ID: 1045146278

View in Genome Browser
Species Human (GRCh38)
Location 8:99347850-99347872
Sequence GCAGATGTGAACTACAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045146278_1045146281 16 Left 1045146278 8:99347850-99347872 CCCACACTGTAGTTCACATCTGC 0: 1
1: 0
2: 2
3: 12
4: 181
Right 1045146281 8:99347889-99347911 TACTTTCTGATTTATGTCCTTGG 0: 1
1: 0
2: 3
3: 28
4: 320
1045146278_1045146282 21 Left 1045146278 8:99347850-99347872 CCCACACTGTAGTTCACATCTGC 0: 1
1: 0
2: 2
3: 12
4: 181
Right 1045146282 8:99347894-99347916 TCTGATTTATGTCCTTGGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045146278 Original CRISPR GCAGATGTGAACTACAGTGT GGG (reversed) Intronic
901533597 1:9868347-9868369 GCAGCTGTGACCAACTGTGTGGG - Intronic
901759327 1:11460464-11460486 GCAGGTGTGAGCTGCAGTGCAGG - Intergenic
904193475 1:28765725-28765747 GCAGATGTGAGCTACCATGCTGG + Intronic
907062090 1:51438147-51438169 TTAGATGAGATCTACAGTGTAGG - Intronic
907214908 1:52854478-52854500 GCAGATGTTGACCAAAGTGTAGG - Exonic
907432869 1:54424089-54424111 ACAGATGTGAGCCACCGTGTCGG + Intergenic
907588448 1:55642834-55642856 GAAGAATTGAAGTACAGTGTGGG + Intergenic
910590162 1:88921775-88921797 TCAGACTTGAACTACAATGTTGG - Intergenic
911092253 1:94026894-94026916 GCAGATGTGAATAAGAGTGTGGG + Intronic
911374991 1:97041635-97041657 GCATATGGGAGCTTCAGTGTTGG + Intergenic
912794516 1:112683991-112684013 GCAGATCTGCACTCCAGTCTGGG - Intronic
921322526 1:213955925-213955947 GAAAATGTGAATCACAGTGTGGG - Intergenic
922822001 1:228491004-228491026 GCAGCTGAGCACTGCAGTGTAGG + Intronic
924739036 1:246783967-246783989 ACAGATGCGAACTACCGTGCTGG + Intergenic
1065512846 10:26496352-26496374 GCTGAATTTAACTACAGTGTGGG + Exonic
1065773625 10:29100160-29100182 GCAGGTGTGAACCACAGTGCTGG + Intergenic
1066435230 10:35391463-35391485 ACAGATGTGAACTACTGATTAGG + Intronic
1067702740 10:48585471-48585493 GAAGGTGTGAACATCAGTGTTGG - Intronic
1068274980 10:54782949-54782971 GTAGATGTGTCCTAGAGTGTTGG - Intronic
1070214003 10:74356755-74356777 ACAGATGGGAACCAGAGTGTTGG + Intronic
1070564512 10:77593433-77593455 GCAGCTTTGAAGTACAATGTGGG + Intronic
1071152547 10:82652161-82652183 GCAGGAGTGAACTCCATTGTGGG + Intronic
1072449826 10:95531076-95531098 GCAGGTGTAAACCACAGAGTTGG - Intronic
1074248135 10:111714541-111714563 GCAGGTGAGAGCTGCAGTGTGGG + Intergenic
1074342219 10:112643273-112643295 ACAGGTGTGAGCCACAGTGTCGG + Intronic
1074367672 10:112872568-112872590 ACAGATGTGAAATCCAGTCTTGG - Intergenic
1075920912 10:126211961-126211983 GCAGTTGTGAAGTCCAGAGTGGG + Intronic
1075973083 10:126671866-126671888 GAAGATGGGAACTACAATGAAGG + Intergenic
1076133543 10:128029503-128029525 GCAGATGAGAAGGACACTGTGGG + Intronic
1076295171 10:129378381-129378403 GCAGATGTGAACTTCAGCCTGGG - Intergenic
1078447422 11:11414928-11414950 CCAGTTGAGAACTACAGTGCTGG - Intronic
