ID: 1045148990

View in Genome Browser
Species Human (GRCh38)
Location 8:99381547-99381569
Sequence AACAGATGTTGGCGAGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11136
Summary {0: 1, 1: 39, 2: 450, 3: 2316, 4: 8330}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045148990_1045148992 13 Left 1045148990 8:99381547-99381569 CCACAATCTCGCCAACATCTGTT 0: 1
1: 39
2: 450
3: 2316
4: 8330
Right 1045148992 8:99381583-99381605 TTAATAATAGCTGTTCTATCTGG No data
1045148990_1045148993 23 Left 1045148990 8:99381547-99381569 CCACAATCTCGCCAACATCTGTT 0: 1
1: 39
2: 450
3: 2316
4: 8330
Right 1045148993 8:99381593-99381615 CTGTTCTATCTGGTGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045148990 Original CRISPR AACAGATGTTGGCGAGATTG TGG (reversed) Intronic
Too many off-targets to display for this crispr