ID: 1045145664

View in Genome Browser
Species Human (GRCh38)
Location 8:99341088-99341110
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 3, 1: 1, 2: 1, 3: 39, 4: 551}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045145664_1045145670 -1 Left 1045145664 8:99341088-99341110 CCATCCACCATCTCCTTACAAAG 0: 3
1: 1
2: 1
3: 39
4: 551
Right 1045145670 8:99341110-99341132 GGTCAGCATTCTTTTCTGCTGGG 0: 1
1: 1
2: 3
3: 16
4: 186
1045145664_1045145669 -2 Left 1045145664 8:99341088-99341110 CCATCCACCATCTCCTTACAAAG 0: 3
1: 1
2: 1
3: 39
4: 551
Right 1045145669 8:99341109-99341131 AGGTCAGCATTCTTTTCTGCTGG 0: 1
1: 0
2: 6
3: 43
4: 263
1045145664_1045145671 26 Left 1045145664 8:99341088-99341110 CCATCCACCATCTCCTTACAAAG 0: 3
1: 1
2: 1
3: 39
4: 551
Right 1045145671 8:99341137-99341159 ATTATAATGCACCTTCATGTTGG 0: 1
1: 0
2: 0
3: 18
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045145664 Original CRISPR CTTTGTAAGGAGATGGTGGA TGG (reversed) Intronic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
901155454 1:7134549-7134571 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
901549654 1:9986486-9986508 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
901790357 1:11650606-11650628 CGCTGGAAGGAGCTGGTGGACGG - Exonic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
903329470 1:22589873-22589895 TTTTGGGAGGAGATGGTGGGTGG - Intronic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
903694086 1:25194833-25194855 CAGTGTCATGAGATGGTGGAAGG + Intergenic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904345926 1:29869452-29869474 CTTTCTAAGGATATGGAGGGTGG - Intergenic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
906996271 1:50797455-50797477 CTTTGTGAGGCCATGGTGGGAGG + Intronic
907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG + Intronic
907192061 1:52657609-52657631 CTTTGGGAGGACAAGGTGGATGG + Intronic
907297986 1:53467782-53467804 CTATGGAAGGAGCTGGAGGAAGG - Intergenic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
909025587 1:70478054-70478076 CTTTGTAAGCACATGGATGAAGG - Intergenic
909122873 1:71626504-71626526 CTTTGTAGGGACATGGATGAAGG - Intronic
909663790 1:78111612-78111634 TTTTGTTAGGAGACAGTGGAAGG + Intronic
910457695 1:87414940-87414962 CTTTGAGAGGCGAAGGTGGATGG + Intergenic
910910847 1:92232407-92232429 CTTTGTAGGGACATGGATGAAGG - Intronic
911801332 1:102142262-102142284 CTTTGCAAGGACATGGATGAAGG + Intergenic
912553559 1:110499999-110500021 ATTTATAAGAAGATGGTGGGAGG - Intergenic
912800662 1:112717902-112717924 CTTTGAGAGGCCATGGTGGATGG + Intergenic
912919071 1:113847976-113847998 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
913102185 1:115578530-115578552 CTTTGTAGGGACATGGATGAAGG - Intergenic
913380678 1:118207245-118207267 CTTTGTGATGAGATGGTTGGTGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914312711 1:146481194-146481216 CTTTGGAAGGATGAGGTGGACGG + Intergenic
914501637 1:148252144-148252166 CTTTGGAAGGATGAGGTGGACGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914830791 1:151169565-151169587 CTTTGGTAGGAGGTGGGGGAGGG - Exonic
915054227 1:153111029-153111051 CTTTGCAGGGAGATGGATGAAGG + Intergenic
915657009 1:157369029-157369051 GTTTTTAAGGATATCGTGGAGGG + Intergenic
915671982 1:157497286-157497308 GTTTTTAAGGATATAGTGGAGGG - Intergenic
915755565 1:158256331-158256353 AATTGGAAGGAGGTGGTGGAAGG - Intronic
915919417 1:159963018-159963040 ATTTAGAAGGAGATGGTGGGTGG + Intergenic
916620755 1:166493952-166493974 CTTTGTAGGGACATGGATGAAGG - Intergenic
916621548 1:166503487-166503509 CTTTGTAGGGACATGGATGAAGG + Intergenic
916810719 1:168303339-168303361 CTTTGTAGGGACATGGATGAAGG - Intronic
916818495 1:168375605-168375627 CTTTGAAAGGAGGTGGAGAAAGG + Intergenic
916836418 1:168550381-168550403 CTTTGTAGGGACATGGATGAAGG + Intergenic
916906941 1:169296248-169296270 CTTTGTAAGGTGAATGTTGATGG - Intronic
917010892 1:170469713-170469735 CTTTGTAGGGACATGGATGAAGG + Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917170447 1:172167217-172167239 CTTTGTAGGGACATGGATGAAGG - Intronic
917331096 1:173881252-173881274 CTTTGTAGGGACATGGATGAAGG - Intronic
917895991 1:179487749-179487771 CTTTGTAAGGCCAAGGTGGGAGG + Intronic
918063936 1:181086910-181086932 CTTTGGAAGGACAAGGTGGGCGG - Intergenic
918961077 1:191278774-191278796 GGTTGTCAGGAGATGGAGGAGGG - Intergenic
920722733 1:208402700-208402722 ATTGGTAAGGAGGTGGTGGATGG - Intergenic
921994662 1:221405191-221405213 CTTTGATAGGAGATGGTCAAGGG - Intergenic
922313085 1:224414734-224414756 CTTTGGAAGGACAAGGTGGGAGG + Intronic
922431880 1:225562701-225562723 TTTTGTAAGTAAATGGTGGGTGG + Intronic
923053116 1:230402729-230402751 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
923218601 1:231873040-231873062 CTGTGGAAGAAGATGGTGGGAGG + Intronic
924587864 1:245375746-245375768 CTTGGTAAGGAGAAGCGGGATGG + Intronic
924763904 1:247013636-247013658 CTTTGTCAGGAGCTGGGGGTAGG - Intergenic
