409 X:149636184-149636206 CATGAAATGAATGCTGATGTTGG + Intergenic
1199686575 X:150270561-150270583 CTTGACTTGAATTCTGATGCTGG - Intergenic