ID: 1045173548

View in Genome Browser
Species Human (GRCh38)
Location 8:99696647-99696669
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 2, 1: 1, 2: 0, 3: 12, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045173548_1045173553 4 Left 1045173548 8:99696647-99696669 CCTCCAGGACACCATCGAGGAGA 0: 2
1: 1
2: 0
3: 12
4: 136
Right 1045173553 8:99696674-99696696 CTTGAAGAACATAGCAGCCAAGG 0: 1
1: 0
2: 1
3: 14
4: 174
1045173548_1045173554 5 Left 1045173548 8:99696647-99696669 CCTCCAGGACACCATCGAGGAGA 0: 2
1: 1
2: 0
3: 12
4: 136
Right 1045173554 8:99696675-99696697 TTGAAGAACATAGCAGCCAAGGG 0: 1
1: 0
2: 1
3: 13
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045173548 Original CRISPR TCTCCTCGATGGTGTCCTGG AGG (reversed) Intronic
903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG + Intergenic
904897912 1:33831084-33831106 TCTCCTGGATAGTATCCTGCAGG - Intronic
906120283 1:43385273-43385295 TCTCCCTGAAGGTGTCCAGGAGG + Intronic
908657302 1:66401863-66401885 TCTCCTAAATGGAGTCCTGGTGG + Intergenic
915780209 1:158541637-158541659 TCTGCTTGATGGTGTCCCGTGGG + Intergenic
917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG + Intronic
918307198 1:183258102-183258124 TCTCCTCCATGGGCTCCTGTAGG - Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
919744447 1:200999906-200999928 TCTCCTCGCTGTTCTCCTGTTGG + Exonic
920704517 1:208241955-208241977 TCTCCTTGGTGGTGGCCTGGAGG - Intronic
921840542 1:219823510-219823532 GCTCCACTATGGTGCCCTGGTGG + Intronic
1065390387 10:25175993-25176015 TCTCCTCGCGCGTGGCCTGGAGG - Exonic
1071076465 10:81759441-81759463 TCTTCTCCATGGTGGCCAGGTGG - Intergenic
1076607963 10:131701613-131701635 TCTCCTCACTGGTGTCCTGATGG - Intergenic
1078834663 11:15015769-15015791 TCTCCTGGATGATATCCTGCTGG - Intronic
1083147088 11:60767753-60767775 TCTCCTAGGTGGGGGCCTGGAGG + Intronic
1084537349 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG + Intergenic
1084816519 11:71650527-71650549 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
1085702441 11:78756917-78756939 TCTCCTGGATGATGTCCAGAGGG + Exonic
1092426474 12:8379507-8379529 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1095186760 12:39209304-39209326 TCTCCTGGATAATGTCCTGAAGG - Intergenic
1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1102969852 12:117157776-117157798 CCTCCTCCACTGTGTCCTGGGGG + Intronic
1112804366 13:103146703-103146725 TCTCCACGATACTGTCATGGTGG - Intergenic
1113227616 13:108176371-108176393 TCTCCCTGATGGGTTCCTGGGGG - Intergenic
1117071693 14:52063293-52063315 TCTCCTCTCTGGGATCCTGGGGG - Intronic
1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG + Intergenic
1124423305 15:29540915-29540937 TATCCTAGATGATGTCCTAGTGG + Intronic
1129457910 15:75685443-75685465 TCCCCTCGAGGGCGTCCTTGTGG - Exonic
1132437455 15:101820653-101820675 TCTCATCGTTTGTGTCCTAGGGG + Intergenic
1134205513 16:12234523-12234545 TTTTCTCGATGGTGTCCTTGAGG + Intronic
1136509629 16:30728959-30728981 TTTCCTCCAGGGAGTCCTGGGGG - Exonic
1138264692 16:55652115-55652137 TCTCCTCATTGGTGCCATGGAGG + Intergenic
1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG + Intergenic
1143417084 17:6758179-6758201 GCTCCTCCATGGTTTCCTTGGGG - Exonic
1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG + Intronic
1148339498 17:46864873-46864895 GCTCCTGGAAGGTGTCCTGGAGG - Intronic
1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG + Exonic
1150440924 17:65190731-65190753 TCTCCTAGATGATGTCCTATGGG - Intronic
1152294574 17:79459224-79459246 TCACCTCTATGGGGCCCTGGAGG + Intronic
1157572398 18:48721634-48721656 TCTGCACAATGGTGTCCTTGGGG - Intronic
1160964696 19:1741953-1741975 TCTCCCAGCTGGTGTCCTTGGGG - Intergenic
