ID: 1045147872

View in Genome Browser
Species Human (GRCh38)
Location 8:99367964-99367986
Sequence ATTTTTAAAGGGATTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045147859_1045147872 30 Left 1045147859 8:99367911-99367933 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG No data
1045147860_1045147872 29 Left 1045147860 8:99367912-99367934 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG No data
1045147863_1045147872 -1 Left 1045147863 8:99367942-99367964 CCGCACCTGACCATTTGGTTCCA 0: 1
1: 0
2: 3
3: 14
4: 164
Right 1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG No data
1045147864_1045147872 -6 Left 1045147864 8:99367947-99367969 CCTGACCATTTGGTTCCATTTTT 0: 1
1: 0
2: 2
3: 37
4: 467
Right 1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG No data
1045147862_1045147872 2 Left 1045147862 8:99367939-99367961 CCACCGCACCTGACCATTTGGTT 0: 1
1: 0
2: 9
3: 125
4: 1357
Right 1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045147872 Original CRISPR ATTTTTAAAGGGATTGGGGA AGG Intronic
No off target data available for this crispr