ID: 1045148993

View in Genome Browser
Species Human (GRCh38)
Location 8:99381593-99381615
Sequence CTGTTCTATCTGGTGTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045148990_1045148993 23 Left 1045148990 8:99381547-99381569 CCACAATCTCGCCAACATCTGTT 0: 1
1: 39
2: 450
3: 2316
4: 8330
Right 1045148993 8:99381593-99381615 CTGTTCTATCTGGTGTGAGATGG No data
1045148991_1045148993 12 Left 1045148991 8:99381558-99381580 CCAACATCTGTTATTTTTTGACG 0: 11
1: 266
2: 1737
3: 3302
4: 4829
Right 1045148993 8:99381593-99381615 CTGTTCTATCTGGTGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045148993 Original CRISPR CTGTTCTATCTGGTGTGAGA TGG Intronic
No off target data available for this crispr