ID: 1045172659

View in Genome Browser
Species Human (GRCh38)
Location 8:99687634-99687656
Sequence CGGGAGAGAGTAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045172659_1045172665 26 Left 1045172659 8:99687634-99687656 CCCACAATCACTACTCTCTCCCG 0: 1
1: 0
2: 2
3: 35
4: 198
Right 1045172665 8:99687683-99687705 GTGCCACACAGCCACCCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045172659 Original CRISPR CGGGAGAGAGTAGTGATTGT GGG (reversed) Intronic
900163228 1:1234415-1234437 CGGGAGAGAGTGGTGATCTGTGG + Exonic
900543400 1:3215472-3215494 CGGGAGAGAGTGGTTTGTGTGGG + Intronic
902157696 1:14502950-14502972 CAGGAGAGAAGAATGATTGTGGG - Intergenic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
905251031 1:36648461-36648483 TGGGTCAGAGTAGTGTTTGTGGG + Intergenic
905319402 1:37105264-37105286 CCAGAGAGAGTAGTCATTGCTGG - Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907379836 1:54077405-54077427 CCTGAGAGAATAGTGGTTGTGGG - Intronic
908554891 1:65248082-65248104 CTGGAGCGAGCAGTGATTGTGGG + Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
912332183 1:108830111-108830133 AAGGAGAGAGTAGGGATGGTGGG + Intronic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916677087 1:167073232-167073254 GGGGAGGGAGCAGTGAATGTTGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917608095 1:176656560-176656582 CCGGGAAGAGTAGTTATTGTTGG + Intronic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922596834 1:226820363-226820385 CGGGAGAGAAGAGTGGCTGTGGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086325112 11:85690868-85690890 CTGGATAGAGGAGTGATAGTGGG + Intergenic
1086457818 11:86976670-86976692 CCCGAGAGAGTAGAGAATGTAGG + Intergenic
1088098378 11:106126402-106126424 TAGGAGAGAGAAGTGATTCTAGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1091708722 12:2721697-2721719 TGGGAGAGAGAAGTTAATGTAGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1094226251 12:28049423-28049445 CTGGAGAGTGGAGTGATTTTTGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1104922371 12:132297522-132297544 CGGGAGTGATTGGTTATTGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107869379 13:44732990-44733012 CGGGAGAGAGTTGGGAGTGCAGG - Intergenic
1108623290 13:52204540-52204562 CAGAAGAGAGCAGTGAGTGTTGG - Intergenic
1108663439 13:52606497-52606519 CAGAAGAGAGCAGTGAGTGTTGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1115186364 14:30692453-30692475 AGGGAGAGAGTAGGGATTGAAGG + Intronic
1115618257 14:35116900-35116922 CAGTAGAGGGTAGTGATTCTTGG - Intronic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1122840721 14:104461520-104461542 CGGGAGAGAGAAGAGGCTGTGGG + Intergenic
1124880385 15:33636717-33636739 GGGGAGATAATAGTGATAGTTGG + Intronic
1128387366 15:67159654-67159676 AGGGAGGGAGTAGGGATTGGAGG - Intronic
1136549605 16:30975925-30975947 CGGGAGAGAGGAATGCTTGCTGG + Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144809176 17:17987722-17987744 CTGGAGAGGGTAGTGAATATTGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150013142 17:61525023-61525045 CAGGTGTGAATAGTGATTGTAGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159435286 18:68408564-68408586 CAGGAGAGAGCAGGGAGTGTGGG + Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1162675636 19:12295977-12295999 CGTGAGAGGGTCGTGATTGATGG - Intergenic
1164816659 19:31209374-31209396 CAGGACAGAGTAGTGATTAGGGG + Intergenic
1165372010 19:35414400-35414422 TGGAAGAGTGTACTGATTGTTGG + Intergenic
1165395221 19:35560179-35560201 TGGGAGAGGGTAGTGACAGTGGG + Intronic
1166746250 19:45143221-45143243 AGGGAGACAGTGGTGACTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930400016 2:50872424-50872446 GGGGAGCGAGTAGTGATATTGGG + Intronic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
936237169 2:110752525-110752547 AGAGAGAAAGTAGTGATTGAGGG + Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
938190702 2:129277591-129277613 CGAGAGAGTGGAGTGATTGAAGG - Intergenic
938745587 2:134275206-134275228 CGGGAGAGAGATGAGATTGCAGG + Intronic
939854633 2:147343662-147343684 CAGGAGAGAGTAGTGTGTGAGGG - Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170628574 20:18048756-18048778 CGGGAGATAGGAGAGAATGTTGG - Intronic
1171024932 20:21621605-21621627 CTGGGAAGAGTAGTGATGGTGGG + Intergenic
1175010890 20:55734593-55734615 CAGGAGAGAGAAGTGTTTGAAGG + Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177849725 21:26332458-26332480 AGAGAGAGTGTAGTGATTCTGGG + Intergenic
