ID: 1045174137

View in Genome Browser
Species Human (GRCh38)
Location 8:99702864-99702886
Sequence CTAGCATTACAAATCTATTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045174137 Original CRISPR CTAGCATTACAAATCTATTT CGG (reversed) Intronic
902346055 1:15818591-15818613 CCAGCATTATAAATGTAATTCGG + Intergenic
903001115 1:20266571-20266593 CTGCCATTCCAAATCTTTTTGGG + Intergenic
905642981 1:39604874-39604896 CTAGTATTACAAAACAAGTTAGG + Intergenic
906895775 1:49769584-49769606 CTACCATTACCATGCTATTTTGG - Intronic
908365501 1:63418985-63419007 CCGGCAAAACAAATCTATTTTGG - Intronic
908794138 1:67814892-67814914 CTGGCATTACAACTCCATTAGGG - Intronic
908841412 1:68283812-68283834 CTTGCATTACAAATTCATGTTGG - Intergenic
910402853 1:86854622-86854644 TTTGCGTTACAAATCTAATTTGG - Intergenic
911545578 1:99212266-99212288 CTAGTATTACGAAAATATTTTGG - Intergenic
911685606 1:100773588-100773610 ATAGCACTTCACATCTATTTAGG - Intergenic
913207615 1:116555499-116555521 CTAGCATAGAAAATCTTTTTAGG - Intronic
913262807 1:117015619-117015641 CTGGCATTAGAAATCTAAATAGG - Intronic
915653005 1:157333078-157333100 ATAGCAATACAAAGGTATTTAGG - Intergenic
915750226 1:158200263-158200285 CTAGTATTATAAATATATTTGGG + Intergenic
915783082 1:158576061-158576083 CTAGTATTATAAATTTATTTTGG - Intergenic
916779690 1:168011481-168011503 CAGGAATTACAAATTTATTTTGG + Intronic
916987856 1:170210653-170210675 CTTTCATTACAAATTGATTTGGG + Intergenic
919061353 1:192637738-192637760 ATAGAACTACAAATCTACTTTGG - Intronic
922027584 1:221765499-221765521 CTAACTTTACAAATTTTTTTTGG + Intergenic
922418198 1:225441209-225441231 CAAGCACTACAAATAGATTTAGG - Intergenic
1063260305 10:4380794-4380816 TTAGAATTACAAATATATATTGG - Intergenic
1065255574 10:23863678-23863700 ATAGCATTACAAATGGACTTAGG + Intronic
1068113430 10:52709119-52709141 CTAGAATTAGAAATCAGTTTTGG + Intergenic
1068798887 10:61116614-61116636 CTATGATAACAAATCCATTTAGG + Intergenic
1069144808 10:64877650-64877672 TAAGCATTAAAAATCTATTATGG - Intergenic
1069163922 10:65125393-65125415 CTAGCATTACAATGCTACTCTGG + Intergenic
1070509056 10:77143055-77143077 CTGGCATTATAAATCAAGTTGGG - Intronic
1079631919 11:22688039-22688061 TTACAATTACAAATCTATTTGGG - Intronic
1081418578 11:42844758-42844780 ATAGCATTACAAAGATATCTGGG - Intergenic
1090892699 11:130940279-130940301 ATTGCATTATAAATCTATCTGGG - Intergenic
1094344842 12:29456042-29456064 CTAGTATTCCAATTTTATTTTGG + Intronic
1099090456 12:78300432-78300454 CTATCTTTAAAAATCTTTTTGGG - Intergenic
1099177054 12:79434313-79434335 GCAGCATTAAAAATATATTTGGG - Intronic
1102458972 12:113088335-113088357 CAGGCATTACTAATCAATTTCGG - Intronic
1109345165 13:61107078-61107100 TTAACATTACAAATATATTTTGG - Intergenic
1109674457 13:65656235-65656257 CTAGCCCTGCAAATCTATTTAGG - Intergenic
1109907866 13:68869081-68869103 ATAACTTTACAAATCTTTTTAGG - Intergenic