1163516026 19:17764369-17764391 TCTCCTCGATGGTGGCCCTGGGG - Exonic
1165077514 19:33288405-33288427 TCTCCTCAATTTTGGCCTGGTGG - Intergenic
1165183672 19:33996868-33996890 TCTCTTCAATGTTGTACTGGAGG + Intergenic
1165443358 19:35843552-35843574 TCACCTCAGTGGGGTCCTGGAGG + Exonic
1165751840 19:38264952-38264974 GCTCCTCTCTGGGGTCCTGGCGG + Exonic
1167471932 19:49680266-49680288 TCCCCTGGATGGTGCTCTGGGGG + Intronic
1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG + Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
927089623 2:19700647-19700669 TCTGCTGGGTGGTGGCCTGGTGG - Intergenic
929584153 2:43102868-43102890 TCTGCTTGATGCTGTGCTGGTGG - Intergenic
930019889 2:46995145-46995167 CTTCCTCGATGTTGTCCTTGGGG - Exonic
930606304 2:53496885-53496907 TCTCCTCAGTGGTGTGTTGGTGG + Intergenic
931694986 2:64864986-64865008 TCTCCGGGGTGGGGTCCTGGGGG - Intergenic
934067123 2:88350651-88350673 TCTGCTCTGTGGTCTCCTGGGGG - Intergenic
942591078 2:177547608-177547630 TTTTCTCCCTGGTGTCCTGGAGG - Intergenic
946410839 2:219514466-219514488 TCTCCTCGATCGTCTCCTTGTGG - Exonic
946914358 2:224501701-224501723 ACTCTTAGATGGTGTACTGGGGG + Intronic
947908982 2:233789532-233789554 CCTGCTGGATGATGTCCTGGAGG - Exonic
948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG + Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1171355726 20:24544243-24544265 TCTCACCGGTGCTGTCCTGGGGG - Intronic
1171847599 20:30286474-30286496 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1172188101 20:33044089-33044111 TCTCCTCCATGGGGTGCAGGTGG - Intergenic
1173105628 20:40130932-40130954 TCACATCGATGGTGACCTGAGGG + Intergenic
1173447765 20:43135478-43135500 TCACATTGATGGTCTCCTGGTGG + Intronic
1173776880 20:45715908-45715930 TCTCCTGGATGATATCCTGAAGG - Intergenic
1175214215 20:57382242-57382264 TGTCCGCGATGGTTTCCTCGTGG + Intergenic
1177332142 21:19678689-19678711 TCTCCTGGATGATATCCTGAAGG + Intergenic
1181093295 22:20489046-20489068 CCTCTTCGATGTTGTGCTGGTGG - Exonic
1181167158 22:20989875-20989897 TCTCCTCCCTGGTGACCTGCGGG + Intronic
1183621202 22:38973843-38973865 TCTCCTCCAGTGTGGCCTGGGGG - Intronic
1185256367 22:49835176-49835198 TCTCCTCCAGGATGTCCTGTAGG + Intergenic
950579677 3:13854038-13854060 GCCCCAGGATGGTGTCCTGGGGG - Intronic
951558718 3:23945566-23945588 TCACCTCCATGGTGCCCTCGCGG - Exonic
952848828 3:37711323-37711345 TCTCCTGGATGGTTTCATTGGGG - Intronic
953716614 3:45321468-45321490 TCTTATAGATGGTGCCCTGGGGG + Intergenic
954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG + Exonic
954200939 3:49022710-49022732 TGTCTTCGGTGATGTCCTGGTGG - Exonic
954692266 3:52401873-52401895 TCTCCTAGGAGCTGTCCTGGTGG - Exonic
957071148 3:75568807-75568829 TCTGCACTCTGGTGTCCTGGGGG - Intergenic
959791635 3:110368657-110368679 TCTCATCTATGGTTTCCTGTAGG + Intergenic
960818326 3:121697813-121697835 TCTCCTCGATGGTTTGTTGGAGG + Exonic
961282959 3:125777911-125777933 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
961500099 3:127326321-127326343 TCCCCTAGAGAGTGTCCTGGTGG - Intergenic
961862490 3:129927743-129927765 TCTCCTCTGTCGTGTCCTGGCGG - Intergenic
962989298 3:140564052-140564074 TCTCCTGGATGAAGTGCTGGTGG - Exonic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969014758 4:4096511-4096533 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
969609343 4:8218286-8218308 CATCGTCGATGGGGTCCTGGGGG - Exonic
969739183 4:9011936-9011958 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
982986111 4:162208946-162208968 TCTATTCAATGTTGTCCTGGTGG + Intergenic
984878303 4:184388925-184388947 CCTCTTTGATGGTGACCTGGAGG + Exonic
986438525 5:7758739-7758761 CCTGCTCGATGGAATCCTGGAGG + Intronic
989111032 5:37906847-37906869 GCTCCTTGGTGGTGTCCTGGGGG + Intergenic