1062789925 10:296731-296753 CTTTGTAGGAACATGGAGGAAGG + Intronic
1063457586 10:6195193-6195215 CTTTGGAAGAAGATGGTGTCAGG + Intronic
1064056113 10:12098925-12098947 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
1065097645 10:22297436-22297458 CTTTGGAAGGCAAAGGTGGAAGG + Intergenic
1065480402 10:26187789-26187811 CTTTGTAGGGACATGGATGAAGG - Intronic
1065759212 10:28966356-28966378 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1066326745 10:34368007-34368029 CTTTGGAAGGCCATGGTGGGTGG + Intronic
1066368294 10:34797742-34797764 AGTTGTAATGAGATGGGGGAAGG - Intronic
1067319360 10:45203124-45203146 CTTTGCAAGGACATGGATGAAGG - Intergenic
1067932321 10:50575308-50575330 CTTTATAAGGCTATGGTGGGTGG + Intronic
1068490238 10:57714023-57714045 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1069598580 10:69688495-69688517 CTGTGTCATGACATGGTGGAAGG - Intronic
1069717085 10:70528078-70528100 CTTTGTAGGGACATGGATGAAGG - Intronic
1069943388 10:71970253-71970275 CTTTGTGAGGAGGTGGTGGGGGG - Intronic
1071097388 10:81993588-81993610 CTTTGTGAGGACATGGTGGGAGG - Intronic
1071355135 10:84786115-84786137 CTTTGGAAGGACAAGGTGGGTGG + Intergenic
1071450279 10:85787026-85787048 CATTGATGGGAGATGGTGGATGG - Intronic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1072360778 10:94656971-94656993 CTTTGTAGGGACATGGATGAAGG - Intergenic
1072442338 10:95468195-95468217 CTTTGTTAGAAGATGGTAAAGGG - Intronic
1072869750 10:99104755-99104777 CTTTGTAAGGACATGGCTGAAGG + Intronic
1073825400 10:107314968-107314990 CGTTGTAAAGTGATAGTGGATGG + Intergenic
1074355797 10:112781982-112782004 CTAGGAAAGGAGATGCTGGAAGG - Intronic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1074692138 10:116015898-116015920 CTTTGTTATTAGATGGTGAAGGG - Intergenic
1074796994 10:116957030-116957052 CTTTGGAAGGACAAGGTGGGAGG - Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1075733231 10:124648609-124648631 CATTGTGAGGGCATGGTGGAGGG - Intronic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1077067829 11:651638-651660 CTTTGAAAGGAGACTGAGGAGGG + Intronic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1078372924 11:10765703-10765725 CTTTGGGAGGCCATGGTGGATGG - Intronic
1078493924 11:11797086-11797108 CTTTGTAGGGACATGGATGACGG - Intergenic
1079756254 11:24267729-24267751 CTTTGTAGGGACATGGATGAAGG - Intergenic
1080478877 11:32624874-32624896 CTTTGTAGGGACATGGATGAAGG + Intronic
1080618768 11:33968742-33968764 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081875762 11:46407476-46407498 CTCTGGGAGGAGGTGGTGGAAGG - Intronic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082887166 11:58097932-58097954 GTTTGTAAGGAAATGGAGCATGG + Intronic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1084017898 11:66397440-66397462 CTTTGGAAGGACAAGGTGGGAGG - Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084928609 11:72535598-72535620 CTTTGGAAGGCCATGGTGGGAGG + Intergenic
1085594350 11:77794437-77794459 CTTTGCAAGGACAAGGTGGGAGG + Intronic
1085986566 11:81794593-81794615 CTTTGTAGGGACATGGATGAAGG - Intergenic
1086460781 11:87003556-87003578 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087110684 11:94463624-94463646 CTTTGTAGGGACATGGATGAAGG + Intronic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1087798191 11:102476506-102476528 GCATGTAAGGAGATGGTGAAAGG + Intronic
1088577633 11:111287114-111287136 CTTTGGAAGGCCATGGTGGATGG - Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089799995 11:121019790-121019812 CTTTGGAAGGTCAAGGTGGAAGG + Intergenic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1092675707 12:10916571-10916593 CTATGAAAAGAGTTGGTGGAAGG + Intronic
1092778465 12:11964224-11964246 CTTTCTATGGACATGGTGTAAGG - Intergenic
1093450801 12:19311180-19311202 CTTTGGAAGGATAAGGTGGGAGG + Intronic
1094205681 12:27838030-27838052 CTTTGTAAGAAGCTGTTGAAAGG - Intergenic
1095594042 12:43938754-43938776 CTTTGGAAGGCCAAGGTGGATGG + Intronic
1095890678 12:47233148-47233170 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096793045 12:54056992-54057014 GTTTGTTAGGAGAAGGTGGGAGG + Intergenic
1097669172 12:62515570-62515592 CTTTGTAAGGCCAAGGTGGATGG + Intronic
1098023797 12:66182030-66182052 CTTTGTGAGGCTAAGGTGGAAGG + Intergenic
1098427889 12:70386606-70386628 TTTTTTAAGGAGATGGGGAAAGG + Intronic
1098556302 12:71822706-71822728 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1098751355 12:74297040-74297062 TTTTGTAAAGAGTTGCTGGAGGG - Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1100051310 12:90451601-90451623 CTTTGTAGGGACATGGATGAAGG - Intergenic
1100994221 12:100284926-100284948 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
1101273083 12:103168853-103168875 CTTTGTAGGGACATGGATGAAGG + Intergenic
1102678936 12:114677074-114677096 CTTTGAAAGGGGGTGGGGGAGGG + Intronic
1103127470 12:118436419-118436441 CTTTGCAGGGAAATGGTGGCAGG - Intergenic
