ID: 1045146277

View in Genome Browser
Species Human (GRCh38)
Location 8:99347836-99347858
Sequence CAGTGTGGGCTTTTAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045146277_1045146280 1 Left 1045146277 8:99347836-99347858 CCATCTTCTAAAAGCCCACACTG 0: 1
1: 0
2: 1
3: 13
4: 221
Right 1045146280 8:99347860-99347882 AGTTCACATCTGCAGTTGCTAGG 0: 1
1: 0
2: 0
3: 16
4: 169
1045146277_1045146281 30 Left 1045146277 8:99347836-99347858 CCATCTTCTAAAAGCCCACACTG 0: 1
1: 0
2: 1
3: 13
4: 221
Right 1045146281 8:99347889-99347911 TACTTTCTGATTTATGTCCTTGG 0: 1
1: 0
2: 3
3: 28
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045146277 Original CRISPR CAGTGTGGGCTTTTAGAAGA TGG (reversed) Intronic
901295114 1:8155505-8155527 CAGGGTGGGCTCTTTAAAGATGG - Intergenic
901368623 1:8776670-8776692 CATTGATGGTTTTTAGAAGAAGG - Intronic
903173195 1:21566078-21566100 CAGGGTGGGCTGGGAGAAGAAGG - Intronic
903565380 1:24261417-24261439 CAGGGTGGGCTTTTGAGAGAAGG - Intergenic
904345953 1:29869793-29869815 CAGTGTGGCCTTATATAACATGG - Intergenic
906300448 1:44677848-44677870 TAGTAAGGGCTTTTACAAGAAGG + Intronic
906310793 1:44752885-44752907 CAGTATGGGCTTTGACATGAAGG - Intronic
906951754 1:50340712-50340734 CAGTCTGTGATTCTAGAAGAGGG - Intergenic
908424784 1:63996259-63996281 TACTGTGGGGTTTCAGAAGAGGG + Intronic
909064107 1:70912183-70912205 CTGTGTAGACTTTGAGAAGATGG - Intronic
909243530 1:73246019-73246041 CACTGGGGGCTATTAGAAGGGGG + Intergenic
909352859 1:74674245-74674267 CAGAGCTGGCTTTCAGAAGATGG + Intergenic
909485161 1:76164397-76164419 TAGAGTAGGCTTTTAGTAGATGG + Intronic
909519276 1:76548241-76548263 TAGGGTGGCCTTTTAGAAGAGGG - Intronic
909758968 1:79265935-79265957 CATTGTGTGATTTTAAAAGATGG + Intergenic
911574648 1:99560985-99561007 CACTGTAGGCCTTTAGAAAAAGG - Intergenic
914456708 1:147843332-147843354 GAGAGTGGGCTTTTAGAATCTGG - Intergenic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
916763505 1:167838153-167838175 CACAGAGGGCTTTCAGAAGAAGG - Intronic
917711312 1:177688164-177688186 CAGTGTGGGCTTTGAGTTGGGGG + Intergenic
918015337 1:180628219-180628241 CAGTGTGAGGTCTTTGAAGAAGG - Intergenic
921163061 1:212486551-212486573 CACTGTGGGGAATTAGAAGAAGG + Intergenic
922389269 1:225122272-225122294 TAGTATTTGCTTTTAGAAGAGGG - Intronic
923286663 1:232502734-232502756 CATTGTGAGCCCTTAGAAGATGG - Intronic
923553126 1:234979920-234979942 CAGCCTGGGCTTTTAAAAGGGGG - Intergenic
924751067 1:246890961-246890983 CATTCTGGGCTTTTACCAGAAGG - Exonic
1063030562 10:2230177-2230199 CAGTGTCAGCTTCTAGCAGATGG + Intergenic
1063572746 10:7231215-7231237 CTGTCTGGGGTTTTGGAAGACGG + Intronic
1064118120 10:12596138-12596160 GAGTGTGGGCATTTGGAGGAGGG + Intronic
1066025550 10:31355742-31355764 CAGTGTGAGCGTTGAAAAGAAGG + Intronic
1069871329 10:71534985-71535007 CTGTGTGGGCTGTCAGGAGAGGG + Intronic
