ID: 1045156799

View in Genome Browser
Species Human (GRCh38)
Location 8:99485032-99485054
Sequence GTTCCTGACTTTACAAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045156799_1045156801 7 Left 1045156799 8:99485032-99485054 CCAGCTCTTGTAAAGTCAGGAAC 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1045156801 8:99485062-99485084 GGATTTACTCACAACAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045156799 Original CRISPR GTTCCTGACTTTACAAGAGC TGG (reversed) Intronic
900518166 1:3093017-3093039 GTTCCTGGCTTTACAGGAGTTGG - Intronic
903472058 1:23594047-23594069 GTTCAGGACTTTAGAGGAGCAGG + Intronic
903695282 1:25201698-25201720 GTTCCAGACTTTTAAAGAACCGG - Intergenic
908644458 1:66262338-66262360 CTTCCTCACTTGAGAAGAGCAGG - Intronic
910438207 1:87226833-87226855 GTTCCTGACATAACAAAAACTGG - Intergenic
913159813 1:116134567-116134589 CTTCCTGGCTTTACAAGGCCAGG - Exonic
916609887 1:166381311-166381333 GTTCCTGAGTTTGCTAGAGATGG + Intergenic
917710390 1:177678704-177678726 TTTCCTGTGTTTACAAGAGGAGG + Intergenic
919990453 1:202705494-202705516 TCTCCTGACTTTACAGCAGCAGG + Intronic
1062847754 10:720825-720847 GTACCTGACTTTACACGGGCAGG + Intergenic
1063073241 10:2688522-2688544 CTTCCAGACTTTACAACTGCAGG + Intergenic
1064346904 10:14540721-14540743 GTTCCTGACTTCCCAAGCTCTGG + Intronic
1070842537 10:79497221-79497243 GTCCCCGACTTTTTAAGAGCTGG - Intergenic
1071250283 10:83811196-83811218 TTTCCTGACTTTTCAAAAACTGG - Intergenic
1072202360 10:93171969-93171991 GTTCCTGGCTTTAGAATAGCAGG - Intergenic
1072821209 10:98559638-98559660 GTGCCAGACTGTTCAAGAGCAGG + Intronic
1076241076 10:128908041-128908063 TTTGCTCACTTTACCAGAGCTGG - Intergenic
1079083879 11:17431722-17431744 ATTCCTAAATTTAAAAGAGCAGG + Intronic
1082129496 11:48471122-48471144 GTTCCTGTATCTACATGAGCTGG + Intergenic
1088146277 11:106683769-106683791 GTCCCTGACTTTCTGAGAGCAGG - Intronic
1089749261 11:120638876-120638898 GCCCTTGACCTTACAAGAGCAGG + Intronic
1090424774 11:126599809-126599831 GTTCCTGACTTGACCCCAGCTGG + Intronic
1091340233 11:134806376-134806398 TTCTCTGACTTTACAAGAGGAGG - Intergenic
1099259908 12:80365263-80365285 GTTGCAGACTTTACAGGAGAGGG + Intronic
1100475822 12:94934453-94934475 GTTCCTTCCTTTCCAACAGCTGG + Intronic
1107072212 13:36283088-36283110 ATTCCTGACTTTCCAAGATATGG + Intronic
1109278005 13:60323251-60323273 CTTCCTGACTCTAGAGGAGCTGG + Intergenic
1116586605 14:46713071-46713093 TATACTGACTTTACAACAGCTGG - Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1120479094 14:85026087-85026109 ATTCCAGAATTAACAAGAGCTGG + Intergenic
1126932418 15:53669347-53669369 GTTCCTGACCTTGCTAGAGAGGG - Intronic
