ID: 1045173548 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:99696647-99696669 |
Sequence | TCTCCTCGATGGTGTCCTGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1045173548_1045173553 | 4 | Left | 1045173548 | 8:99696647-99696669 | CCTCCAGGACACCATCGAGGAGA | No data | ||
Right | 1045173553 | 8:99696674-99696696 | CTTGAAGAACATAGCAGCCAAGG | 0: 1 1: 0 2: 1 3: 14 4: 174 |
||||
1045173548_1045173554 | 5 | Left | 1045173548 | 8:99696647-99696669 | CCTCCAGGACACCATCGAGGAGA | No data | ||
Right | 1045173554 | 8:99696675-99696697 | TTGAAGAACATAGCAGCCAAGGG | 0: 1 1: 0 2: 1 3: 13 4: 233 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1045173548 | Original CRISPR | TCTCCTCGATGGTGTCCTGG AGG (reversed) | Intronic | ||