ID: 1045159475

View in Genome Browser
Species Human (GRCh38)
Location 8:99522421-99522443
Sequence GAGTTGTATTTTTACTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045159472_1045159475 2 Left 1045159472 8:99522396-99522418 CCTTTCCGCTTTCTGGCTTTTGC 0: 1
1: 0
2: 0
3: 18
4: 300
Right 1045159475 8:99522421-99522443 GAGTTGTATTTTTACTTTCTGGG No data
1045159471_1045159475 3 Left 1045159471 8:99522395-99522417 CCCTTTCCGCTTTCTGGCTTTTG 0: 1
1: 0
2: 1
3: 46
4: 593
Right 1045159475 8:99522421-99522443 GAGTTGTATTTTTACTTTCTGGG No data
1045159468_1045159475 17 Left 1045159468 8:99522381-99522403 CCTTTCCTTCTGTACCCTTTCCG 0: 1
1: 0
2: 1
3: 41
4: 604
Right 1045159475 8:99522421-99522443 GAGTTGTATTTTTACTTTCTGGG No data
1045159473_1045159475 -3 Left 1045159473 8:99522401-99522423 CCGCTTTCTGGCTTTTGCATGAG 0: 1
1: 0
2: 1
3: 26
4: 306
Right 1045159475 8:99522421-99522443 GAGTTGTATTTTTACTTTCTGGG No data
1045159469_1045159475 12 Left 1045159469 8:99522386-99522408 CCTTCTGTACCCTTTCCGCTTTC 0: 1
1: 0
2: 0
3: 15
4: 267
Right 1045159475 8:99522421-99522443 GAGTTGTATTTTTACTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045159475 Original CRISPR GAGTTGTATTTTTACTTTCT GGG Intronic
No off target data available for this crispr