ID: 1045173548

View in Genome Browser
Species Human (GRCh38)
Location 8:99696647-99696669
Sequence TCTCCTCGATGGTGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045173548_1045173553 4 Left 1045173548 8:99696647-99696669 CCTCCAGGACACCATCGAGGAGA No data
Right 1045173553 8:99696674-99696696 CTTGAAGAACATAGCAGCCAAGG 0: 1
1: 0
2: 1
3: 14
4: 174
1045173548_1045173554 5 Left 1045173548 8:99696647-99696669 CCTCCAGGACACCATCGAGGAGA No data
Right 1045173554 8:99696675-99696697 TTGAAGAACATAGCAGCCAAGGG 0: 1
1: 0
2: 1
3: 13
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045173548 Original CRISPR TCTCCTCGATGGTGTCCTGG AGG (reversed) Intronic