ID: 1045179575

View in Genome Browser
Species Human (GRCh38)
Location 8:99765622-99765644
Sequence GATGCAGAAGTGCCCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045179566_1045179575 3 Left 1045179566 8:99765596-99765618 CCCTTGTTCCCAAGTCCCACAAG 0: 1
1: 0
2: 7
3: 26
4: 299
Right 1045179575 8:99765622-99765644 GATGCAGAAGTGCCCCCAGGGGG No data
1045179568_1045179575 -5 Left 1045179568 8:99765604-99765626 CCCAAGTCCCACAAGCGTGATGC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1045179575 8:99765622-99765644 GATGCAGAAGTGCCCCCAGGGGG No data
1045179567_1045179575 2 Left 1045179567 8:99765597-99765619 CCTTGTTCCCAAGTCCCACAAGC 0: 1
1: 0
2: 1
3: 28
4: 191
Right 1045179575 8:99765622-99765644 GATGCAGAAGTGCCCCCAGGGGG No data
1045179565_1045179575 4 Left 1045179565 8:99765595-99765617 CCCCTTGTTCCCAAGTCCCACAA 0: 1
1: 0
2: 4
3: 26
4: 219
Right 1045179575 8:99765622-99765644 GATGCAGAAGTGCCCCCAGGGGG No data
1045179569_1045179575 -6 Left 1045179569 8:99765605-99765627 CCAAGTCCCACAAGCGTGATGCA 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1045179575 8:99765622-99765644 GATGCAGAAGTGCCCCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045179575 Original CRISPR GATGCAGAAGTGCCCCCAGG GGG Intronic
No off target data available for this crispr