ID: 1045158883

View in Genome Browser
Species Human (GRCh38)
Location 8:99513381-99513403
Sequence ATGTGATATTAGAGGTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045158880_1045158883 5 Left 1045158880 8:99513353-99513375 CCAAAATTTCATTGAAACATAAG 0: 1
1: 0
2: 3
3: 24
4: 382
Right 1045158883 8:99513381-99513403 ATGTGATATTAGAGGTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045158883 Original CRISPR ATGTGATATTAGAGGTGAGA GGG Intronic
No off target data available for this crispr