997915139 5:137917116-137917138 TCTACTTGATGGTGTCCTGCAGG + Intronic
997976693 5:138445350-138445372 AGTCCTCGATGGTGTCCAGGAGG - Exonic
1000633260 5:163615200-163615222 TCTCCTCCCTAGTTTCCTGGTGG + Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1008185773 6:48388765-48388787 TCTCTTCAATGGTGTACTGCAGG + Intergenic
1010370429 6:75100711-75100733 TCTGCCCAATGGTGTCTTGGAGG + Intronic
1011359173 6:86503557-86503579 CCTACTCAATGATGTCCTGGTGG + Intergenic
1013235926 6:108197906-108197928 CCTCCTCTTTGGTGTCTTGGTGG + Intergenic
1017656601 6:156635195-156635217 CCTCCGCGAAGGTGTCGTGGGGG + Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1020688282 7:11322909-11322931 TCTCCTGGATGGAGGCCTAGAGG + Intergenic
1022498707 7:30869160-30869182 TCTCCTCCATGTCCTCCTGGGGG - Intronic
1023811961 7:43918791-43918813 ACTCCTCCATGGTGCCCTTGGGG - Intronic
1023846924 7:44127062-44127084 TCTGCTTGATGGTGTCCCGCAGG + Intergenic
1024995177 7:55268745-55268767 TCTCCTGGAGGGACTCCTGGAGG - Intergenic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1029073430 7:97918140-97918162 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1029726307 7:102407857-102407879 CCTCCTCGATCTTGTCCAGGAGG + Intronic
1030273080 7:107690925-107690947 TCTCTTCGACTGTGTCCTGCTGG - Intronic
1034330069 7:150274888-150274910 TCTCCTGGATGACGTTCTGGCGG + Intronic
1034667985 7:152834970-152834992 TCTCCTGGATGACGTTCTGGCGG - Intronic
1036256481 8:7210589-7210611 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036308531 8:7669174-7669196 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036889961 8:12590098-12590120 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036897574 8:12648259-12648281 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1042471132 8:69189278-69189300 TTTCCTCTGTGGTGTACTGGTGG + Intergenic
1043738460 8:83776057-83776079 TATCCTCTTTGATGTCCTGGGGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045390000 8:101705727-101705749 TCTCCTCCATGGTGGCTTTGGGG - Intronic
1047855783 8:128910117-128910139 TCTCCTTGAAGGTGTCCTACAGG - Intergenic
1049311145 8:141934592-141934614 TGTCCTAGATGCTGTCCTTGTGG - Intergenic
1049656675 8:143802167-143802189 TGTCCTTGAGGGAGTCCTGGTGG - Intronic
1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG + Intronic
1051484641 9:17594721-17594743 TCTCCTTGATGGTATCCTCTAGG + Intronic
1051955407 9:22687072-22687094 TCTTCTCTATGCTTTCCTGGAGG + Intergenic
1052160284 9:25248911-25248933 TCTGCTTGATGGTGTCCTACAGG - Intergenic
1053053202 9:34978100-34978122 TCTGCTCCATGCTATCCTGGGGG - Exonic
1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054159330 9:61663067-61663089 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054479104 9:65594072-65594094 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1057208633 9:93187654-93187676 TCTCCTCACTGGTGACCTTGGGG - Intronic
1059860868 9:118460002-118460024 TGTCCTCTATGATTTCCTGGAGG + Intergenic
1203785799 EBV:126798-126820 TTCCCTCGGTGGTGTCCTGCCGG + Intergenic
1188262111 X:28034359-28034381 GCTCCTCCCTGGTATCCTGGAGG - Intergenic
1192845325 X:74901318-74901340 TCTCCTAGGTTGTTTCCTGGAGG + Intronic
1197813405 X:130471101-130471123 TCTCCAGCATGGTGTCCAGGGGG - Intergenic
1199679265 X:150214301-150214323 TCTCCTCACTGGTCTCCAGGTGG + Intergenic
1200977111 Y:9224827-9224849 TCTCCTTGATCGTGTCCTACTGG - Intergenic
1202032182 Y:20588652-20588674 TCTCTTTGATGGTGTCATGAGGG - Intronic
1202036525 Y:20642047-20642069 TCTCCTTGATGGTGAACAGGAGG - Intergenic
1202041888 Y:20694445-20694467 TCTCCTGGATAGTATCCTGAAGG + Intergenic
1202071098 Y:20992282-20992304 TCTCCTGGTTGGTCTCCTAGAGG - Intergenic
1202133986 Y:21641152-21641174 TCTTCTTGATGGTGTCCTACTGG + Intergenic