1103980749 12:124735526-124735548 CTTTGGAAGGCCAAGGTGGACGG + Intergenic
1104260967 12:127181674-127181696 CTTTGGAAGGCCAAGGTGGATGG - Intergenic
1104263381 12:127206145-127206167 CTTTATAAAAACATGGTGGAGGG - Intergenic
1104557923 12:129818789-129818811 CTTTGGAAGGCCAAGGTGGATGG + Intronic
1104915219 12:132260883-132260905 CTTAGGAGGGGGATGGTGGAGGG + Intronic
1106345229 13:28870493-28870515 CAATGTAAGGAGATGGGGAATGG - Intronic
1107212996 13:37880674-37880696 CTTTGTAAGGCCAAGGTGGGAGG - Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1109241010 13:59888251-59888273 CTGTGTTCTGAGATGGTGGAGGG - Intronic
1109309111 13:60671767-60671789 CTTTGCATGGGGATGGGGGATGG + Intergenic
1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1111535132 13:89594010-89594032 CTTTGTAATGAGATTCTGTATGG + Intergenic
1112411334 13:99166140-99166162 CTATGCATGGAGATGGTTGAAGG + Intergenic
1112635591 13:101214138-101214160 CTTTGTAGGGACATGGATGAAGG + Intronic
1113362437 13:109643823-109643845 CTTTGTAGGGACATGGGTGAAGG - Intergenic
1113418967 13:110155136-110155158 CTTTGGAAGGGGATGGTTGGAGG + Intronic
1115288613 14:31745349-31745371 CTTTGTAGGGACATGGATGAAGG - Intronic
1115340458 14:32288071-32288093 CTTTGCAAGGACATGGATGAAGG - Intergenic
1115505316 14:34088170-34088192 ATTAGTAAGGAGAAGATGGAAGG + Intronic
1115523371 14:34255043-34255065 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
1116125525 14:40779456-40779478 CTTTGGAAGGCCATGGTGGGAGG + Intergenic
1116513041 14:45770219-45770241 CTTTGTAGGGACATGGATGAAGG - Intergenic
1116717034 14:48440440-48440462 CTTTGTAGGGACATGGATGAAGG + Intergenic
1117698325 14:58388879-58388901 CCTTTTAAGGAAATGGTGCAGGG + Intergenic
1118790322 14:69085731-69085753 TTTTGTAAAGAGAAGGTAGAGGG - Intronic
1120794020 14:88611336-88611358 CTTTGGAAGGCCACGGTGGAAGG - Intronic
1121019816 14:90573069-90573091 CTTTGTGAGAAGATGGCAGAGGG - Intronic
1121062179 14:90922690-90922712 CTTTGGAAGGCCAAGGTGGATGG - Intronic
1121318601 14:92977256-92977278 CTCTGTAAGGTGATCTTGGATGG - Intronic
1121751354 14:96360093-96360115 CTTTGTAAAGAGAAAGTGAATGG + Intronic
1121856047 14:97271036-97271058 CTTTATAAAGAGAGGATGGATGG - Intergenic
1122572129 14:102712115-102712137 CTTTGCAAGGCCATAGTGGAAGG - Intronic
1122589541 14:102837380-102837402 CTTTGGAAGGTCAAGGTGGAAGG - Intronic
1122668546 14:103352093-103352115 CTTTGGGAGGACAAGGTGGAAGG + Intergenic
1123539052 15:21269235-21269257 CTTTGTAAGGCCCAGGTGGATGG + Intergenic
1125607078 15:40945693-40945715 CTTTGGAAGGCCAAGGTGGACGG + Intergenic
1125697928 15:41654755-41654777 CTTTGGGAGGAGGAGGTGGAAGG - Intronic
1126522509 15:49612389-49612411 CTTTGTAGGGACATGGATGAAGG - Intronic
1127545519 15:59991369-59991391 CTTTGGATGGATATCGTGGATGG - Intergenic
1129719817 15:77871919-77871941 CCCTGTAAGGAGCTGGTGGCAGG + Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1132673378 16:1111640-1111662 CTTTGTAAGGCCAAGGTGGGTGG - Intergenic
1133849781 16:9491614-9491636 ATTTGCAAGGAGACTGTGGAGGG + Intergenic
1133901614 16:9980680-9980702 CTTTGTAGGGACATGGATGAAGG + Intronic
1134008636 16:10835036-10835058 CTGAGTCAGGAGATGGTTGAAGG - Intergenic
1134202255 16:12208942-12208964 CTTTGTTAGGGGCTGGTAGAAGG + Intronic
1134813963 16:17190592-17190614 CTTTGTAGGGACATGGATGAAGG - Intronic
1134828662 16:17305655-17305677 CTTTGGGAGGCGGTGGTGGAGGG - Intronic
1135113359 16:19707663-19707685 CTGTGTAGGGAGGTGGGGGAGGG - Intronic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1135883634 16:26283550-26283572 CCTTGAAATGAGATGGTTGAAGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1139466672 16:67157752-67157774 TTTTGTCAGAAGATGGAGGAAGG - Intronic
1140029058 16:71319687-71319709 CTTTGGAAGGCCAAGGTGGACGG - Intergenic
1140046957 16:71446248-71446270 CATGGTAAGGAGATGGTGTGTGG + Intergenic
1140105650 16:71957552-71957574 CTTTGGGAGGAGAAGGTGGGAGG + Intronic
1140110341 16:71998692-71998714 CTTTGGAAGGTGGAGGTGGATGG - Intronic
1140240955 16:73199727-73199749 CTTTGGGAGGCCATGGTGGATGG + Intergenic
1140581243 16:76233741-76233763 TTTAGTAAGTCGATGGTGGATGG - Intergenic
1140833121 16:78769761-78769783 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
1142029751 16:87832613-87832635 TTTTTTAAGGAGCTGGGGGAAGG - Exonic
1142564710 17:832495-832517 ATTTTTAAGGAAATGGTGGTGGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144133727 17:12272572-12272594 CTTTGCAAGGACATGGATGAAGG - Intergenic
1144382944 17:14720782-14720804 CCTAGTAATGGGATGGTGGAAGG - Intergenic
1145013822 17:19384344-19384366 CCTTGTAAGGAGTTGGTGCTCGG + Exonic
1145090654 17:19983133-19983155 CTTTGTAAGGCCAAGGTGGGTGG + Intergenic
1145725642 17:27120541-27120563 CTTTGGGAGGCCATGGTGGATGG + Intergenic
1146906175 17:36619422-36619444 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1147714150 17:42492770-42492792 CTTTGTGGGGACAAGGTGGAAGG + Intronic
1148548103 17:48532088-48532110 TTTTGGAAGGAGATGGAGGGTGG - Intergenic
1148674617 17:49438262-49438284 CTTTGTGAGGTGCTGGTGCAGGG + Intronic
