ID: 1045145754

View in Genome Browser
Species Human (GRCh38)
Location 8:99341922-99341944
Sequence AAACTCTCCCAGCCCCAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045145754_1045145757 9 Left 1045145754 8:99341922-99341944 CCCGACTGGGGCTGGGAGAGTTT 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1045145757 8:99341954-99341976 AGTTCTATAATTCTTAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045145754 Original CRISPR AAACTCTCCCAGCCCCAGTC GGG (reversed) Intronic
900885220 1:5410325-5410347 AACCTCTCCCAGACCCAGGCAGG - Intergenic
901506567 1:9689404-9689426 AAATTCTCACACCCCCAGCCGGG - Intronic
901898831 1:12340524-12340546 ATACAGTCCCAGCCTCAGTCTGG + Intronic
903023627 1:20411572-20411594 AAGCTCCCCCAGCCCCAGGCAGG - Intergenic
903451412 1:23456061-23456083 CCCCTCTCCCAGCCCCAGCCTGG - Intronic
906200754 1:43958698-43958720 CAGATCTCCCAGCCCCAGTTTGG - Intronic
906543797 1:46607631-46607653 AAGCCTTCCCAGCCCCATTCTGG + Intronic
907543016 1:55233741-55233763 CAACTCTCCCAGCGAGAGTCAGG - Intergenic
908154990 1:61343979-61344001 AGCCTCTCACAGCCACAGTCAGG + Intronic
909186762 1:72496644-72496666 AAATTCTCCCAGCCCTATTTGGG + Intergenic
909459128 1:75889053-75889075 AAACTTTCCCAGTCCTAGCCGGG - Intronic
912804277 1:112743460-112743482 ACACTCGCCCCGCCCCAGGCTGG + Intergenic
913177536 1:116288593-116288615 AAACTCTGCCACCACCAGTTGGG - Intergenic
915128717 1:153682729-153682751 AAACAGACCCAGCTCCAGTCTGG + Intronic
915562203 1:156693895-156693917 AGACTCTCCCAGTGCCTGTCAGG + Intergenic
915733694 1:158071544-158071566 AAATTCTGGCAGCTCCAGTCTGG - Intronic
918881743 1:190132998-190133020 AATCTCTCCCAGGCCCAGTGAGG + Intronic
919504098 1:198375810-198375832 AAGCTCTAACAGTCCCAGTCAGG + Intergenic
920012280 1:202877498-202877520 AATCTCTCCCTGTCCCAGGCTGG + Intergenic
920682637 1:208084480-208084502 AATCTGCCCCAGCCGCAGTCCGG - Exonic
920785092 1:209033609-209033631 CAACTGTCCCAGCCTCAGTCTGG - Intergenic
921302645 1:213765390-213765412 GACCTCTCCCACCTCCAGTCAGG + Intergenic
921702563 1:218284734-218284756 AAACCCTCCAGGCCCCAGCCGGG + Intergenic
923394109 1:233543713-233543735 AAACACTCCCAGCCTCACCCAGG - Intergenic
924032021 1:239895278-239895300 AAACTCTCCCAGTGGCACTCGGG - Intronic
1063942526 10:11144941-11144963 CAACTCTCCACTCCCCAGTCAGG - Intronic
1067550446 10:47230717-47230739 CACCCATCCCAGCCCCAGTCTGG - Intergenic
1069723975 10:70565895-70565917 GACCTCCCCCAGCCCCAGTGGGG - Intronic
1070745313 10:78930174-78930196 AAGCCCTCCCAGCCCCTGCCTGG - Intergenic
1073132425 10:101198194-101198216 AGACTCTGGCAGGCCCAGTCTGG + Intergenic
1076844006 10:133060269-133060291 ACACCCGCCCCGCCCCAGTCGGG + Intergenic
1077229142 11:1450816-1450838 GCTCTCTCCCAGCCCCACTCTGG - Intronic
1077865174 11:6216263-6216285 AGCATCTCCCAGGCCCAGTCAGG + Intronic
1079068370 11:17319284-17319306 AAACTCTCACTGGCCAAGTCTGG - Intronic
