ID: 1045156550

View in Genome Browser
Species Human (GRCh38)
Location 8:99480855-99480877
Sequence TATGTAAGCAAATCCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045156550_1045156552 3 Left 1045156550 8:99480855-99480877 CCAGCTGTGGATTTGCTTACATA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1045156552 8:99480881-99480903 TGCTTGCATTTTTTCTTCCTGGG No data
1045156550_1045156554 24 Left 1045156550 8:99480855-99480877 CCAGCTGTGGATTTGCTTACATA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1045156554 8:99480902-99480924 GGCTTGTTTTATACAGTATATGG No data
1045156550_1045156551 2 Left 1045156550 8:99480855-99480877 CCAGCTGTGGATTTGCTTACATA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1045156551 8:99480880-99480902 GTGCTTGCATTTTTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045156550 Original CRISPR TATGTAAGCAAATCCACAGC TGG (reversed) Intronic
903113894 1:21162201-21162223 TATCTAAACTAATCCAAAGCAGG + Intronic
903379569 1:22887311-22887333 TATTCCAGCAAGTCCACAGCCGG + Intronic
907421328 1:54349364-54349386 TATGTGAGCAAAACAACTGCCGG + Intronic
908359046 1:63349622-63349644 TATGTAAGTAAATCCATGGGAGG - Intergenic
910337050 1:86145896-86145918 AATGTAAGCAATTTCACAGACGG + Intronic
919505361 1:198391587-198391609 TGGGTTAGCAAATCCGCAGCTGG - Intergenic
920927162 1:210352703-210352725 TCTCTCAGCAAATCCACAGCAGG + Intronic
923049465 1:230380666-230380688 CCTGTAAGCAAATGCACACCTGG + Intronic
1063059788 10:2539252-2539274 TCTGCGAGTAAATCCACAGCTGG - Intergenic
1063304354 10:4883237-4883259 AATGTAAGCAATTCAACAGATGG - Intergenic
1063851124 10:10191849-10191871 TATGGAAGCAAATGCAAAGGTGG - Intergenic
1064607451 10:17058216-17058238 TATGTCAGCAAACACACACCTGG - Intronic
1067250019 10:44578272-44578294 TTTGTAAGGAAATGCACAGATGG + Intergenic
1068183688 10:53556945-53556967 TATGAAAGAAAATACACAGATGG + Intergenic
1071099813 10:82022326-82022348 TAAGTAAGCAAATCCACCACTGG + Intronic
1079282819 11:19103273-19103295 CATGTAATCAAATCAACAACTGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1085213772 11:74808859-74808881 AAGGAAAGCAAATCCACAGCTGG - Intronic
1085239244 11:75038532-75038554 TAACTCAGCAAATCCACTGCTGG - Intergenic
1088946146 11:114514683-114514705 TATGTAAAGAAAATCACAGCTGG - Intergenic
1105962033 13:25350782-25350804 TATATAAACAAATCCAGAACAGG - Intergenic
1110812842 13:79829505-79829527 AATAGAAGCAAATCCACACCTGG - Intergenic
1111220323 13:85196802-85196824 TATGAAAACAAATACACAGATGG + Intergenic
1115224455 14:31088439-31088461 ACTTTAAGCAAAACCACAGCTGG + Intronic
1116062193 14:39937898-39937920 TATGTTAGGGATTCCACAGCAGG + Intergenic
1116141961 14:41007880-41007902 TAAATAAGCAAATCCAGAACAGG + Intergenic
1116508659 14:45716569-45716591 TATGAAGGCACATCCACTGCCGG + Intergenic
1116537464 14:46051315-46051337 TATGTAATTAGATTCACAGCTGG - Intergenic
1116639078 14:47437800-47437822 TATGCAAGCATATCCACTGTAGG + Intronic
1120935408 14:89891070-89891092 TATTAAAACAAATCCACAGATGG - Intronic
1127341961 15:58055607-58055629 TATGTAAGTATATACACAGAAGG + Intronic
1129088670 15:73124802-73124824 TATGTAAGCTCAACCAGAGCAGG + Intronic