1148715371 17:49711899-49711921 CTTTGGAAGGCCAAGGTGGATGG + Intronic
1148737674 17:49874018-49874040 CTTTTTATGGAGATGGAGGTGGG - Intergenic
1149888210 17:60361979-60362001 CTTTGTATGGACATAGTAGAAGG - Intronic
1150695615 17:67402509-67402531 CTTTGTCAGGAAATGGCGGAGGG - Intronic
1151300525 17:73221643-73221665 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151623194 17:75259904-75259926 CTTTGTAAGGGAAAGGTGGGAGG + Intronic
1151875702 17:76867185-76867207 CTGGCTAAGGAGATGTTGGAGGG - Intergenic
1152238110 17:79148897-79148919 GTTTGTAAGGTCATGGGGGATGG + Intronic
1152350811 17:79783130-79783152 CCTTGAAAGCTGATGGTGGACGG + Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152656918 17:81524089-81524111 CTTTCTGAGGTGCTGGTGGACGG - Intergenic
1153265480 18:3264541-3264563 CTTTGCAAGGAGTGGGTGGCAGG - Intronic
1153562535 18:6385559-6385581 CTTTGAATGGAGATGGTGGTAGG - Intronic
1153586487 18:6626059-6626081 CTCTGGATGGAGATGGTGGATGG + Intergenic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1155021178 18:21898256-21898278 CTTTGAAAGGAGGTGGTGGCAGG - Intergenic
1155380618 18:25218332-25218354 CGTGGTAAGGGGATGGTGGGAGG + Intronic
1155492332 18:26411540-26411562 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1155524869 18:26705786-26705808 CTTTGAAAGGCCATGGTGGGAGG - Intergenic
1155533980 18:26796421-26796443 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1157208033 18:45717218-45717240 CTCTTTGAGGAGATGGTGGGGGG - Intergenic
1157217214 18:45794363-45794385 CTTTGTAGGGACATGGATGAAGG - Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157640840 18:49212738-49212760 CTTTGGAAGGCCAGGGTGGATGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157802224 18:50630063-50630085 CTGTGTTGGGAGATGGGGGAGGG + Intronic
1159165218 18:64690506-64690528 CTTTGTAGGGACATGGATGAAGG + Intergenic
1159206927 18:65265154-65265176 CTTTGTGAGGCCAAGGTGGATGG - Intergenic
1159263885 18:66053687-66053709 ATTTTTAAGGGGTTGGTGGAAGG + Intergenic
1159455168 18:68652313-68652335 CTTTGTAGGGACATGGATGAAGG - Intergenic
1159630321 18:70741677-70741699 CTTTGTAGGGACATGGATGAAGG + Intergenic
1159673038 18:71246788-71246810 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1159737858 18:72124714-72124736 CTTTGTAGGGACATGGATGAAGG + Intergenic
1161882047 19:6962379-6962401 CTTTGTAGGGACATGGATGAAGG + Intergenic
1162359399 19:10208913-10208935 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
1162651094 19:12089642-12089664 CTTTGGAAGGCCAAGGTGGATGG - Intergenic
1163436131 19:17296295-17296317 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
1163586273 19:18165800-18165822 CTTTGTTAGGGGTTGTTGGAAGG + Intronic
1165919206 19:39282918-39282940 CTTTGGAAGGACAAGGTGGGAGG - Intergenic
1165958431 19:39515924-39515946 TTCTGTAAGGAGATGGCCGACGG - Exonic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166412389 19:42564577-42564599 CTTTGTATGGAGATCATTGAGGG + Intergenic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
1167261770 19:48462806-48462828 CTTTGCGAGGGGGTGGTGGAGGG + Intronic
1167316048 19:48763328-48763350 CTTTGTAAGGCCAGGGTGGGCGG + Intergenic
1167691448 19:50986460-50986482 GTCTTGAAGGAGATGGTGGAGGG + Intergenic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
925459853 2:4051540-4051562 CTTTGGAAGGTGGAGGTGGAAGG + Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926553325 2:14326909-14326931 CTTTGTACGGACATGGATGAAGG - Intergenic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
926939131 2:18116577-18116599 ATTTGAAAGGAGGTGGTAGAGGG - Intronic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927910127 2:26891561-26891583 TTTTGAAAGGAGATGGGTGAGGG - Intronic
929535712 2:42783133-42783155 CTTTGTTGGCTGATGGTGGAGGG - Intronic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
929954463 2:46444852-46444874 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931061087 2:58530663-58530685 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
931475289 2:62581189-62581211 CTTTGTAGGGACATGGATGAAGG - Intergenic
932482296 2:72051714-72051736 CTCTGGAAGGAGGTGATGGAAGG - Intergenic
932667580 2:73709326-73709348 TTTTGTAAGGTGCTGGTGCAGGG - Intergenic
932894939 2:75630541-75630563 CTTTGGGAGGCCATGGTGGATGG + Intergenic
933056846 2:77681125-77681147 ATTTCAAAGGAGGTGGTGGAGGG - Intergenic
933926979 2:87102269-87102291 ATTTCAAAGGAGGTGGTGGAGGG - Intergenic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
935600540 2:104917629-104917651 CTTTGTAAGGAAGTGAGGGAAGG + Intergenic
936233800 2:110726129-110726151 CTCTCTAAGGAGCTGCTGGAAGG - Intergenic
936896483 2:117433565-117433587 GTTTGTAAGAAGATGGTGAATGG + Intergenic
936943061 2:117905430-117905452 CTTTGTAGGGACATGGATGAAGG - Intergenic
938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG + Intergenic
938604960 2:132882947-132882969 CTTTGGAAGGACAAGGTGGGAGG + Intronic