1111484222 13:88874497-88874519 CTAGAATTACAAATCTACCAAGG - Intergenic
1111790949 13:92853787-92853809 CTAGAAATGCATATCTATTTGGG - Intronic
1113228354 13:108183336-108183358 CTAGCATAACACATGTAATTTGG - Intergenic
1113317435 13:109197131-109197153 CTAGCCATTCAGATCTATTTAGG + Intronic
1115277869 14:31627795-31627817 CTACATTAACAAATCTATTTGGG - Intronic
1117164517 14:53020173-53020195 CTTGCATTAAAAATCTCTTCTGG - Intergenic
1118288286 14:64498268-64498290 CTAGCAATTCAATTCTGTTTGGG - Intronic
1118784458 14:69034532-69034554 CTATCATCACAAATTTCTTTTGG - Intergenic
1121968525 14:98334342-98334364 CTAGCAGTTCATATCTATGTGGG + Intergenic
1124880122 15:33634349-33634371 CTAGCATTAAAAAACACTTTTGG - Intronic
1125272495 15:37954394-37954416 CTAGCATTTCAAATATATCATGG - Intronic
1126395135 15:48207480-48207502 CAAGTAATACAAATATATTTAGG - Intronic
1126742000 15:51786757-51786779 GTAGCATTTTAAATATATTTGGG - Intronic
1126888243 15:53175761-53175783 CTTGCATAAATAATCTATTTAGG + Intergenic
1127344107 15:58077389-58077411 ATAGCACTGCACATCTATTTAGG - Intronic
1128973763 15:72132868-72132890 CTTGCAATAAAAATCTAATTGGG + Intronic
1129554766 15:76495733-76495755 ATATCATTTCAAAGCTATTTTGG - Intronic
1130685926 15:86037624-86037646 CTTTCATTCCAAATCTCTTTAGG - Intergenic
1133520443 16:6550848-6550870 CCAGAATTAAATATCTATTTAGG - Intronic
1142950422 17:3473847-3473869 CCAGCATTACAAATGTTTTGTGG - Intronic
1145771438 17:27496094-27496116 CCAGCATTATGAATCTCTTTTGG + Intronic
1149278401 17:55071760-55071782 CCAGCACTTCAAATGTATTTAGG + Intronic
1149886579 17:60346023-60346045 CAAGCATTACACTTCTTTTTTGG + Intronic
1150364942 17:64573801-64573823 AAACCATTAAAAATCTATTTGGG - Intronic
1155148622 18:23104727-23104749 CTAGCCTGCCAAATCTTTTTGGG - Intergenic
1156194781 18:34762066-34762088 CTAGAATTACCACTATATTTTGG - Intronic
1158725317 18:59966563-59966585 CTAACATGAAAAATCTATATTGG - Intergenic
1159656418 18:71033622-71033644 TTAGCATTACAAAGCTAATTGGG + Intergenic
1164257875 19:23545057-23545079 CTAGAAATACAAAATTATTTGGG + Intronic
928919761 2:36514330-36514352 CTTGAATTACAAATCTGTTCTGG - Intronic
929206421 2:39299906-39299928 ATAGCAATACAGATTTATTTGGG - Intronic
931173902 2:59833725-59833747 CCAGCATTACAGATGTATTGTGG - Intergenic
933393102 2:81697407-81697429 GTACCACTACAAATCTGTTTTGG - Intergenic
933434674 2:82233375-82233397 CTAAAATTACAAAACAATTTTGG + Intergenic
936660420 2:114536954-114536976 CTAGTAATGCAAATCCATTTGGG - Intronic
936823117 2:116547917-116547939 TTAGTATTACAAATACATTTGGG + Intergenic
937494793 2:122406596-122406618 ATAGAATTAAAGATCTATTTTGG - Intergenic
937715044 2:125022726-125022748 CTAGAAACAAAAATCTATTTAGG + Intergenic
938300316 2:130206383-130206405 CTACAACTACAAATATATTTAGG - Intergenic
939580383 2:143939429-143939451 CTGGCATCACACATCTATGTGGG + Exonic
941417436 2:165239163-165239185 TTAGAATTATAATTCTATTTTGG - Intergenic