1130709648 15:86267078-86267100 TAAGTAAGGAAAACCACAGTGGG + Intronic
1130917406 15:88316445-88316467 TATGTAAGAAGATCTACAGATGG + Intergenic
1135612885 16:23883732-23883754 GAGGGAAGCAAATGCACAGCTGG + Intronic
1136155331 16:28378258-28378280 TTTATAAACAAATTCACAGCTGG - Intergenic
1136207752 16:28737030-28737052 TTTATAAACAAATTCACAGCTGG + Intergenic
1136291986 16:29279525-29279547 TATGCAAGAAAATCCACAAATGG - Intergenic
1136669356 16:31842263-31842285 TATGTAAGGAACTCAACAGCAGG + Intergenic
1141309886 16:82903404-82903426 TGTGTGAGCAAGTCCACTGCGGG - Intronic
1142041559 16:87897552-87897574 TCTGTAACCAAAACCACATCAGG - Intronic
1142097876 16:88253480-88253502 TATGCAAGAAAATCCACAAATGG - Intergenic
1153352741 18:4098969-4098991 TAAGCAAGTAAATCCAAAGCTGG - Intronic
1155556679 18:27027724-27027746 TATGTAAGAAAATGCAGAACTGG - Intronic
1155688179 18:28581385-28581407 TATGTTAGCAAATCTATAACAGG - Intergenic
1155891178 18:31271078-31271100 CATATAAGCATATCCATAGCAGG - Intergenic
1157002119 18:43539269-43539291 TATTTCAGCAAATACAGAGCTGG - Intergenic
1159511007 18:69398751-69398773 TATGCAACCAAATCCAGAACTGG + Intergenic
1159832644 18:73296051-73296073 TGTGAAAACAAATCCACAGTTGG + Intergenic
1164305315 19:24000905-24000927 GCTGTAACCATATCCACAGCAGG - Intergenic
1166335442 19:42103595-42103617 TATATAAGCAATTCAACAGAAGG + Intronic
925255995 2:2488615-2488637 AATGAAAGCAATTCCACTGCTGG - Intergenic
932887173 2:75558957-75558979 TCTGTTGCCAAATCCACAGCAGG - Intronic
942719057 2:178928647-178928669 TCTGTAAGCAAAATAACAGCAGG + Intronic
943838103 2:192541151-192541173 GATATAAGAAAATCCAGAGCAGG - Intergenic
948857932 2:240738948-240738970 AACGTAAGCAAATACACAGCTGG - Intronic
1168802281 20:651330-651352 TATGTAAGCAAAGGCAGAGCTGG + Intronic
1171120672 20:22566623-22566645 TATCTGAGTCAATCCACAGCAGG - Intergenic
1172669491 20:36625124-36625146 CTTGTCAGCACATCCACAGCTGG + Intronic
1175693473 20:61083250-61083272 TATCAGAGCAAAACCACAGCTGG + Intergenic
1176122649 20:63461104-63461126 AAAGTAAGCACATCCACCGCAGG - Intronic
1178871302 21:36379108-36379130 TATTTCAGAAAATCCACAGTAGG + Intronic
950267166 3:11582738-11582760 GATGCATGCAACTCCACAGCAGG + Intronic
952708152 3:36401002-36401024 TCTTTAACCAAGTCCACAGCTGG - Intronic
956408749 3:68956402-68956424 TTTGTATCCAAATACACAGCAGG - Intergenic
961972018 3:130978086-130978108 TATGTCAGCAAATCCTAAGACGG - Intronic
963287652 3:143450818-143450840 TAGGTGAAGAAATCCACAGCAGG + Intronic
964366786 3:155958900-155958922 TGTATAAGTAAATCCACAACTGG + Intergenic
964469446 3:157036989-157037011 TATATAAGCATATGCACATCTGG - Intronic
965027985 3:163327402-163327424 TAAGGATGCAAATCCACAGTTGG + Intergenic
971241597 4:24894061-24894083 TATGCAAGGAAAGCCAGAGCTGG - Intronic
972070369 4:35011971-35011993 AATAGAAGCAAACCCACAGCTGG - Intergenic
975838229 4:78447001-78447023 AGTGTAATCAAATTCACAGCTGG + Intronic
978104711 4:104887699-104887721 CATGTAACTAAATCCAGAGCTGG + Intergenic
978847977 4:113297290-113297312 TTTTTAAGAAAATACACAGCGGG - Intronic
978848045 4:113298059-113298081 TTTTTAAGAAAATACACAGCAGG - Intronic