1079276830 11:19046891-19046913 GCAGACTTGAACTACACTTTAGG + Intergenic
1080530692 11:33173008-33173030 GCAGATATGAATAAAAGTGTGGG + Intergenic
1083233033 11:61335116-61335138 GGAGCTGGGATCTACAGTGTGGG + Intronic
1087917439 11:103827455-103827477 GCAGATGTGAACGTTTGTGTGGG + Intergenic
1092679484 12:10961975-10961997 GCAGATGTGAAAGAACGTGTTGG - Intronic
1093052776 12:14521621-14521643 GCAGATGTGTCCTAAGGTGTCGG - Intronic
1096003716 12:48151280-48151302 GCAGATGTGAACTGCACTCATGG - Exonic
1096471994 12:51884736-51884758 ACAGATGTGAACTACTGATTAGG - Intergenic
1096933911 12:55247793-55247815 GAAGAAATGATCTACAGTGTTGG - Exonic
1098666031 12:73163853-73163875 GCAGATGAGAGCTACAAAGTAGG + Intergenic
1099189743 12:79550090-79550112 CCTGCTGTGAAATACAGTGTTGG - Intergenic
1099240858 12:80136654-80136676 GCAGCTGTGAACAACGGTATAGG + Intergenic
1099482846 12:83189959-83189981 ACAGGTGTAAACTATAGTGTAGG + Intergenic
1102310124 12:111838147-111838169 GCACCTGTGAACTCCAGTCTGGG - Intergenic
1104462606 12:128967948-128967970 GCATGTGTGAACTACATTGGAGG + Intronic
1107272179 13:38632939-38632961 GCAGATGTAAACTAGAAGGTGGG + Intergenic
1108617289 13:52146157-52146179 ATAGATGTTAATTACAGTGTGGG + Intronic
1111200840 13:84933934-84933956 GCAGATGTGAGCAGCAATGTAGG + Intergenic
1112340355 13:98547886-98547908 GTGGATAAGAACTACAGTGTGGG - Intronic
1115259068 14:31434789-31434811 GAGGATGTGAACTTCAGTGGGGG - Intronic
1115953653 14:38750720-38750742 GCAAATCTAAACCACAGTGTTGG + Intergenic
1116396078 14:44449903-44449925 ACAGATGTGAACTACTGATTAGG + Intergenic
1116566907 14:46458508-46458530 GCAGATGTGTCCTAGATTGTTGG - Intergenic
1117117316 14:52527336-52527358 GCTGATGTCAGCTACAGAGTTGG + Intronic
1124796512 15:32786341-32786363 ACAGGTGTGATCTACAGTGAGGG - Intronic
1126324752 15:47464515-47464537 CCAGATGTGGAATACACTGTTGG - Intronic
1127908548 15:63395926-63395948 ACAGATGTGAACTACTGATTAGG + Intergenic
1128066398 15:64767432-64767454 CCAGAACTGAACTACAGTGCTGG - Intronic
1129102645 15:73280552-73280574 GCAGTGCTGAACTACAGGGTTGG - Intronic
1129276200 15:74447338-74447360 GGAGCTGTGAACTACAATGCTGG + Intronic
1129345924 15:74918811-74918833 GCAGATGTGAACTACGTTGAAGG - Intergenic
1134874879 16:17688984-17689006 GGAGATGAGACCTCCAGTGTTGG - Intergenic
1135006507 16:18828420-18828442 GAAGATGTTAACTACAGTTAAGG + Intronic
1136146255 16:28318215-28318237 ACGGCTGTGACCTACAGTGTGGG - Intronic
1136594320 16:31237197-31237219 GCAGGTGTGAACTACCATGCTGG + Intergenic
1137850550 16:51737699-51737721 TCTGATGTGGACTACGGTGTGGG + Intergenic
1138028879 16:53543349-53543371 GCAGGTGTGACCCACACTGTGGG + Intergenic
1138572251 16:57883412-57883434 GCAGATGTGAACCACTGTGCAGG + Exonic
1139813150 16:69640591-69640613 TCAGATGAGAACTTCAGAGTTGG + Intronic
1140747213 16:77991739-77991761 GGAGATGTGAATTACAGATTGGG - Intergenic
1141320079 16:83000289-83000311 GCAGCTTTGCACTACAGTCTGGG - Intronic