1144253952 17:13447114-13447136 GTTCTTGTCTTTAAAGGAGCTGG - Intergenic
1144619200 17:16805552-16805574 GTTCCGGACTGTAGAAGAGAGGG + Intergenic
1144893498 17:18510143-18510165 GTTCCGGACTGTAGAAGAGAGGG - Intergenic
1145138727 17:20434131-20434153 GTTCCGGACTGTAGAAGAGAGGG + Intergenic
1147328884 17:39684713-39684735 GTTCCTGTTCTTTCAAGAGCCGG - Exonic
1147700403 17:42390406-42390428 GCTTCTGACTTCTCAAGAGCTGG + Intergenic
1149988353 17:61365766-61365788 TTTTCTCACTTCACAAGAGCAGG - Intronic
1150858509 17:68776579-68776601 GTGCCTCTCTTAACAAGAGCAGG - Intergenic
1151247551 17:72806532-72806554 GTACCTGAATTTTCAAGAGTGGG - Intronic
1154030334 18:10747992-10748014 TTTCCTAAACTTACAAGAGCAGG + Intronic
1158395733 18:57077336-57077358 CATCCTGACTCTACCAGAGCTGG - Intergenic
1160431015 18:78812557-78812579 GTTCCTGTGTTTCCAAGGGCAGG + Intergenic
1160597356 18:79985788-79985810 GTTACTCACTTTAAAACAGCTGG + Intronic
925584766 2:5453565-5453587 GTTCCTGCCTTTCCTAGACCTGG + Intergenic
925911971 2:8579717-8579739 GTGGCTGACTTCAAAAGAGCAGG + Intergenic
928356011 2:30615209-30615231 GTTCCTGAGTAGGCAAGAGCAGG + Intronic
930909553 2:56615256-56615278 GTTCCAGACAATACAAGACCAGG + Intergenic
932506391 2:72236141-72236163 GTTCCTCTCCTTACTAGAGCAGG + Intronic
947156440 2:227166431-227166453 GTTTCTGAATTTAGAAGAACAGG + Intronic
1168829896 20:840179-840201 GTCCCTGACTTTACAGGGGACGG - Intronic
1173408456 20:42788168-42788190 GTTCCCTTCTTTACAACAGCAGG - Intronic
1175035035 20:55992105-55992127 CTTTCTGACTTTCCAAGAACTGG - Intergenic
1177546519 21:22565426-22565448 GTTCCTGACATTACAATATATGG + Intergenic
1179078574 21:38148238-38148260 CTTCCTGACATTACCAAAGCAGG - Intronic
1181382559 22:22518373-22518395 CTTCCTGACTGTACAAAAACAGG - Intronic
1182914623 22:34018059-34018081 ATTCCTGACTTTGCAAAAACAGG - Intergenic
1183041007 22:35178008-35178030 CCTCCTGGCTTTTCAAGAGCTGG + Intergenic
1184530149 22:45050383-45050405 GTTCCTGGATTTGCAGGAGCTGG + Intergenic
949513052 3:4783349-4783371 GTACCTGAGTTTAAAAGAGGTGG - Intronic
951499965 3:23374192-23374214 GTTCTTTAATTTAAAAGAGCTGG - Intronic
954647275 3:52139401-52139423 GTCCCTCACTCTCCAAGAGCCGG + Intronic
956444904 3:69316819-69316841 TTTCCTGACTTTAAAAAATCAGG + Intronic
957414547 3:79884316-79884338 GTTACTGACATTTCAAGACCTGG + Intergenic
964575252 3:158159079-158159101 GTTCCTTACTGGACAAGAGAGGG - Intronic
970077561 4:12241790-12241812 GTTCCTGAGATTTCAAGAGCAGG - Intergenic
971996266 4:33968853-33968875 GTTACTGACTTTATAAGAATCGG - Intergenic
976314694 4:83646774-83646796 GTTCCTCACTTCACTTGAGCTGG - Intergenic
980299433 4:130968310-130968332 TTTCCTGTCTTTGTAAGAGCTGG + Intergenic
982385591 4:154797891-154797913 GTTCCTGTATTTGAAAGAGCTGG + Exonic