979441346 4:120753436-120753458 TATTAAAGCAAATCTATAGCAGG - Intronic
982385507 4:154796900-154796922 ACTGTAAACAAATCCACACCTGG - Exonic
985431411 4:189884708-189884730 TTTGTAAAAAAATCCACAACAGG + Intergenic
987865786 5:23535801-23535823 TAAAAAAGCAAATGCACAGCAGG - Intergenic
990174290 5:53090105-53090127 TTTGTAAGCAAATTCAAGGCTGG - Intronic
993772526 5:91947912-91947934 TATGTTAGTATATCCACGGCCGG - Intergenic
995533744 5:113115417-113115439 AATGAAAACAAATCCCCAGCTGG - Intronic
997855545 5:137369447-137369469 TATATAAGCAAAACCCCAACAGG + Intronic
1000241047 5:159408338-159408360 TATTTCAGCAAATCCTCAGAGGG + Intergenic
1005204058 6:23380574-23380596 TTAGTCAGCAGATCCACAGCTGG + Intergenic
1006574342 6:35033313-35033335 GAACTAAGCAAATCCTCAGCTGG + Intronic
1006689506 6:35869095-35869117 TCTGTAGGAAAATCCACGGCTGG - Exonic
1008555713 6:52671276-52671298 TTTGTAAGAAAATTCAGAGCAGG - Intronic
1008803814 6:55403673-55403695 TAAGTAGGCAAAACCACAGAAGG + Intergenic
1020609814 7:10381273-10381295 TATAAAAGCAGATCCACAGTTGG + Intergenic
1020858232 7:13455305-13455327 TGTATAAGAATATCCACAGCAGG - Intergenic
1022452675 7:30529533-30529555 TATGTAAGAAAATTCACCTCTGG + Intronic
1022891690 7:34707600-34707622 TTTGTAATCAAATCCACTGTGGG - Intronic
1023772711 7:43572952-43572974 TAGGAAAGAAAATCCACAGATGG + Intergenic
1024012291 7:45279381-45279403 GATCTAAGCAAATGAACAGCAGG - Intergenic
1026620741 7:71947995-71948017 TATGTAGGAAGATCCACAGAGGG + Intronic
1028141885 7:87283070-87283092 AAGATAAGCAAATCCATAGCTGG - Intergenic
1031108166 7:117571282-117571304 CATGTTAGGAAATCCAGAGCAGG + Intronic
1037229666 8:16642114-16642136 TATATAAGCATATCAACAGATGG - Intergenic
1038956760 8:32476242-32476264 TATGTAAAGAATTCCAGAGCTGG + Intronic
1039376213 8:37036760-37036782 TATTTTAGCAAATCTCCAGCAGG + Intergenic
1039505615 8:38050258-38050280 GATCTAAGCAAATCAACAGGAGG - Intronic
1040991959 8:53361769-53361791 ATTGTTACCAAATCCACAGCTGG - Intergenic
1042104284 8:65308147-65308169 TATGGGAGCAAATGCACAGAAGG + Intergenic
1043046858 8:75336549-75336571 TATTTAAGAAGATACACAGCTGG + Intergenic
1045156550 8:99480855-99480877 TATGTAAGCAAATCCACAGCTGG - Intronic
1050422695 9:5483466-5483488 TATGCAAGCAAATCCCCTGTTGG + Intergenic
1051526068 9:18046087-18046109 TGTGAAAGCAAAACCACAGTGGG + Intergenic
1056386707 9:86102708-86102730 CATGGAAGCAAAGCCATAGCAGG - Intergenic
1057051754 9:91929197-91929219 TATGTTAGAAAATACAAAGCAGG + Intronic
1060863111 9:126972620-126972642 TATGTCTGCAAATCAGCAGCTGG - Intronic
1062093937 9:134693452-134693474 TCTGTAAGCTAATTCACAGAAGG - Intronic
1203738297 Un_GL000216v2:158004-158026 TATGTAATAAATTCCACAGTAGG + Intergenic
1203454546 Un_GL000219v1:153127-153149 TTTGTAAATAAATCCACAACAGG - Intergenic
1188652054 X:32643416-32643438 AATGTATTCAAATCCACAGTTGG + Intronic
1189652073 X:43201235-43201257 TATGCAATCAATTTCACAGCAGG + Intergenic
1194095707 X:89636445-89636467 TATGTCAGCACAACCACAGTAGG + Intergenic
1198606961 X:138351046-138351068 TATGCAAGCAAATTGACAGAAGG + Intergenic
1200448709 Y:3297817-3297839 TATGTCAGCACAACCACAGTAGG + Intergenic