1141521876 16:84585902-84585924 GCAGATGTGCATTGCAGTGGGGG - Intronic
1141662476 16:85448873-85448895 GCAGCTGTGAACTCCGGTTTTGG + Intergenic
1141985460 16:87576929-87576951 GCAGGTGCGAGCGACAGTGTGGG + Intergenic
1142632805 17:1236404-1236426 GGAGATGTAAACAACAGTGCAGG - Intergenic
1145181942 17:20760938-20760960 ACAGATGTGAGCTACAGTGCCGG + Intergenic
1151288654 17:73132432-73132454 GCAGAAGTGATCTAAAGTGGCGG + Intergenic
1151624022 17:75265449-75265471 ACAGGTGTGAACCACAGTGCCGG + Intronic
1151649823 17:75459914-75459936 GCACAGGTGAACTAGAGGGTAGG + Intronic
1154358456 18:13640617-13640639 GCAGATGGGACCTACACTGGTGG + Intronic
1156256299 18:35400006-35400028 GTAGATGTGAACAACCCTGTAGG + Intergenic
1158142022 18:54266014-54266036 ACAGATGTGAGCCACCGTGTTGG + Intergenic
1159481271 18:68993903-68993925 GCAGATACCAACCACAGTGTAGG - Intronic
1164416089 19:28047512-28047534 TCAGATGTGAACAACTGGGTTGG + Intergenic
1164917506 19:32063792-32063814 GCAGTTTTGAACTTCAGTGAGGG - Intergenic
925533944 2:4895373-4895395 GCAAATGTGATCCCCAGTGTTGG - Intergenic
928491695 2:31790983-31791005 ACAGATGTGAACCACTGTGCTGG - Intergenic
931718020 2:65044601-65044623 ACAGATGTGAACTACTGATTAGG + Intergenic
933006714 2:77004525-77004547 GCAGAAGTGTGCTACAGTGGTGG + Intronic
933279087 2:80312488-80312510 ACAGATGTGAACTACTGATTAGG + Intronic
938715452 2:134016591-134016613 GCAGTTGTGAACCACAGCGCCGG + Intergenic
938896136 2:135752453-135752475 ACAGATGTGATCCACAGTGCTGG + Intronic
940529753 2:154866548-154866570 CCAGATGAGAACTAAAATGTTGG + Intergenic
944563133 2:200961426-200961448 GCAGGTGTGAACCACTGTGCTGG + Intronic
945180161 2:207083533-207083555 GCAGATGTGACTAAGAGTGTGGG - Intronic
946215883 2:218183338-218183360 GCAGGTGGGAACTGGAGTGTAGG + Intergenic
1169785452 20:9354829-9354851 GCATTTGTGAACCACAGAGTTGG - Intronic
1170759728 20:19239030-19239052 GCAGTTGGGAATCACAGTGTGGG + Intronic
1175217548 20:57399552-57399574 GCAGCTGTGCAGTACAGTTTTGG + Intronic
1178555823 21:33588946-33588968 GCTGATGTGCACTACCCTGTGGG + Intronic
1182914125 22:34012390-34012412 CCAGATGAGAACCACAGTGTGGG - Intergenic
949898785 3:8792782-8792804 GCAGCTTTGGACTGCAGTGTGGG + Intronic
950600598 3:14031935-14031957 GCAGATGAGAGCTACAAAGTAGG - Intronic
951259574 3:20491098-20491120 ACAGATGTAACCAACAGTGTTGG + Intergenic
951334911 3:21408771-21408793 GTAGATATGCACTCCAGTGTCGG - Intergenic
951957583 3:28274383-28274405 CCAGATGTGAAATTCTGTGTTGG + Intronic
956314974 3:67925125-67925147 ACAGATGTAAACTACTGTGCTGG - Intergenic
958264673 3:91424043-91424065 GCAGATGTGAGCCACTATGTCGG + Intergenic
958583178 3:96052464-96052486 GCAGAAGTTTACTACAGTGGTGG - Intergenic
959090597 3:101898855-101898877 GCAGATGTTAACTACAGGGTTGG - Intergenic
959699231 3:109282603-109282625 TGAAATGTGAACTCCAGTGTTGG - Intergenic
959699836 3:109288339-109288361 GCAGATGTGCACTCAAGTGAGGG + Intergenic
961139616 3:124544882-124544904 GCAGATGTGGACTGGAGGGTAGG + Intronic