1070421812 10:76244807-76244829 CAGTGTGGGAATTTAGAGCATGG + Intronic
1073258820 10:102173335-102173357 CAGTGTGGTATGTTGGAAGATGG - Intergenic
1073920847 10:108456990-108457012 CAGTGTTGGGTTTCAGTAGAAGG + Intergenic
1074135979 10:110626662-110626684 CAGGGTGGGCTTTCAGTAAATGG + Intergenic
1075788902 10:125069281-125069303 CATTGTGGGCGTTTACAAGTTGG - Intronic
1076322538 10:129593996-129594018 CAGTGTGGGGTTTTATGAGCTGG + Intronic
1077126038 11:937409-937431 CAAAGTGTGCTTTGAGAAGATGG - Intronic
1077830668 11:5866627-5866649 CAGTGTGGACTATTAGAGGGTGG + Intronic
1078491211 11:11770599-11770621 CACTGGGGGCTTCTGGAAGATGG + Intergenic
1079367166 11:19819487-19819509 CAGGGTTGGCTTCTAGGAGAAGG + Intronic
1079617735 11:22515605-22515627 CAGGGAGGGCTTTTCGGAGAAGG - Intergenic
1079661235 11:23039401-23039423 CACTGGGGGCTACTAGAAGATGG + Intergenic
1081034827 11:38130881-38130903 CAGTGTATGCTTTTAAAACAAGG + Intergenic
1082762809 11:57143690-57143712 CAGAGTGGGCTTTTGCAAGGAGG - Intergenic
1082909160 11:58350603-58350625 GAGTTTGGGCTCTCAGAAGAGGG + Intergenic
1084380253 11:68807408-68807430 CAGTTTGGGCTTTGGGAAGAAGG - Intronic
1086486641 11:87310462-87310484 CACTGGGGGCTTCTAGAGGAGGG + Intronic
1087552685 11:99672150-99672172 CAGAGTAGGGTTTTCGAAGAGGG - Intronic
1088806331 11:113356554-113356576 CAGTGTGTGTTTGTAGAAGCTGG + Intronic
1090765952 11:129876602-129876624 CAGGGTAGGCTTTGAGAACAAGG - Intronic
1092962214 12:13607066-13607088 CAGTGTGGGGTGTTACTAGAGGG - Intronic
1093265145 12:16994554-16994576 CAGTGGGGCCTTTCAGAAGGTGG + Intergenic
1093719515 12:22422977-22422999 CAGTGGGGCCTTTCAGAGGATGG + Intronic
1093720012 12:22429617-22429639 CAGTGGGGCCTTTCAGAGGATGG + Intronic
1094412987 12:30187749-30187771 CAGTTTGGGCTCTAAGCAGAAGG + Intergenic
1094488595 12:30944683-30944705 CTGTTTGGTCTTTTAAAAGAAGG + Intronic
1097704489 12:62853624-62853646 CAGTGTTGGCCTTTGGATGACGG - Intronic
1098522401 12:71448142-71448164 CAGTGTAGGCTTTGAAAAGAAGG - Intronic
1103019964 12:117526026-117526048 CGGTGTGAGGTTTTAGATGAAGG + Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108543387 13:51465918-51465940 TAGTGTGGGGTTTGAGAAAAAGG + Intergenic
1109857793 13:68156216-68156238 CCTAGTGGACTTTTAGAAGACGG - Intergenic
1110254189 13:73413919-73413941 CAGTGTGGGGTTATAAAGGAAGG - Intergenic
1110799092 13:79673910-79673932 CAGTGTGGGCTTTTAGGGAGAGG + Intergenic
1111396100 13:87671958-87671980 CAGTGTGCGCTGCAAGAAGAAGG + Intergenic
1112204182 13:97307871-97307893 CACTGTGGACATTTTGAAGAGGG - Intronic
1113321413 13:109235891-109235913 CAGTCTGGGCTTGTAGTACAGGG + Intergenic
1114795751 14:25712996-25713018 GAGTGTAGGCTTTTAGAAGGAGG + Intergenic
1114830335 14:26133671-26133693 CAGTGGGGCCTGTTATAAGAAGG - Intergenic
1115844755 14:37516123-37516145 CAGTGTGGGGTTTTATAAAATGG + Intronic
1118508039 14:66436960-66436982 CAGTGAGGACTACTAGAAGAGGG - Intergenic