1079497928 11:21067398-21067420 AAAATCTCACTGGCCCAGTCTGG + Intronic
1079853660 11:25571733-25571755 AAACTCTCCTAGCCACAATTTGG - Intergenic
1081674491 11:44960569-44960591 AATCTCTCCCTCCCCCAGCCTGG + Intergenic
1083330606 11:61896719-61896741 ACACCTTCCCAGCCCCACTCTGG + Intergenic
1084478479 11:69402315-69402337 TAAGTCTCCCAGCAACAGTCTGG + Intergenic
1085485478 11:76860126-76860148 TAATACTCCCAGCCCCCGTCTGG - Intergenic
1086024054 11:82268671-82268693 AACTTCTCCCATCCCCAGTTTGG + Intergenic
1086312270 11:85548647-85548669 AAACAGGCACAGCCCCAGTCAGG - Intronic
1088961258 11:114667758-114667780 TAAATCTTCCAGCCCCAGTCAGG + Intergenic
1089402017 11:118169763-118169785 AAAGTCTCCTGGCCTCAGTCTGG - Intronic
1089671733 11:120061783-120061805 AACCTCTCCCAGCCCCAAATAGG - Intergenic
1089702505 11:120254070-120254092 AGACTCCCCCAGCCCCAAGCTGG + Intronic
1090882763 11:130848795-130848817 CAAGTTTCCCAGCCCCAGCCAGG - Intergenic
1092413733 12:8273650-8273672 AATCTCTCTCAGCTGCAGTCAGG - Intergenic
1094439028 12:30454494-30454516 AATCTCTCCCAGCACCAGCAAGG + Intergenic
1095121642 12:38425947-38425969 AAACTCTCACACTACCAGTCAGG + Intergenic
1096460164 12:51818056-51818078 AGAGGATCCCAGCCCCAGTCTGG + Intergenic
1097173605 12:57130255-57130277 AAACTTTCCCAATCCCAATCTGG - Intronic
1097308388 12:58093614-58093636 TACCTCTCCCAGCCCCAGGAGGG + Intergenic
1097381423 12:58899879-58899901 AAATTCTCCAATCTCCAGTCTGG + Intronic
1098584243 12:72137419-72137441 TAAGGCTCTCAGCCCCAGTCTGG - Intronic
1099222208 12:79928422-79928444 AAACCCTCCCAACCCCAAACTGG - Intronic
1103648172 12:122411748-122411770 CAACTTTCCCAGCCCTAGGCAGG - Intronic
1113562701 13:111295667-111295689 AAACTCTCTCAGCACAAGTTGGG + Intronic
1118426588 14:65671068-65671090 AAACTCTACCAGCCCCACTATGG + Intronic
1121513155 14:94528963-94528985 AAACTTTCCCACCCCCACTGAGG + Intergenic
1122350223 14:101084697-101084719 CATCTCTCCCGGCCCTAGTCGGG - Intergenic
1127111235 15:55673417-55673439 TGACTCTCCCAGCCCCACTCTGG + Exonic
1127470003 15:59282339-59282361 AAACCCTCCCAGCCACAGGTGGG + Intronic
1127775226 15:62259430-62259452 AAACGCAGCCAGACCCAGTCTGG + Intergenic
1129061879 15:72866989-72867011 ACACTCTCCCAGAGCCAGTGTGG - Intergenic
1129345159 15:74912835-74912857 AAAATTACCCAGCCCCAGGCCGG + Intergenic
1129427775 15:75476940-75476962 AAGTTTGCCCAGCCCCAGTCTGG - Intronic
1129923770 15:79343833-79343855 AAACTCTCCTTCCCACAGTCAGG - Intronic
1130562332 15:84968366-84968388 TAGATCTTCCAGCCCCAGTCAGG - Intergenic
1130890694 15:88131533-88131555 ATCCTCCCCCTGCCCCAGTCAGG - Intronic
1131050368 15:89343573-89343595 ACGCACTTCCAGCCCCAGTCAGG + Intergenic
1133354900 16:5128837-5128859 AATCTCTCTCAGCTGCAGTCAGG - Intergenic
1138465603 16:57187220-57187242 AGACTCTCCCCACCCCACTCGGG - Intronic
1139559873 16:67735127-67735149 CAACTCTCCCAGCCCAAGCATGG - Intronic
1141475786 16:84272282-84272304 AAATTCTCCCATCACCAGTGGGG - Intergenic
