ID: 1045148991

View in Genome Browser
Species Human (GRCh38)
Location 8:99381558-99381580
Sequence CGTCAAAAAATAACAGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10145
Summary {0: 11, 1: 266, 2: 1737, 3: 3302, 4: 4829}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045148991_1045148994 25 Left 1045148991 8:99381558-99381580 CCAACATCTGTTATTTTTTGACG 0: 11
1: 266
2: 1737
3: 3302
4: 4829
Right 1045148994 8:99381606-99381628 TGTGAGATGGCATCTCATTGTGG 0: 250
1: 14033
2: 10417
3: 10113
4: 8100
1045148991_1045148992 2 Left 1045148991 8:99381558-99381580 CCAACATCTGTTATTTTTTGACG 0: 11
1: 266
2: 1737
3: 3302
4: 4829
Right 1045148992 8:99381583-99381605 TTAATAATAGCTGTTCTATCTGG No data
1045148991_1045148993 12 Left 1045148991 8:99381558-99381580 CCAACATCTGTTATTTTTTGACG 0: 11
1: 266
2: 1737
3: 3302
4: 4829
Right 1045148993 8:99381593-99381615 CTGTTCTATCTGGTGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045148991 Original CRISPR CGTCAAAAAATAACAGATGT TGG (reversed) Intronic
Too many off-targets to display for this crispr