1119995983 14:79254163-79254185 CAGAGGGGACTTTTGGAAGATGG - Intronic
1120414852 14:84206532-84206554 CATTGTGGGCTTTATGGAGAAGG + Intergenic
1122543946 14:102512104-102512126 CAGACTTGGCTTTTAGAAAAAGG - Intergenic
1123709281 15:22974989-22975011 CACTGTGAGCTTTTTGAGGATGG + Intronic
1125089176 15:35770692-35770714 CAGGGTGGGGTTAAAGAAGAAGG + Intergenic
1128778500 15:70342136-70342158 CACTGTGGGCTTTCTGGAGAGGG + Intergenic
1128787233 15:70406799-70406821 CAGTGTGGTCATTCAGCAGAGGG - Intergenic
1128822078 15:70666165-70666187 CAGTGAGGGCTTTAAGAAGGAGG + Intronic
1129767367 15:78178869-78178891 CAGTGGGGGCTTGGAGGAGACGG - Intronic
1130063670 15:80587653-80587675 CTGTGTGGGCTTTCAGACCACGG - Intronic
1130129083 15:81121872-81121894 CAGTGGGGCCTTTCAGAAGGTGG - Intronic
1130603031 15:85290670-85290692 CAGTGTGGCATTTAACAAGAAGG - Intergenic
1130887652 15:88107594-88107616 CAGGGAGGGCTTTCAGAACAGGG - Intronic
1130983015 15:88825834-88825856 CTGTGTGAGCTTTTAGGTGAAGG - Intronic
1131243459 15:90769371-90769393 CAGTGTTGGCTTTTTATAGAAGG + Intronic
1133476449 16:6126459-6126481 CAGTGTCCCATTTTAGAAGAAGG + Intronic
1133503942 16:6391812-6391834 CAGTGTGAGCTCTTCGAGGATGG - Intronic
1134194179 16:12146144-12146166 CAGTGTGAGCTTATAGATAAAGG + Intronic
1135510814 16:23081497-23081519 CAGGGTGGGCTGCTAGTAGATGG - Intronic
1137399480 16:48141623-48141645 CAGTGTCAGCTCTTATAAGAAGG + Intronic
1142059473 16:88020161-88020183 CCGTGTGGCCCTTCAGAAGAAGG - Intronic
1143028886 17:3956344-3956366 CCGTGTGAGTTTTGAGAAGAAGG + Intronic
1144813238 17:18015462-18015484 CAGTGAGGCCTATTAGAAGGTGG + Intronic
1146059891 17:29599101-29599123 CAGGGTGGGCTTTTCTAAGGAGG + Intronic
1146848937 17:36205360-36205382 CAGAGTGGGGTTTTACAAGCAGG - Intronic
1149417512 17:56475208-56475230 CAGTGTAGGCTTACAGCAGAAGG - Intronic
1150103320 17:62442953-62442975 AAGTGTGGCCTTCTAGAGGAAGG - Intronic
1152632221 17:81415356-81415378 CAGGCTGGGCTTTTTGAAGGTGG + Intronic
1154496824 18:14967433-14967455 CAGGGTGGGCCATTTGAAGAGGG + Intergenic
1156950346 18:42888894-42888916 CACTGTGGACTTCTGGAAGAAGG + Intronic
1157975987 18:52327453-52327475 CAGTGTGGCCTTTTGGAGGGTGG - Intergenic
1158623866 18:59055286-59055308 CAGTGTGGGTTTTCAGCTGAAGG - Intergenic
1159210000 18:65306410-65306432 AAGTGAGGGCTTTCAGAAAAAGG - Intergenic
1161262217 19:3344317-3344339 CTGTGTGGCCTATCAGAAGATGG + Intergenic
1163244118 19:16082074-16082096 CCGTGTTTGCTTTTAGAAAATGG + Intronic
1165380926 19:35479558-35479580 CAGAGTATGCTTTTAGAGGAGGG - Intergenic
1166925567 19:46264752-46264774 CTGTATGGGATTTTAGAAGGTGG + Intergenic
925065576 2:927124-927146 CAGGGTGGGATTTTCAAAGAAGG - Intergenic
927088527 2:19693164-19693186 CAGTGGCGGCTATTAGAAGGAGG - Intergenic
929613182 2:43287055-43287077 CATTTTGTGCTTTTAGAACAGGG - Exonic
931750710 2:65327583-65327605 CAGGGTGGGGTGTCAGAAGAAGG - Intronic