941422052 2:165294803-165294825 ATACCAGTAAAAATCTATTTAGG + Intronic
941461769 2:165780434-165780456 CTAGAAATACAGATCTATATTGG - Intronic
943055890 2:182978672-182978694 ATAGCATCACAAACCCATTTTGG + Intronic
943417961 2:187631692-187631714 CAAACATTTCAAATGTATTTTGG + Intergenic
943599470 2:189897602-189897624 CTTCTCTTACAAATCTATTTTGG + Intronic
944787855 2:203092035-203092057 CTAGAAGTAAAATTCTATTTTGG - Intronic
1169625190 20:7559205-7559227 GTAGCAATACTAAGCTATTTTGG + Intergenic
1170519665 20:17171289-17171311 CTGGCATTGCAAATCTATGGAGG - Intergenic
1173449213 20:43147616-43147638 CTAACATTTCAAGTCTATATTGG + Intronic
1182916802 22:34040893-34040915 TCAGAATTAAAAATCTATTTAGG - Intergenic
951286855 3:20823728-20823750 ATAGCAATAAAAATCTACTTTGG - Intergenic
952282945 3:31940799-31940821 CTAAAAATACAAATCTAGTTTGG - Intronic
953363615 3:42322932-42322954 CTAGCATTAAAAACAAATTTTGG + Intergenic
953541570 3:43823588-43823610 CTCCCATTAGAAACCTATTTGGG - Intergenic
953544208 3:43851153-43851175 CTTGCATTACAAAAGTATGTTGG - Intergenic
956342573 3:68242626-68242648 CTAACATCACAAATTTAGTTTGG + Intronic
957436534 3:80184409-80184431 CTAGCTCTACAATGCTATTTAGG - Intergenic
958649497 3:96920058-96920080 CTTGCATTACAAATCATGTTAGG + Intronic
963617524 3:147560610-147560632 CTATCATTCCACATATATTTAGG + Intergenic
964830079 3:160874468-160874490 CAAGCAATAGAAATCCATTTTGG - Intronic
965627062 3:170691752-170691774 CTACCATTATAAATCTGTCTAGG - Intronic
965866130 3:173206048-173206070 CTAGCATTCCAAATTTGTATTGG - Intergenic
965905035 3:173694454-173694476 CTAGGATTTCAAATATATTGAGG + Intronic
971219361 4:24691047-24691069 CTTGCAAAACAAATCTACTTCGG - Intergenic
971667015 4:29500457-29500479 AGAACATTACAAATCTATTCTGG + Intergenic
971790191 4:31160326-31160348 CTAGCATGACTAATTTATTCTGG + Intergenic
973570987 4:52239539-52239561 TAAGCATTAAAAATCTATTTAGG + Intergenic
974169493 4:58247450-58247472 CAAGCATTAAAAACTTATTTTGG + Intergenic
974535183 4:63165418-63165440 GTAGCAGTACCATTCTATTTTGG + Intergenic
975390400 4:73810249-73810271 AAAGCATAAAAAATCTATTTAGG - Intergenic
975962591 4:79931024-79931046 CTAATATTACAATTCTATTTAGG - Intronic
977647390 4:99428923-99428945 CTAGCTATAAAAATCTACTTTGG - Intronic
978678937 4:111354542-111354564 ATAGCATTACAAATGGATTAAGG + Intergenic
978684210 4:111419497-111419519 CTAGCATTAAAAATATAAATAGG - Intergenic
979843142 4:125471481-125471503 CAAGAATGACATATCTATTTAGG + Intronic
987629921 5:20457002-20457024 AAAACATTACAAATGTATTTTGG - Intronic
988100165 5:26666087-26666109 CTAGCAAAAAAAATCTCTTTGGG + Intergenic
989751760 5:44903442-44903464 CCAGAATTTAAAATCTATTTTGG - Intergenic
991137642 5:63201194-63201216 CTATCATTAGAAACTTATTTAGG - Intergenic
993065988 5:83097303-83097325 TCAGCAATACAAAACTATTTAGG - Intronic
993355909 5:86907076-86907098 CTAGAAATAAAAATCTAATTAGG + Intergenic