939544556 2:143536671-143536693 CTTTGTAGGGACATGGATGAAGG - Intronic
940484230 2:154276477-154276499 CTTTGGGAGGCAATGGTGGATGG - Intronic
941100713 2:161292019-161292041 CTTTGTAGGGACATGGATGAAGG + Intergenic
941367843 2:164628445-164628467 CTTTGTAGGGACATGGATGAAGG - Intergenic
941396301 2:164977913-164977935 CTTTGTAAGGCCCAGGTGGATGG + Intergenic
942198674 2:173549096-173549118 CTTTAAAAGGATTTGGTGGAAGG + Intergenic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
943285239 2:185990234-185990256 CTTTGTAGGGACATGGATGAAGG + Intergenic
944088239 2:195874312-195874334 CAGTTTAAGGAGATGGTGAAAGG + Intronic
945278854 2:208016399-208016421 CTTTGGGGGGAGATGGTGGCAGG + Intronic
945289035 2:208109841-208109863 CTTTGGAAGGCCAGGGTGGAAGG + Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
946220084 2:218218020-218218042 CTTTTAAAGGAGATGGGGGTGGG - Intronic
946684251 2:222251402-222251424 CTTTGTAGGGACATGGATGAAGG - Intronic
946775538 2:223136342-223136364 CTTTGTGAGAAGATGGAGGCTGG + Intronic
947898644 2:233699962-233699984 CTTTGTTGGGAGTTGGGGGACGG - Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
948363951 2:237442591-237442613 CTCTGTAGGGAGAGGGAGGAAGG + Intergenic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
948861784 2:240756113-240756135 CCTTGGGTGGAGATGGTGGAAGG - Intronic
1169316568 20:4595953-4595975 CTTTGTAAGGCCAAGGTGGGTGG - Intergenic
1170222684 20:13957631-13957653 CTTTGGAAGGACAAGGTGGCCGG + Intronic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172535284 20:35667984-35668006 CTTTGGGAGGCGAAGGTGGATGG - Intronic
1172977265 20:38915731-38915753 CTTTGGGAGGCTATGGTGGATGG - Intronic
1173808694 20:45942854-45942876 CTTTGGAAGGCTAAGGTGGAAGG - Intronic
1174241375 20:49138039-49138061 CTTTTTAAGGACAAGGTGGGTGG + Intronic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175578829 20:60082959-60082981 ATATGTAAGGAGATTATGGAAGG + Intergenic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1176678172 21:9800780-9800802 ATTTGTGTGGGGATGGTGGAAGG + Intergenic
1176918049 21:14649524-14649546 CTTTGAAAGGCCAAGGTGGATGG + Intronic
1177087952 21:16730679-16730701 CTTTGTAGGGACATGGATGAAGG - Intergenic
1178284595 21:31315125-31315147 CTTTGGAAGGCCATGGCGGATGG + Intronic
1178882579 21:36461041-36461063 CTTTGTAGGCAGCTGGTGGCTGG + Exonic
1179141851 21:38732669-38732691 TTTGCCAAGGAGATGGTGGAAGG - Intergenic
1179633168 21:42691152-42691174 CTTTGGATGGTGATGGTGAAGGG - Intronic
1179633204 21:42691342-42691364 CTTTGGATGGTGATGGTGAAGGG - Intronic
1179633317 21:42691954-42691976 CTTTGGATGGAGATGGTGAAGGG - Intronic
1180795199 22:18600357-18600379 CTTTGGAAGGCCAAGGTGGATGG - Intergenic
1181226540 22:21394955-21394977 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1181252109 22:21539883-21539905 CTTTGGAAGGCCAAGGTGGATGG - Intergenic
1181382442 22:22517161-22517183 CTTTGTAAGGCCAAGGCGGAAGG + Intronic
1182029012 22:27142982-27143004 CTTTGGAAGGACAAGGTGGGTGG - Intergenic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
1183613766 22:38928925-38928947 CTTTGGAAGGCCAAGGTGGATGG - Intergenic
1184376392 22:44116548-44116570 CTCTGTAAGGATGTGGTGAATGG - Intronic
1185291056 22:50028000-50028022 CTTTGGAAGCAGCTGGTGGGTGG + Intronic
949932941 3:9093717-9093739 CTTTGAAAAGAGATTTTGGATGG - Intronic
950230242 3:11269921-11269943 CTTTGTGAGGTGAAGGTGGGAGG + Intergenic
952195908 3:31075152-31075174 CCTAGTAAAGAGATGGTGGGGGG + Intergenic
952534323 3:34294340-34294362 CTTGGTATGTGGATGGTGGATGG + Intergenic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
953609878 3:44438709-44438731 CTTTGTAGGGACATGGATGAAGG + Intergenic
953775317 3:45811825-45811847 CTTTGGAAGGAGATGGTGCCTGG + Intergenic
954309542 3:49754438-49754460 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
954761880 3:52880661-52880683 CTTTGTAAGGAGGCAGTTGATGG - Intronic
955584149 3:60458275-60458297 CTTTGTAGGGACATGGATGAAGG + Intronic
955739357 3:62073722-62073744 CTTTGTGAGGCCAAGGTGGATGG - Intronic
955796717 3:62644837-62644859 CTTTGAGAGGAGATAGTGGGAGG - Intronic
955993155 3:64650210-64650232 CTTTTTAACCAGATGGTGTAAGG - Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
956021475 3:64937921-64937943 CTTTGGAAGGCCAAGGTGGAAGG - Intergenic
956222513 3:66919613-66919635 CTTTGTAGGGACATGGATGAAGG + Intergenic
956330489 3:68101526-68101548 CTTTGTAGGGACATGGATGAAGG + Intronic
956790593 3:72677188-72677210 CTTTGTTAGGAGATCTTGGGCGG - Intergenic
957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG + Intronic
957343811 3:78936651-78936673 ATTTGTAAGTATATGGGGGAGGG + Intronic
957466473 3:80599423-80599445 CTTTGTAGGGACATGGATGAAGG + Intergenic
958019100 3:87977081-87977103 ATATGTAAGGGGATGGTGGGAGG - Intergenic
958671288 3:97208500-97208522 CTTTGGAAGGCCATGGTGGGTGG + Intronic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
960221478 3:115115017-115115039 CTTTGTAATAAGATGGAGAATGG - Intronic