931815632 2:65897891-65897913 CTGTGTGGGCTGGTAGAAGTGGG + Intergenic
932967702 2:76496929-76496951 CAGTGGGGGTTTTGAGAGGATGG - Intergenic
933977092 2:87520368-87520390 CAGTATGGACTTTGGGAAGATGG + Intergenic
936291774 2:111230865-111230887 AAGTGTGGGCTTACAGAAAAAGG + Intergenic
936316725 2:111430437-111430459 CAGTATGGACTTTGGGAAGATGG - Intergenic
937623580 2:124018276-124018298 CAGTTTGGGCTTGTAGGACAGGG + Intergenic
937713460 2:125005100-125005122 CAGTGGGAGCTTTTAGAAATGGG + Intergenic
938013293 2:127846319-127846341 CAGTGTTGGCTTTTAAAATCAGG - Exonic
938577539 2:132618838-132618860 AACTGAGGGCGTTTAGAAGATGG + Intronic
940438514 2:153684810-153684832 CAATGGGGCCTTTTGGAAGATGG - Intergenic
940906022 2:159170696-159170718 CAATGTGGGATTTGGGAAGACGG + Exonic
941094740 2:161225498-161225520 CAGTCTGGGGTTTTAGGAAAGGG - Intronic
941118889 2:161505634-161505656 CATTCTGGGCTTTTACCAGAAGG - Intronic
942599406 2:177625635-177625657 CAGTTTGAGTTTTTACAAGAAGG + Exonic
942810497 2:179994367-179994389 CAGTGTTCTCTTTTAAAAGAAGG - Intronic
942833789 2:180267693-180267715 CAGTGGGGACTGCTAGAAGATGG - Intergenic
944010426 2:194967933-194967955 CAGGGTTGGCTTTGAGAACAGGG - Intergenic
945007469 2:205423915-205423937 CACTGGGGCCTTTTGGAAGATGG + Intronic
945663531 2:212715004-212715026 CAGTCTGGGCTCTTAAAAAAGGG + Intergenic
945676111 2:212857363-212857385 CACTGTGGACATTTAAAAGATGG - Intergenic
946053156 2:216880603-216880625 CAGAGTGGGCTTTGGGAAGAAGG + Intergenic
1172012276 20:31852499-31852521 CAATGTGGTCTTGTAGAAGTTGG + Intronic
1172117153 20:32579852-32579874 CTGGGGGGGCTTTTGGAAGAAGG - Intronic
1173633758 20:44536651-44536673 CAGTTTGGACTTCTAGAAGGTGG + Intronic
1174141484 20:48417323-48417345 GAGTTTGGCCTGTTAGAAGAAGG + Intergenic
1174345234 20:49924167-49924189 AAGTATTGGGTTTTAGAAGACGG + Intergenic
1174387291 20:50194681-50194703 CAATGTGTGCTTTTAGAAATGGG - Intergenic
1175255950 20:57647315-57647337 CAATGTGGGCTTTGAGAGAAGGG + Intergenic
1175626185 20:60489875-60489897 CAGTGTGCCCTTTGAAAAGATGG + Intergenic
1175878179 20:62240280-62240302 CAGTGTCGTCTTTTAGAATGTGG + Intronic
1177756829 21:25358838-25358860 CATTGTAGCCTTTTATAAGAGGG + Intergenic
1178214987 21:30585581-30585603 CATTGTGTACATTTAGAAGAGGG + Intergenic
1182712836 22:32333293-32333315 CAGAGGGGTCTTTTAGAGGATGG + Intergenic
1183209398 22:36441585-36441607 CAGGGAGGGCTTCTAGAAGCAGG + Intergenic
1183288738 22:36984612-36984634 CAGGGTGGGAATTTAGAAGCTGG - Intergenic
1183920433 22:41163022-41163044 CAGTGAGGCCTTTTAGATCATGG + Intronic
1184605785 22:45574087-45574109 CACTGTGGGCTCTGAGAAGGCGG + Intronic
1184635357 22:45824176-45824198 CAGTGTGGGATATTAGAAGAGGG - Intronic
951851549 3:27146819-27146841 GAGTGTGGGTTCTTAGGAGAAGG + Intronic
952248719 3:31627491-31627513 AATTGTGAGCTTTTAGAAGATGG + Intronic
953412484 3:42698108-42698130 CCCTGTGGGCTTCTAGAACAGGG - Intronic