983911026 4:173239623-173239645 GTTCCTGAGTTTAAATGTGCTGG + Intronic
993120967 5:83773916-83773938 GTTCTTGACTTTACAAAGGAAGG - Intergenic
997101675 5:130976071-130976093 GATTCTGACTTTACAAGGCCAGG - Intergenic
998898416 5:146825119-146825141 GTTCCTCACATTACAAGGTCAGG + Intronic
1001679795 5:173547688-173547710 AGTCCTGACTTTACTTGAGCAGG - Intergenic
1004334938 6:14756077-14756099 TTTCTTGTCTTTGCAAGAGCCGG - Intergenic
1006137287 6:31902625-31902647 GTTACTAGCTTTACAAGAGTTGG - Intronic
1006244720 6:32721305-32721327 GTTCCTGATTGTAGAAGAGGAGG + Intergenic
1008047658 6:46867716-46867738 GCTTCTGACTTTTCCAGAGCTGG - Intronic
1008240380 6:49102644-49102666 GTTCCTCCCTTTAAGAGAGCAGG - Intergenic
1008524649 6:52396103-52396125 GTCCCTGCCTTTAAAGGAGCTGG + Intronic
1008890831 6:56487787-56487809 GTTACTGAATATACAATAGCAGG + Intronic
1010965442 6:82200984-82201006 CTTCCTAAATTTACAAGAGGGGG + Intronic
1011567596 6:88694018-88694040 GTTCCTGATCTTAGAAGAGAAGG - Intronic
1012186652 6:96225265-96225287 AATTATGACTTTACAAGAGCAGG + Intergenic
1013454533 6:110318175-110318197 GTTCCTGACTTTAGCAAAGGAGG - Intronic
1013967095 6:115967914-115967936 GTGCCTGACTTCCCAAGATCTGG - Intronic
1014545638 6:122732350-122732372 ATTCCTGTTTTTCCAAGAGCAGG + Intergenic
1023582039 7:41693524-41693546 GCCCCTGATTTCACAAGAGCAGG + Intronic
1023629652 7:42151370-42151392 GTTGCTAAATTTATAAGAGCAGG - Intronic
1024525844 7:50348647-50348669 GTTGCTGACTTAACAATATCTGG - Intronic
1032453700 7:132056037-132056059 CTCCCTGACTTCACAAGAGTTGG + Intergenic
1033920814 7:146388983-146389005 GATCCTGACTTCAGAAGAACTGG + Intronic
1036962459 8:13259966-13259988 GTTCTAGACATTACAAGAGCAGG + Intronic
1040458457 8:47623127-47623149 GTGACTTACTTTACAAGAGGAGG - Intronic
1040896478 8:52373870-52373892 GCTCCTGAATTTATAGGAGCCGG - Intronic
1045156799 8:99485032-99485054 GTTCCTGACTTTACAAGAGCTGG - Intronic
1046951361 8:120022843-120022865 GTCCCTGACTTTACAAGTGGGGG - Intronic
1050802253 9:9629989-9630011 CTTCCTTACTTTCCAAAAGCTGG - Intronic
1052697058 9:31891494-31891516 GTTCCTGCCCTTTCTAGAGCTGG - Intergenic
1053538576 9:38949922-38949944 GTTACTGACTTTGCAAGCGGTGG + Intergenic
1185504520 X:621383-621405 GTTTCTGACTTTAAAAGGGGAGG + Intergenic
1188635974 X:32432071-32432093 GTTCCTCACCTTACAAGAATAGG + Intronic
1188870354 X:35364385-35364407 GTACCTGGCTTTACAGCAGCAGG + Intergenic
1196130437 X:112149653-112149675 GTTGCTGAATGAACAAGAGCAGG - Intergenic
1198431239 X:136568180-136568202 GTTGCTGACTTTAAAACAGAAGG - Intergenic
1200299337 X:154956930-154956952 GTTCTTGCCTTTCCAAGTGCTGG - Intronic
1201268420 Y:12231090-12231112 GCTCCTGACATTATAAGAGCTGG - Intergenic