960435512 3:117621757-117621779 CTTTGGGAGGATATGGTGGGAGG + Intergenic
961141865 3:124562820-124562842 CTTTGGAGGGTGGTGGTGGAGGG - Intronic
962453951 3:135548015-135548037 CTTTGGAAGGCCCTGGTGGATGG + Intergenic
962605715 3:137031340-137031362 CTTTGGAAGGCTAAGGTGGAAGG - Intergenic
964572582 3:158125060-158125082 CTTTGGAAGGATAAGGTGGGAGG - Intronic
964630810 3:158808331-158808353 CGGTGTAAGGATATGGAGGAAGG + Intronic
964665211 3:159164522-159164544 CTTTGTAAGGCCAAGGTGGGCGG + Intronic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
967218496 3:187229741-187229763 CTAGGTAGGGAGAAGGTGGAAGG - Intronic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967761914 3:193235340-193235362 CTTTGGAAGGCCAAGGTGGATGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
969178479 4:5418884-5418906 CTTAGTTTGGACATGGTGGAGGG + Intronic
969742562 4:9042361-9042383 CTTTGGGAGGACAAGGTGGATGG - Intergenic
970125854 4:12809823-12809845 CTTTGCAAGGAAAGGGTAGAAGG + Intergenic
971402599 4:26290084-26290106 CTTTGGGAGGACATGGTGGGAGG + Intronic
972760368 4:42097220-42097242 CTTTGGGAGGAGGTGGTGGGTGG + Intergenic
973231750 4:47846754-47846776 CTTTGTAGGGACATGGATGAAGG + Intergenic
974563443 4:63553002-63553024 CTCTGTTAGGGGATTGTGGAAGG - Intergenic
976106048 4:81618623-81618645 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
976208602 4:82645068-82645090 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
976638983 4:87317650-87317672 CTTTGTGAGGCCAAGGTGGAAGG - Intronic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
976890047 4:90035566-90035588 CTTTGCAAGGACATGGATGAAGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977166350 4:93703793-93703815 CTTTGTAGGGACATGGATGAAGG - Intronic
977207870 4:94183916-94183938 CTTTGTAGGGACATGGATGAAGG + Intergenic
977342450 4:95775898-95775920 CTTTGTAGGGACATGGATGAAGG + Intergenic
977543565 4:98348263-98348285 CTTTGTAGGGACATGGATGAAGG - Intronic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG + Intronic
978508810 4:109492961-109492983 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
979006690 4:115307830-115307852 ATTTTTAAGGTGATGGAGGATGG - Intergenic
979153812 4:117356695-117356717 CTTTGTAAGGCCAAGGTGGGTGG + Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979607145 4:122650741-122650763 CTTTGTGAGGCCAAGGTGGATGG + Intergenic
980538187 4:134158131-134158153 ATTTGTAGGGAGATGGGGGAGGG - Intergenic
980631572 4:135442910-135442932 CTTTGGAAGGACAAGGTGGGCGG + Intergenic
980788365 4:137584435-137584457 TATTGTAAGGAAATGGTGGGTGG + Intergenic
981212119 4:142119489-142119511 CTTTGTAGGGATATGGATGAAGG + Intronic
981980781 4:150788339-150788361 CTTTGGGAGGAGTAGGTGGATGG - Intronic
982126353 4:152187113-152187135 CTTTCTTGGGAGATGATGGAAGG + Intergenic
982516648 4:156359601-156359623 CTTTGGAAGGCGAAGGTGGGTGG - Intergenic
982786306 4:159540791-159540813 CTATGTGAGCAGGTGGTGGAAGG + Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
984815479 4:183832231-183832253 CTTTGGAAGGCCATGGTGGGCGG - Intergenic
985376778 4:189349032-189349054 CTTTGTAGGGACATGGATGAAGG - Intergenic
986555138 5:9002770-9002792 CTTTGTAGGGACATGGATGAAGG - Intergenic
987150122 5:15029887-15029909 CTTTGCGAGGAGTTTGTGGAAGG + Intergenic
987490523 5:18575340-18575362 CTTTGTAGGGACATGGATGAAGG + Intergenic
987629397 5:20448197-20448219 CTTTGTAGGGACATGGATGAAGG - Intronic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989680205 5:44019566-44019588 CTTTGTAGGGACATGGATGAAGG + Intergenic
990436651 5:55799304-55799326 CTTTGGAAGGACAAGGTGGGAGG - Intronic
990742953 5:58930884-58930906 ATTTGACAGAAGATGGTGGATGG + Intergenic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
990849631 5:60188242-60188264 CTCTTTAAGGAGATGTTGGTAGG + Intronic
991100272 5:62784224-62784246 CTTTGTAGGGACATGGATGAAGG - Intergenic
991425576 5:66488631-66488653 CTTTGGGAGGCCATGGTGGAAGG + Intergenic
991560455 5:67945960-67945982 CTTAGTTAGGTAATGGTGGAAGG - Intergenic
992642568 5:78780624-78780646 CATTGTATTGAGACGGTGGAGGG + Exonic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
994629929 5:102272710-102272732 CTTTGGAAGGACAAGGTGGGTGG + Intronic
995641903 5:114266828-114266850 CTTTACAAGGAGATGCTGGTGGG - Intergenic
996013760 5:118508313-118508335 CTTAGAAAGGAGCTGGAGGAGGG + Intergenic
996059525 5:119017753-119017775 CTTTGGGAGGTGATGGAGGAGGG + Intergenic
996253927 5:121374653-121374675 CTTTGTAGGGACATGGATGAAGG + Intergenic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996316701 5:122168465-122168487 CTTTGTGAGGCCAAGGTGGATGG + Intronic
996451195 5:123626849-123626871 CTTTGGGAGGACAAGGTGGATGG + Intergenic
996552864 5:124748030-124748052 TTTTTTAAGGAGATGGCGAATGG + Intronic
996602545 5:125281822-125281844 CTTAGTAATGAGATGTTTGAAGG + Intergenic