1143477450 17:7211035-7211057 AACCTCTTCCAGCCACATTCTGG - Intronic
1147018075 17:37508306-37508328 CAACTCTTCCAGCCCCACTCTGG + Intronic
1147700147 17:42388520-42388542 ATCCTCGCCCAGCCCCAGCCTGG + Exonic
1149855498 17:60079017-60079039 AACCCCTCTGAGCCCCAGTCCGG - Intergenic
1156440305 18:37179656-37179678 ATACTCTACCAATCCCAGTCTGG + Intronic
1157521048 18:48345705-48345727 AGAGGGTCCCAGCCCCAGTCTGG + Intronic
1157712808 18:49861664-49861686 AAACTGCCCCAGCCTGAGTCAGG + Intronic
1161252878 19:3290425-3290447 AAACCCTCCCATTCCCTGTCAGG - Intronic
1163901706 19:20107260-20107282 AACTCCTCCCAGCCACAGTCTGG - Intronic
1163911937 19:20203437-20203459 AAACTCCTCCAGCCACAGTCTGG + Intergenic
1163917370 19:20252901-20252923 AACTTTTCCCAGCCACAGTCTGG - Intergenic
1163959980 19:20680383-20680405 AACTCCTCCCAGCCACAGTCTGG - Intronic
1163974451 19:20836807-20836829 AACTCCTCCCAGCCACAGTCTGG + Intronic
1164134367 19:22400136-22400158 AACTCCTCCCAGCCACAGTCTGG + Intronic
1164164446 19:22656637-22656659 AACTCCTCCCAGCCACAGTCTGG - Intronic
1165621501 19:37252125-37252147 AAACTACATCAGCCCCAGTCCGG - Intergenic
1166360782 19:42252204-42252226 AAAAGCTCCCAGCCCCTCTCAGG + Intronic
926693459 2:15753874-15753896 AAAGTCTCCTACCCCCATTCAGG + Intergenic
928323442 2:30301882-30301904 AAGCTGACCCAGCCCCAGCCTGG + Intronic
928834123 2:35522755-35522777 CATGTGTCCCAGCCCCAGTCAGG + Intergenic
929465167 2:42137546-42137568 AGACTCCCTCAGCCCCAGTGAGG - Intergenic
930642281 2:53865762-53865784 AAAATGTCCCAGCCCCACCCAGG + Intronic
935124915 2:100214708-100214730 ACTCTCTGCCAGCCCCAGGCGGG + Intergenic
935430519 2:102971165-102971187 AAACTCTCGGAGCCAGAGTCCGG - Intergenic
938378943 2:130825937-130825959 ATCCTCTCCCCGCCCCAGCCTGG + Intergenic
940749808 2:157612617-157612639 TAATTCTCACAGCCCCAGACAGG + Intronic
942676234 2:178429338-178429360 AACTTCTCCCTGCCCCAGTGAGG + Intergenic
944547755 2:200814363-200814385 AAACTCCCTCAGTCCCAGACAGG - Intronic
948258285 2:236584239-236584261 CAAGTCTTCCAGCCCCAGGCAGG - Intergenic
1170338480 20:15297203-15297225 TAACTCTCCCAGCCCCTGCCTGG - Intronic
1174989375 20:55492645-55492667 AAACTCTCCCACCACCTGACCGG + Intergenic
1177492751 21:21848634-21848656 CATCTCTCCCAGCCCCACTTGGG - Intergenic
1178202817 21:30427049-30427071 CAACTCTCCCAGCCTCTCTCAGG + Intergenic
1179106761 21:38408196-38408218 CCACTCTCCCAGACCCACTCCGG + Intronic
1179187915 21:39098816-39098838 AAACTGACCCAGCCCCACACAGG + Intergenic
1181078841 22:20400762-20400784 AAATCCCCCCAGCCCCAGGCTGG + Intronic
1181533383 22:23529773-23529795 AGACTGTCCCACCCCCAGGCTGG + Intergenic
1181772676 22:25137799-25137821 AAACTTTCCCAGCTGCAGGCAGG - Intronic
1181781549 22:25197497-25197519 TGACTCAGCCAGCCCCAGTCAGG - Intergenic
1185003624 22:48262425-48262447 CACCTCTCCCAGCCCCATGCTGG - Intergenic
950063781 3:10094433-10094455 GAACACTCCCAGCCCCACCCAGG - Intronic