953738882 3:45519524-45519546 CAGTGACGGTTTTTAGAATATGG - Intronic
954702378 3:52456910-52456932 TAGGGTGAGCTTTTTGAAGATGG - Intronic
958089072 3:88852401-88852423 CAGTTTGGGCTTTTAAATAAAGG - Intergenic
960372328 3:116855537-116855559 TAGGGCTGGCTTTTAGAAGACGG + Intronic
962343127 3:134601803-134601825 CAGTGGGGACTTTTAGGGGAGGG + Intronic
962373789 3:134842760-134842782 CTGTGTGGGATATTAAAAGATGG - Intronic
963574183 3:147039213-147039235 CATTGTGGGCTACTAGAGGAGGG + Intergenic
964944933 3:162209687-162209709 CAGAGTGGGTGTTTAGGAGAGGG + Intergenic
969690056 4:8699244-8699266 CAGAGTGGGCACTCAGAAGAGGG + Intergenic
970146099 4:13037721-13037743 CACTGGGGCCTTTCAGAAGATGG + Intergenic
975499303 4:75067610-75067632 CAGTGTGAGCCCTTATAAGAAGG + Intergenic
976037807 4:80845257-80845279 CAGTGTGGGACTTGAGCAGATGG - Intronic
979194755 4:117907290-117907312 CAGTATGGGGTTTCAGAAGCTGG + Intergenic
985933577 5:3078207-3078229 CAGGGTGGGCTTAGAGAAAAAGG + Intergenic
986774736 5:11003940-11003962 CAGTATTTGCTTTTAAAAGATGG - Intronic
986793708 5:11189055-11189077 CATTGTGGGCTATTAGAAGCTGG - Intronic
986910494 5:12549671-12549693 TTGTGTGGCTTTTTAGAAGAGGG + Intergenic
988430361 5:31111784-31111806 CAGGGTGGTCTTTTAAAAGTAGG - Intergenic
990082889 5:51938722-51938744 CACTGGGGCCTTTTAGAGGATGG - Intergenic
990174421 5:53091368-53091390 CAGGATGGGCTTCTAGCAGATGG - Exonic
992023583 5:72649465-72649487 CAGTGAGGGGCTTTGGAAGAAGG - Intergenic
992775996 5:80089898-80089920 CAGTGTGGTCTGTTAGAGTATGG - Intergenic
992881245 5:81112619-81112641 CAGTGTCGTCTTTATGAAGACGG - Exonic
994466685 5:100143431-100143453 CAGTGTGGGCATAAAGAACATGG - Intergenic
996394439 5:122999033-122999055 TCCTGTGGTCTTTTAGAAGAGGG + Intronic
997900814 5:137762688-137762710 AAATCTAGGCTTTTAGAAGAGGG + Intergenic
1000528306 5:162386192-162386214 CATTGTAGTCTTTTTGAAGAAGG - Intergenic
1000970871 5:167713242-167713264 CAGTGTTATATTTTAGAAGAGGG - Intronic
1001601023 5:172928456-172928478 CAGTGAGGGCTTCTTGGAGACGG - Intronic
1003421497 6:5962201-5962223 AAGTGTGAAATTTTAGAAGATGG + Intergenic
1003487086 6:6589019-6589041 CACTGGGAGCTTTTGGAAGAAGG + Intronic
1004902353 6:20206060-20206082 GAGGGTGGGCTTTGTGAAGAAGG - Intronic
1006133252 6:31881124-31881146 GAGTGTGGGCTATTAGGAGGTGG + Intronic
1006672378 6:35737394-35737416 CAGGGTGGGCTTGAGGAAGATGG - Intronic
1007545481 6:42690376-42690398 CAGCGTGGGCTGTTAGGAGGAGG + Intronic
1009157801 6:60244588-60244610 AAGTGAGGGCTTTTAGGTGAAGG + Intergenic
1009839187 6:69044908-69044930 CATTGTGGGTGTTTAGAAGATGG - Intronic
1010870110 6:81026463-81026485 CAATGTGGGGCTTGAGAAGATGG - Intergenic
1015575177 6:134663730-134663752 AAGTTTGGGTTTCTAGAAGATGG - Intergenic
1019433003 7:1007985-1008007 CAGTGTGGACTGTTAGACAAGGG - Intronic
1022850276 7:34254734-34254756 CAGAGTGGGCTTTGAGAATTGGG - Intergenic