997264115 5:132485153-132485175 CTTTGGAAGGCGAAGGTGGGTGG - Intronic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997557674 5:134815001-134815023 CTTTGGAAGGCCATGGTGGGAGG + Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998491479 5:142550944-142550966 CTTTGGAAGGATAAGGTGGACGG - Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999665682 5:153910597-153910619 CTTTGTAGGGACATGGATGAAGG + Intergenic
999759239 5:154687724-154687746 CTTTGGAAGGCGAAGGTGGCAGG + Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1002185056 5:177450546-177450568 CTATGGAAGGAGATGCTGGAGGG - Intronic
1003628355 6:7764288-7764310 CTTTTTCTGGAGGTGGTGGAAGG + Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1004222277 6:13757057-13757079 CTTTGGGAGGCGAAGGTGGATGG + Intergenic
1004305608 6:14499374-14499396 CTTTGTAAGGCCAAGGTGGGAGG - Intergenic
1004314346 6:14572847-14572869 CTTGGTAATGAGATGGGGGCGGG + Intergenic
1007460715 6:42016826-42016848 CTTTGGAAGGCCATGGTGGTTGG - Intronic
1008165014 6:48126207-48126229 CCTTGTAGTGAGATGGGGGATGG - Intergenic
1009037770 6:58138729-58138751 CCACGTAAGGAGATGGAGGAGGG + Intergenic
1009213557 6:60892367-60892389 CCACGTAAGGAGATGGAGGAGGG + Intergenic
1009312245 6:62169892-62169914 CTTTGTCTGGTGAGGGTGGATGG - Intronic
1009449625 6:63786061-63786083 CTTTGTAAGGATATGTTAGCTGG + Intronic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1010082367 6:71878760-71878782 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG + Intergenic
1010362203 6:75008047-75008069 CTTTGTAGGGACATGGATGAAGG + Intergenic
1011006469 6:82651175-82651197 CTTTGTAGGGACATGGATGAAGG + Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1012029947 6:94046296-94046318 CTTTCTGAAGAGAAGGTGGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1013745078 6:113335593-113335615 CTTTGCAGGGACATGGTTGAGGG - Intergenic
1013837115 6:114345707-114345729 ATTTGGGAGGAGAAGGTGGAAGG + Intergenic
1014745090 6:125191440-125191462 TTTTGAAAGGAAATGGTGAAGGG + Intronic
1015283270 6:131456860-131456882 CTTTGAAAGGCCATGGTGGGAGG + Intergenic
1015293158 6:131561100-131561122 CTTTGGAAGGCCAAGGTGGAAGG - Intergenic
1015429814 6:133117954-133117976 CTTTGTAGGGACATGGATGAAGG - Intergenic
1015802778 6:137077518-137077540 CTTTGTGAGGAAAAGGTGGGAGG + Intergenic
1016031952 6:139346956-139346978 CTTTGGGAGGAGGAGGTGGACGG + Intergenic
1017152076 6:151289787-151289809 CTTTGTAAAGGGAGGGTGGTGGG + Intronic
1018782547 6:167081229-167081251 CTTTGTAGGGACATGGATGAAGG - Intergenic
1019539912 7:1546861-1546883 CTTTGGCAGGAGTTGGTGGGTGG + Exonic
1019692479 7:2424108-2424130 CTTTGGAAGGCCATGGTGGGAGG + Intronic
1021362245 7:19730011-19730033 CTTTGGGAGGTCATGGTGGACGG + Intronic
1021430707 7:20555803-20555825 CTTTGTAGGGATATGGATGAAGG + Intergenic
1021478563 7:21090764-21090786 CTTTGTAGGGACATGGTTGAAGG + Intergenic
1021961842 7:25880958-25880980 CTATGTTAGGAGGTGGTGTATGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023907329 7:44531886-44531908 ATTTGTGGGGAGATGGGGGACGG - Intronic
1026411029 7:70123117-70123139 CTTTGGAAGGCCAAGGTGGATGG - Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026774128 7:73220714-73220736 CTATGTGAGTAGCTGGTGGAGGG + Intergenic
1026823013 7:73562287-73562309 CTTTGGAAGGCCAAGGTGGACGG + Intergenic
1027014985 7:74774100-74774122 CTATGTGAGTAGCTGGTGGAGGG + Exonic
1027073046 7:75171853-75171875 CTATGTGAGTAGCTGGTGGAGGG - Intergenic
1027413383 7:77946876-77946898 CTTTGGAAGGCCAAGGTGGATGG + Intronic
1027823948 7:83086911-83086933 CTTTGTAGGGACATGGATGAAGG + Intronic
1028206628 7:88024849-88024871 CTTTGTAGGGACATGGATGAAGG - Intronic
1028744206 7:94309075-94309097 CTTTGGGAGGACAAGGTGGATGG - Intergenic
1029313631 7:99691136-99691158 CTTTGTAGGGACATGGATGAAGG + Intronic
1029673044 7:102047223-102047245 CTCTGTTAAGTGATGGTGGATGG + Intronic
1030289223 7:107855729-107855751 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1030314335 7:108098471-108098493 CTTTGTAAAGAGAACGTGGAAGG - Exonic
1030540028 7:110818803-110818825 CTTTGTAGGGACATGGATGAAGG + Intronic
1031476641 7:122230873-122230895 CTTTGGGAGGACATGGTGGGAGG + Intergenic
1031790270 7:126093626-126093648 CATGGCAAGGACATGGTGGAAGG - Intergenic
1032116590 7:129122865-129122887 CTTAGTAAGGAACTGGTGGAGGG + Intergenic
1032154658 7:129458207-129458229 CTTAGTGAGGAGTTGCTGGAGGG - Exonic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034397300 7:150836813-150836835 CTTACTAAGGAGATGGAGCAAGG + Intronic
1034488049 7:151378560-151378582 TTTTGTGAGGAGATGATGGAAGG + Intronic
1034865032 7:154634309-154634331 CTTTGTAGGGACATGGATGAAGG - Intronic
1034936715 7:155204703-155204725 CTTTGGGATGGGATGGTGGAGGG - Intergenic
1034970985 7:155418959-155418981 CTCTGTGAGGAGGTGGAGGAAGG + Intergenic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1036566366 8:9941636-9941658 CTTTGTAGGGACATGGATGAAGG + Intergenic
1037403366 8:18515854-18515876 CTTTGTGAGGAGATGAAGGCTGG + Intergenic
1038414264 8:27382189-27382211 CTTTGGAAGGCCAAGGTGGATGG - Intronic
1039353979 8:36795053-36795075 CTTTGCAAGGAGATGGGGCAGGG + Intronic