962451143 3:135518191-135518213 GCAGATGTGAAATACAGGAATGG + Intergenic
963251927 3:143111638-143111660 ACAGATGTGAGCTACCGTGCCGG + Intergenic
964611663 3:158621966-158621988 GCAGACAAGAACTACAGTGTTGG - Intergenic
965203632 3:165692780-165692802 GCAGAGGTTAACTACAGGGGTGG - Intergenic
967137653 3:186526041-186526063 AGAAATGTGAACTTCAGTGTAGG - Intergenic
968425743 4:522129-522151 ACAGATGTGAACACCTGTGTCGG - Intronic
968645568 4:1738919-1738941 ACAGATGTGAACTACTGATTAGG + Intronic
969491279 4:7500458-7500480 GCAGATGAGGCCTTCAGTGTGGG - Intronic
969868809 4:10092457-10092479 GCAGAGGTGAACCACAGACTTGG - Intronic
971318374 4:25585838-25585860 GCAGGTGTGAGCCACTGTGTAGG + Intergenic
971572139 4:28226665-28226687 GCATATGTGAATTTCAGTGTTGG + Intergenic
976499980 4:85776267-85776289 GCAGAGGTGAACTCCAGGGCAGG - Intronic
977534970 4:98246691-98246713 ACATATGAGAACAACAGTGTTGG - Intergenic
978742323 4:112151075-112151097 TGAAATGTGATCTACAGTGTTGG + Intronic
979715036 4:123827696-123827718 GCAAATGTGAATTGCAGTGTGGG + Intergenic
980947915 4:139341261-139341283 GCAGATTTGGCCTACTGTGTAGG + Intronic
981542254 4:145858353-145858375 ACAGGTGTGAACTACTGTGCTGG - Intronic
982622713 4:157727444-157727466 GGAGATGTGAGCTGCATTGTAGG - Intergenic
983008135 4:162510647-162510669 GCACATGTGAGCTATAATGTGGG + Intergenic
983804747 4:171980705-171980727 GCAGATGTCAACTTCAGAGCTGG - Intronic
984053050 4:174891118-174891140 GTAGATGTCAACTATAGTATGGG + Intronic
987770214 5:22292958-22292980 ACAGATGTGAATTACAGATTGGG - Intronic
987837420 5:23179252-23179274 GCTGATGTGAGCTGCAGTGATGG + Intergenic
987987086 5:25161628-25161650 GCAGATGAGAGCTACAAAGTAGG - Intergenic
989276828 5:39599061-39599083 GCAGATGGGAGCTGCAGTGGTGG + Intergenic
989501855 5:42177301-42177323 GCAGAAGGGAAATACAGGGTTGG - Intergenic
991240983 5:64459330-64459352 GTAGATGTGTCCTATAGTGTTGG - Intergenic
995255364 5:110039933-110039955 GAAGATGTGAACTTCTGAGTTGG + Intergenic
998856450 5:146399325-146399347 GCAGATGGGAACTAGAGTGTGGG - Intergenic
1000509291 5:162162453-162162475 GGAAATGTGAACCCCAGTGTTGG + Intergenic
1000870808 5:166574845-166574867 TGAGATGTAATCTACAGTGTTGG - Intergenic
1003143257 6:3489110-3489132 GCATATGTGGCCTCCAGTGTTGG - Intergenic
1003497728 6:6678875-6678897 GCATATTTGAACTACAGGGAAGG + Intergenic
1003823675 6:9928317-9928339 GCAGATGAGAACAACAGCTTAGG + Intronic
1006508919 6:34511239-34511261 GCAGCTGTGTATTACAGTATGGG + Intronic
1007158075 6:39765386-39765408 GCATATGGGAATTATAGTGTAGG + Intergenic
1007227658 6:40326211-40326233 GCACATGTAAAGTCCAGTGTAGG - Intergenic
1007830459 6:44634443-44634465 GCAGATGGGGACTAAAGTGGGGG + Intergenic
1008248436 6:49207567-49207589 GCAGAAGGGAAATACAGGGTGGG - Intergenic
1008687035 6:53936817-53936839 GATCATGTGAACCACAGTGTTGG + Intronic
1010037159 6:71339549-71339571 GCAGTTGTGAACTGCAGTTTAGG + Intergenic