953536745 3:43782659-43782681 ACACCCTCCCAGGCCCAGTCAGG - Intergenic
954396122 3:50294418-50294440 ACACTCACCCAGCCCAAGTAGGG + Intronic
956239849 3:67117315-67117337 AAAATCTCCATGCCCCAGTTTGG - Intergenic
957058767 3:75464501-75464523 AATCTCTCTCAGCTGCAGTCAGG - Intergenic
957152945 3:76509976-76509998 AGACTCTCCCAGGCCCATTCAGG + Intronic
958664072 3:97111100-97111122 AAACTCTCCCAAACTCAGCCAGG + Intronic
961294677 3:125875199-125875221 AATCTCTCTCAGCTGCAGTCAGG + Intergenic
961353039 3:126316231-126316253 GTGCACTCCCAGCCCCAGTCCGG - Intergenic
961353151 3:126316618-126316640 ATGCACTCCCAGCCCCACTCTGG - Intergenic
961647624 3:128400905-128400927 ACACTCTCCCAGGGCCAGGCTGG - Intronic
961891285 3:130132282-130132304 AATCTCTCTCAGCTGCAGTCAGG - Intergenic
962197150 3:133373972-133373994 CAGCTGTCCCAGCCCCAGCCAGG - Intronic
962285131 3:134078940-134078962 AACCTTTCCCAGCCACAGACTGG + Intronic
962933113 3:140055794-140055816 TCAGTCTCCCAGTCCCAGTCTGG + Intronic
963227568 3:142877829-142877851 TACCTCGCCCAGCCCCATTCAGG + Intronic
964786512 3:160401018-160401040 AAACGCGCCCAGCCCGAGGCTGG + Intronic
966866735 3:184262384-184262406 AGACACCCCCAGCCCTAGTCCGG + Intronic
966914747 3:184578493-184578515 AAGCTCTCCCAGCCCCCTGCAGG + Intronic
968518186 4:1023541-1023563 TAGCTCCCCCAGCCCCAGCCGGG - Intronic
969002677 4:3994723-3994745 AATCTCTCTCAGCTGCAGTCAGG - Intergenic
969811254 4:9650089-9650111 AATCTCTCTCAGCTGCAGTCAGG + Intergenic
970242400 4:14023086-14023108 ACACCCTTCCAGCCACAGTCTGG - Intergenic
970598287 4:17619597-17619619 ACACTCTTCCAGCCCCACTGTGG - Intronic
973611191 4:52637278-52637300 ACCCTCTCCCAGGCCCAGGCAGG + Intronic
974665127 4:64951803-64951825 ATACTCTCCAAGCCCCAACCTGG - Intergenic
976605583 4:86979489-86979511 AAACTCTCCCACCCCCACATAGG - Intronic
978409999 4:108416081-108416103 AACCTCACCCAGCCCTAGGCAGG - Intergenic
978439628 4:108719710-108719732 AAACTCTACAAGCACCATTCGGG + Intergenic
982894560 4:160902506-160902528 AGACAGTCCCACCCCCAGTCTGG + Intergenic
987421483 5:17725564-17725586 AAAATGTCCCATCCCCAGACTGG + Intergenic
987480770 5:18454566-18454588 GAACTCTCCCATCCCCAGGATGG - Intergenic
991291400 5:65036610-65036632 AAACTCTCCACGTCCCATTCAGG - Intergenic
992825997 5:80550753-80550775 AAACACTCCTTGCCCCAGACGGG - Intergenic
997350838 5:133230359-133230381 AAGCTCTCCCAGACCAATTCAGG + Intronic
1000285881 5:159825904-159825926 AACCACTCCCTGCCCCTGTCAGG + Intergenic
1001518158 5:172371839-172371861 AAACTCTGCCAGCCCAAGAGTGG + Intronic
1002277942 5:178115302-178115324 AGCCTCTCCCAGCCCCTCTCTGG + Intronic
1002854669 6:1026388-1026410 GGCCTGTCCCAGCCCCAGTCGGG - Intergenic
1003054287 6:2804864-2804886 AAGCTCCCCAAGCCCCAGTGGGG - Intergenic
1003161164 6:3635919-3635941 GAATCCTCCCAGCTCCAGTCAGG + Intergenic
1003324951 6:5084633-5084655 ACACGGTCCCCGCCCCAGTCTGG + Exonic
1003452584 6:6249588-6249610 AAAGTGTCCCAAGCCCAGTCAGG - Intronic