1039469859 8:37806771-37806793 CTTTGGGAGGACAAGGTGGATGG - Intronic
1039677534 8:39685788-39685810 ATATGTTAGCAGATGGTGGAGGG - Intronic
1039988868 8:42470728-42470750 CTTTGAGAGGTGATGGTGGGTGG + Intronic
1040429322 8:47322781-47322803 CTTTGTAGGGACATGGATGAAGG + Intronic
1040431219 8:47344266-47344288 CTTTGTAGGGACATGGATGAAGG - Intronic
1040440847 8:47440415-47440437 CTTTGGGAGGAGCTGGTGGCTGG - Exonic
1040458824 8:47627081-47627103 CTTTGTAGGGACATGGATGAAGG + Intronic
1041218094 8:55621588-55621610 CTTTGTAGGGACATGGATGAAGG + Intergenic
1041520925 8:58755539-58755561 CTTTGTAAGGCCAAGGTGGGAGG - Intergenic
1041716622 8:60938315-60938337 CTCTGCAAGGAGATGGTCGTAGG + Intergenic
1041854371 8:62433941-62433963 CTTAATAAAGATATGGTGGATGG - Intronic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1043413481 8:80024510-80024532 CTTTGTAAGGATAATGTGTATGG + Intronic
1043438690 8:80258154-80258176 CTATGTATGGAGGTGGGGGAAGG - Intergenic
1043520996 8:81045053-81045075 CTTTGCTAGGAGATGTTGAATGG - Intronic
1043942863 8:86215442-86215464 CTTTGTGAGGTCAAGGTGGATGG + Intronic
1043954756 8:86347227-86347249 CTTTGGAAGGCCATGGTGGGAGG - Intronic
1043990017 8:86741418-86741440 CTTTGCAAGGACAAGGTGGGCGG + Intronic
1044865723 8:96569250-96569272 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1045367140 8:101486784-101486806 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1045434653 8:102149903-102149925 CTTTGAAACTAAATGGTGGATGG + Intergenic
1045768887 8:105710449-105710471 ATTTGTAAGCAGATGGTGAAAGG + Intronic
1046370267 8:113295990-113296012 CTTTGTAGGGACATGGATGAAGG + Intronic
1046603400 8:116343765-116343787 CTTTGTCAGGGGATGGCTGATGG + Intergenic
1046774926 8:118153761-118153783 CTTTTGAAGGATATGGAGGAAGG - Intergenic
1047844761 8:128793984-128794006 CTGTGTCATGATATGGTGGAGGG - Intergenic
1049060069 8:140269853-140269875 CTTTGGAAGGCCAAGGTGGATGG + Intronic
1050282524 9:4066004-4066026 CATTTTAATGAGATGTTGGAAGG - Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1055114606 9:72593293-72593315 CTTTGGGAGGCCATGGTGGAAGG + Intronic
1055589537 9:77797274-77797296 CTTTGGGAGGATAAGGTGGATGG - Intronic
1055674453 9:78641236-78641258 CTTTGTAGGGAGATGGAAGTGGG - Intergenic
1055869712 9:80860379-80860401 CTTTGGAAGGATGTGGTGGGAGG - Intergenic
1056237490 9:84609652-84609674 CTATGTATGCAGCTGGTGGATGG + Intergenic
1056340876 9:85630721-85630743 CTTTGTCAGGCCAAGGTGGATGG - Intronic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056427252 9:86489618-86489640 TTTTGGAAGGAGATGGAGAAGGG - Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1057642489 9:96837967-96837989 CTTTGAAAGGCCAAGGTGGACGG - Intronic
1058855975 9:109062725-109062747 CTTTGGGAGGCCATGGTGGAAGG + Intronic
1059158705 9:112013299-112013321 CTTTGGAAGGCCAAGGTGGAAGG - Intergenic
1059309771 9:113380250-113380272 CTTTGGAAGGCTAAGGTGGAAGG + Intergenic
1059789995 9:117631560-117631582 CTTTGTGAGGCCAAGGTGGAAGG + Intergenic
1060916385 9:127393943-127393965 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1061447294 9:130647409-130647431 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1061980199 9:134098402-134098424 CTTTGGGAGGACATGGTGGGTGG + Intergenic
1062111654 9:134785313-134785335 CCTTCCAAGGCGATGGTGGAGGG - Intronic
1062159723 9:135073689-135073711 CTCTGTGAGGAGATGGTGCTGGG - Intergenic
1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG + Intergenic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187537336 X:20154420-20154442 CATGGTAAGGAGATGGGTGAAGG - Exonic
1188037546 X:25335426-25335448 CTTTGTAAGGACTTGGATGAAGG - Intergenic
1188409689 X:29856058-29856080 CTATGTATGGAAATGGTGCATGG - Intronic
1188440822 X:30214292-30214314 ATTTGCAAGGAGATCATGGAGGG + Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189098246 X:38162291-38162313 CTTGGATAGGAAATGGTGGAAGG + Intronic
1189351159 X:40276826-40276848 ATGTGTGAGGACATGGTGGAAGG - Intergenic
1189375588 X:40464103-40464125 CTTTGTGAGGCCAAGGTGGATGG - Intergenic
1189441225 X:41037936-41037958 CTTTGGAAGGACAAGGTGGGTGG + Intergenic
1189789916 X:44593388-44593410 CTTTGTTTGCACATGGTGGAAGG + Intergenic
1190182024 X:48200616-48200638 CTTTGAAAGGTCAAGGTGGACGG - Intronic
1191841548 X:65516849-65516871 CCTTGTATGGACAGGGTGGAAGG - Intronic
1193259873 X:79392773-79392795 CTTTGTAGGGACATGGATGAAGG + Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195214575 X:102686181-102686203 CTTTGTAGGGACATGGATGAAGG - Intergenic
1195416031 X:104620341-104620363 TTTTTTAAAGAGATGGTGGCTGG + Intronic
1196586077 X:117429499-117429521 CATACTAAGGAGATGGTGTATGG + Intergenic
1198437289 X:136629721-136629743 CTATGGTAGGAGATGCTGGAGGG - Intergenic
1198647287 X:138823157-138823179 CTTTGAGAGGAGATGATAGAGGG + Intronic
1201382686 Y:13401186-13401208 CTGTGTCAGAACATGGTGGAAGG - Intronic
1201971930 Y:19807278-19807300 CTTTGTAGGGACATGGATGAAGG + Intergenic
1202051855 Y:20789594-20789616 CTTTGTGAGGCCAAGGTGGAAGG - Intergenic