995236877 5:109839258-109839280 TTGGCTTTACAAAACTATTTTGG + Intronic
999040973 5:148411769-148411791 TTAGCATTTTAAAGCTATTTTGG - Intronic
999238457 5:150113961-150113983 CTAGGTTTACAAATATTTTTAGG - Exonic
1007692388 6:43711075-43711097 CTAGAATGTCAAATCTATGTGGG - Intergenic
1008810802 6:55495946-55495968 AAAGCATTACAGATCTACTTTGG + Intronic
1008855031 6:56073729-56073751 CAAGCTTAACAAATATATTTAGG - Intronic
1010404047 6:75482420-75482442 CTATCCTTGGAAATCTATTTTGG - Intronic
1012106921 6:95173939-95173961 CTAGCAATTCAATTATATTTAGG + Intergenic
1013702253 6:112786890-112786912 CTAGGATTCCATATCTGTTTTGG + Intergenic
1013726349 6:113101674-113101696 CTAGCAATAAAAATCTTTCTGGG + Intergenic
1013943938 6:115699706-115699728 ATAGGATTACAAATATCTTTTGG + Intergenic
1014108436 6:117593024-117593046 CTAGCAATGCATATCTGTTTAGG - Intronic
1014120298 6:117717237-117717259 CTAGGTTTTCAAATTTATTTGGG + Intergenic
1015845389 6:137515228-137515250 CTAGAATCACAAATATTTTTGGG - Intergenic
1018538355 6:164848619-164848641 CTTGCATTACACATTTATATTGG + Intergenic
1022247991 7:28579601-28579623 CTAGCATTTCAAAGATGTTTGGG - Intronic
1022759032 7:33327081-33327103 CTAGACTTTCAAATTTATTTGGG + Intronic
1025992936 7:66509484-66509506 CAAGCCTTAAAAATCTTTTTAGG - Intergenic
1037481512 8:19310492-19310514 CAATCATTAAAAATATATTTAGG - Intergenic
1039224825 8:35377183-35377205 CCTCCATTACAAAACTATTTGGG + Intronic
1039282860 8:36006040-36006062 GTAGGAATACAAATATATTTAGG + Intergenic
1043261473 8:78204923-78204945 CTACTATGATAAATCTATTTTGG - Intergenic
1045174137 8:99702864-99702886 CTAGCATTACAAATCTATTTCGG - Intronic
1048145671 8:131840352-131840374 CTAGCAATACAAAAGTATTTGGG + Intergenic
1050704338 9:8379952-8379974 CCAGCATTACAGAGCTATTGTGG + Intronic
1050976611 9:11946866-11946888 ATAACATTACATGTCTATTTTGG - Intergenic
1050992238 9:12169364-12169386 TAAGCTTTACAATTCTATTTGGG + Intergenic
1051944142 9:22545820-22545842 CTAGCTTTATAAATCTCTGTTGG + Intergenic
1054867845 9:70020794-70020816 TTAGCATTAAAAAATTATTTGGG - Intergenic
1057424639 9:94938381-94938403 CTAGGATTACCTATCTATCTTGG - Intronic
1058346815 9:103973679-103973701 CTAGCATCCCAAATCTAATCTGG + Intergenic
1058532761 9:105923442-105923464 CTAACATAACAAATCTCATTTGG - Intergenic
1061352368 9:130075614-130075636 CCACCACTACAAATCTCTTTAGG + Exonic
1061640399 9:131950007-131950029 CTTGCATTACAAATTTACTCAGG + Intronic
1186579377 X:10800917-10800939 CTAGTTTTACATCTCTATTTAGG - Intronic
1186739690 X:12504719-12504741 CTATCATTCCAGATCTAATTTGG + Intronic
1187825228 X:23328957-23328979 CTATCTTTAGAAATCTCTTTGGG + Intergenic
1188041399 X:25373682-25373704 CTAGCATTGGAAATCTTTTCTGG - Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1195487884 X:105430862-105430884 GTAGCATTTTAGATCTATTTGGG + Intronic
1196501286 X:116385880-116385902 TTAGAATTTAAAATCTATTTAGG - Intergenic