1005704861 6:28441366-28441388 AAAAACTCTCAGCTCCAGTCAGG + Intronic
1006390496 6:33755363-33755385 ACACTGTCACTGCCCCAGTCTGG - Intergenic
1009274144 6:61653704-61653726 GAACTCTCCCAGTCACTGTCTGG - Intergenic
1010486945 6:76426050-76426072 GATCTCTCACATCCCCAGTCTGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020321624 7:6942844-6942866 AATCTCTCTCAGCTGCAGTCAGG - Intergenic
1023869415 7:44255065-44255087 ATACTCTCCCACCCCCACTTAGG + Intronic
1024800186 7:53068167-53068189 AAACCCTCCCAGCCACATACTGG - Intergenic
1025773948 7:64541745-64541767 AACTCCTCCCAGCCACAGTCTGG + Intronic
1025816758 7:64920544-64920566 AACTCCTCCCAGCCACAGTCTGG - Intronic
1025866920 7:65390906-65390928 AACTTCTCCCAGCCACAGTCTGG - Intronic
1026980886 7:74526071-74526093 AGTCTCTCCCCGCCCCAGGCAGG + Intronic
1029635697 7:101782278-101782300 AGACTCCCCCACCTCCAGTCAGG + Intergenic
1032358351 7:131230745-131230767 TTACTCTCCCAGACTCAGTCAGG - Intronic
1032475841 7:132211043-132211065 AACCTCCCCCAGCCCCAGTCTGG - Exonic
1034737777 7:153445118-153445140 TAACTCTCTCAGCCCCAGTATGG - Intergenic
1035406828 7:158604215-158604237 AAAATCTCCAAGGCCCAGCCAGG + Intergenic
1036374550 8:8189219-8189241 AATCTCTCTCAGCTTCAGTCAGG + Intergenic
1036477820 8:9109665-9109687 AATCTGTCCTAGCCCCAGGCAGG - Intronic
1036854991 8:12233928-12233950 AATCTCTCTCAGCTTCAGTCAGG - Intergenic
1036876351 8:12476416-12476438 AATCTCTCTCAGCTTCAGTCAGG - Intergenic
1038759674 8:30374983-30375005 AAACTCTTCCAGCCTCAGGCTGG + Intergenic
1041355272 8:56993538-56993560 AAACACTGCCACCCCCAGTGGGG + Exonic
1042149492 8:65766739-65766761 AAATTTTCCCAGCATCAGTCAGG + Intronic
1043392951 8:79808972-79808994 AAACTCTCCCCGCCCTAAGCAGG - Intergenic
1045145754 8:99341922-99341944 AAACTCTCCCAGCCCCAGTCGGG - Intronic
1046224039 8:111253223-111253245 TAACTCTCTCAGCTCAAGTCAGG - Intergenic
1049237490 8:141519348-141519370 AGACTCTCTCAGCCCCACACGGG - Intergenic
1049385878 8:142342747-142342769 CAACTGTCCCAGCACCTGTCTGG + Intronic
1053005516 9:34601622-34601644 AAACTCTCAGAGACACAGTCAGG + Intergenic
1053470804 9:38345166-38345188 AAGGGCTCCCAGCCCCAGGCAGG + Intergenic
1055323422 9:75104086-75104108 AAAGTAGCCCAGCCCCAGTGTGG + Intronic
1056167895 9:83956526-83956548 AAACTCTTCCCGCCCTAGGCGGG + Exonic
1056548608 9:87633810-87633832 AAACTATCCCAGACCCAGTGGGG + Intronic
1057277940 9:93686217-93686239 CAACTCTCACAGCCCCAGCAGGG + Intergenic
1058013559 9:100004440-100004462 AATATCTCCAAGCCCCAGGCTGG - Intronic
1061395485 9:130341400-130341422 CAGCTCTCCCAGCCACAGCCTGG + Intronic
1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG + Intergenic
1061604165 9:131696019-131696041 CAGCTCTTCCAGCCCCAGTCAGG - Intronic
1189479320 X:41380856-41380878 AACCTCACCCAGGCCCAGGCAGG - Intergenic
1197721623 X:129748802-129748824 AAACCCTTCCAGCCCCAGGAAGG - Intronic
1200108478 X:153726904-153726926 AACCTTTCCCAGCGCCTGTCTGG - Intronic