1010508224 6:76686635-76686657 CCAAATGTGAAAGACAGTGTAGG + Intergenic
1011424698 6:87213680-87213702 ACAGATGTGAACTACTGATTAGG + Intronic
1014463883 6:121730866-121730888 ACAGATGTGAACTACTGATTAGG + Intergenic
1017336879 6:153271806-153271828 GCACATGTGAAGTTCAGTCTAGG - Intergenic
1017747955 6:157463746-157463768 ACAGATGTGAACCACTGTGCCGG - Intronic
1018379831 6:163248654-163248676 TCAGATGTGAAATAGAGTTTTGG - Intronic
1020796665 7:12685695-12685717 GCAGCAGTGGACTACACTGTGGG + Intergenic
1021755024 7:23843325-23843347 GCAAATGTGAACGTGAGTGTGGG - Intergenic
1025024980 7:55509185-55509207 CCAGGTGTGAACCTCAGTGTAGG - Intronic
1026006460 7:66603874-66603896 GCACAATTGAACTCCAGTGTGGG + Intergenic
1027617004 7:80435930-80435952 TGAGATGTGATCTCCAGTGTTGG + Intronic
1028522587 7:91748035-91748057 GTAGTTGTGACCTATAGTGTTGG - Intronic
1031598385 7:123673424-123673446 GCAGATCTGAACTAAAGTACAGG + Intergenic
1034086446 7:148326928-148326950 GCAGATGTGGGCCACAGTTTTGG + Intronic
1035624346 8:1060108-1060130 TCAGATGTGAACCACGGAGTGGG + Intergenic
1036105258 8:5830935-5830957 ACAGATGTGAACTACTGATTAGG + Intergenic
1037221191 8:16524024-16524046 GGAGATGTGAGCTACAGATTAGG - Intronic
1037976950 8:23220578-23220600 GCAGATGTGTGCTGCCGTGTAGG + Intronic
1041624773 8:60013288-60013310 GTAGATTTGAACTACAGGGATGG - Intergenic
1043284432 8:78512095-78512117 GCAGATGGAAACTACACTGGGGG + Intergenic
1043789237 8:84442670-84442692 GAAGCTGTGAACTACATTTTTGG + Intronic
1045146278 8:99347850-99347872 GCAGATGTGAACTACAGTGTGGG - Intronic
1047786392 8:128157811-128157833 GCACATGGGAACCACAGTGAAGG - Intergenic
1048067275 8:130983348-130983370 CTGGATGTGAACTAGAGTGTGGG - Intronic
1049006908 8:139861473-139861495 ACAGATGTGAACTACTGACTAGG + Intronic
1050075512 9:1858439-1858461 GTAGATGTGTCCTATAGTGTTGG - Intergenic
1055196591 9:73601609-73601631 GCAGATGAGAACTTCAGAGAAGG - Intergenic
1055240876 9:74184095-74184117 GCAAAGGTGAACTGCAGGGTGGG + Intergenic
1056163285 9:83919616-83919638 ACAGATGTGAACCACCGTGCTGG - Intronic
1058254209 9:102740840-102740862 GCAGATGTACACTATAGTTTAGG - Intergenic
1059305580 9:113350628-113350650 GCAGGGGTGAACTGCAGAGTCGG - Intronic
1059767506 9:117397505-117397527 CCAGATATGATCTCCAGTGTTGG - Intronic
1060815873 9:126634860-126634882 GCAGGTGTGGGGTACAGTGTGGG + Intronic
1061809673 9:133155025-133155047 GCAGATAGAAAGTACAGTGTAGG - Intronic
1189532320 X:41898948-41898970 GCAGATTTGTACTACACTGTAGG - Intronic
1190340177 X:49290215-49290237 CCTGGTGTGAACCACAGTGTAGG + Intronic
1194604153 X:95960178-95960200 TAAGATGGGAGCTACAGTGTTGG - Intergenic
1194989667 X:100533560-100533582 GCAGACTTGAACAACACTGTAGG - Intergenic
1197650664 X:129060149-129060171 TCAAATGTGATCTCCAGTGTTGG + Intergenic
1198561180 X:137851748-137851770 ACAGAGGGGAATTACAGTGTAGG - Intergenic
1201734496 Y:17243708-17243730 GCAGATATGAAATACTGGGTTGG + Intergenic