1178166947 21:29990001-29990023 ATGGAGAGATTAGTGTTTGTTGG + Intergenic
1183511858 22:38240256-38240278 CGTGAGAGAGTATTGTTTTTTGG - Intronic
951125961 3:18983384-18983406 AGGGAGAGAGACATGATTGTGGG - Intergenic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
954252052 3:49375555-49375577 CGGAAGAAACTGGTGATTGTTGG - Exonic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
961199453 3:125032718-125032740 AGACAGAGAGAAGTGATTGTAGG + Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963194965 3:142516780-142516802 TGTGAGAGAGAAGTGATAGTTGG - Intronic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
966352477 3:179045886-179045908 CAGGAGAGAGAAGTGATACTTGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
985167444 4:187111912-187111934 CAGGAGAGAGAAGTGATCCTTGG - Intergenic
986076872 5:4346959-4346981 AGGGAGAGAGTAGCTAATGTCGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
989200737 5:38760331-38760353 GGGGAAAGAGGAGTGAGTGTGGG + Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
994534736 5:101014613-101014635 TGGGATAGACTATTGATTGTAGG + Intergenic
995215572 5:109590976-109590998 TGGGGGAGAGTAGTGGTTTTTGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995630822 5:114130008-114130030 GGGGAGAGAGCACTGAATGTTGG + Intergenic
995697908 5:114900389-114900411 AGGAAGAGTGTTGTGATTGTGGG - Intergenic
1001122219 5:168990232-168990254 GGGAAGAGAGGAGAGATTGTGGG - Intronic
1001901014 5:175429746-175429768 CTGGAGAGAGGACTGATTCTAGG + Intergenic
1002201357 5:177530504-177530526 AGGGAGAGATGATTGATTGTGGG - Intronic
1003579239 6:7324686-7324708 CGGAAGAGAGAAGTGAAAGTTGG - Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010122970 6:72400634-72400656 CGGGTGAGGGGAGTGAGTGTGGG - Exonic
1011195706 6:84777204-84777226 TGGGAGAGAGCAGTGAGTGCTGG + Intergenic
1012349189 6:98230590-98230612 TGGCAGACAGTAGTGATTATGGG - Intergenic
1015346088 6:132161442-132161464 CTGGAGACATTTGTGATTGTCGG + Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017650389 6:156576169-156576191 GGGGAGAGTGAAGTGAGTGTGGG + Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024603984 7:51010251-51010273 CGGGAGAGTGGAGTCATTGGCGG - Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027603054 7:80263409-80263431 GCGGAGAGAGTGGTGAATGTGGG + Intergenic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031021763 7:116636217-116636239 GGGGAGGGAGAAGTGATTGTTGG - Intergenic
1033232030 7:139606782-139606804 GGGGAGAGACTATTGAATGTGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1037794014 8:21976307-21976329 GGGAAGAGAGGAGTGATTTTGGG + Intronic
1038129197 8:24710312-24710334 CAGTAGAGAGTAGTGGTTGACGG - Intergenic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045067368 8:98460750-98460772 CAGGAGAGAGTAGAGAGTGAAGG - Intronic
1045168070 8:99629512-99629534 GGGAAGAGAGCAGTTATTGTGGG + Intronic
1045172659 8:99687634-99687656 CGGGAGAGAGTAGTGATTGTGGG - Intronic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051582929 9:18696374-18696396 CTGGAGAGAGTAGTAACTGGGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058712578 9:107693694-107693716 CGGGAGAGAGAAGTGTTTTAGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060360511 9:122951950-122951972 CGGCACAGAGCAGTGACTGTAGG + Intronic
1186458984 X:9733406-9733428 TGGGAGAAAATAGTAATTGTGGG + Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188539447 X:31233193-31233215 CAGGAGAGAGCAGTGACTGAAGG - Intronic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG + Intergenic
1192069528 X:67922544-67922566 AGAGAGAGTGTAGTGGTTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195765266 X:108289715-108289737 AGGGAGAGAGAAGTGAGTGCAGG - Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196871383 X:120116165-120116187 CGGGTGAGGGTAGGGGTTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197657597 X:129133937-129133959 AGGGAGAAAGTACTGACTGTAGG + Intergenic
1197887222 X:131231126-131231148 TGGGAGAGCGGAGTGATTGGAGG + Intergenic
1198274123 X:135085525-135085547 AGGGAGAGTGTAGTTATAGTGGG - Intergenic
1198804558 X:140481172-140481194 CAGGAGAGGGTAGTGATCTTGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199447110 X:147938259-147938281 CTGGAGGGAGGAGTGTTTGTGGG + Intronic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1201038926 Y:9809790-9809812 GGGGAGAGTGTTGTGAGTGTTGG - Intergenic