1023465678 7:40451886-40451908 CAAACTGGGCTTATAGAAGATGG + Intronic
1023959222 7:44912830-44912852 CAGTGTGGGATATTAGGAAAGGG + Intergenic
1024014314 7:45297080-45297102 CAGTGTGAGCTTAAAGGAGAGGG - Intergenic
1024047894 7:45597467-45597489 CAGTGTTGGCTTTTACCAGCCGG + Intronic
1026403392 7:70039258-70039280 CAGTATTTGCTTTTAGAATATGG - Intronic
1030932479 7:115542182-115542204 CAGGGTCAGCTTTTAGAGGATGG - Intergenic
1030944235 7:115696292-115696314 CAGTGTAGGATTTCATAAGAAGG + Intergenic
1032032508 7:128496125-128496147 AAGTGTGGCCTTCTAGAGGAAGG - Intronic
1038401421 8:27287477-27287499 CAGTGTGGGCATTAGGAAGAGGG + Exonic
1038658323 8:29474542-29474564 GAGTGAGGGCTTTTAGAAAGTGG + Intergenic
1038854244 8:31313885-31313907 CAGAGCAGGCTTTTAGAAGTAGG + Intergenic
1040464426 8:47680615-47680637 AAGGGTGGCCTTTTTGAAGAAGG - Intronic
1041311514 8:56522355-56522377 AAGCCTGGGCTTGTAGAAGATGG + Intergenic
1042119643 8:65472129-65472151 CATTGTGGTATTTTAGATGACGG - Intergenic
1043103587 8:76080075-76080097 CAGAGAGGGATTTTTGAAGATGG - Intergenic
1043244579 8:77981507-77981529 GTGTGTGGGCTTTTAGGAGCTGG - Intergenic
1044057501 8:87589275-87589297 CACTGTGGTCTATAAGAAGAGGG - Intronic
1045146277 8:99347836-99347858 CAGTGTGGGCTTTTAGAAGATGG - Intronic
1045236070 8:100353540-100353562 AAGTTTGGGCTTTTACAAGAAGG + Intronic
1047130027 8:122008614-122008636 GAGTGTCGGCTTTTAAAAGCTGG + Intergenic
1047897574 8:129383761-129383783 CAGAGTAGGATTTTAGAGGATGG - Intergenic
1047920500 8:129629913-129629935 CTGTGAGGGCTTTTGGAATAAGG - Intergenic
1048215988 8:132495350-132495372 CAGTGTAGACTTTTATGAGAAGG + Intergenic
1049316622 8:141972585-141972607 GAGTGTGGCCATTTGGAAGATGG + Intergenic
1049448698 8:142645980-142646002 AAGTGTGTGCTTTTAAAAAAAGG - Intergenic
1052192568 9:25677164-25677186 CAGTGTTTGCTTTTATAAGTCGG - Exonic
1185779399 X:2831166-2831188 CAGTGTGGTCTGGTACAAGAAGG - Intronic
1186410367 X:9340974-9340996 CTGTGTGGGCTTTGAAAATAGGG - Intergenic
1186727781 X:12375483-12375505 CACTGTGGGCTTGCAGATGAAGG - Intronic
1186852299 X:13592685-13592707 CTGTAAAGGCTTTTAGAAGAAGG + Intronic
1187534311 X:20124132-20124154 CAGACTGGGCTTTTAAAAGGGGG + Intergenic
1188995642 X:36881845-36881867 GATTGTGGGGATTTAGAAGAAGG + Intergenic
1189520106 X:41758101-41758123 TAATGTAGGCTCTTAGAAGATGG - Intronic
1190151584 X:47954462-47954484 CACAGTGGGCTTTTAAAACAAGG - Intronic
1190161144 X:48032262-48032284 CACAGTGGGCTTTTAAAACAAGG + Intronic
1190425322 X:50329871-50329893 GAGTGTAGGCTTTTAGAAGCAGG + Intronic
1192410746 X:70930533-70930555 CAGTGTGGGCTTGGTGAGGAGGG - Intronic
1196254866 X:113505325-113505347 CATTGTGGCCTAGTAGAAGAGGG - Intergenic
1198074852 X:133184501-133184523 AACTGTGGGCTTAAAGAAGATGG - Intergenic
1198233688 X:134716633-134716655 CTGTGTGGGCCTCTGGAAGAAGG - Intronic
1198509908 X:137340094-137340116 CAGTGTGGATTTTAAAAAGAAGG + Intergenic