ID: 1045180202

View in Genome Browser
Species Human (GRCh38)
Location 8:99772688-99772710
Sequence CAGTATACACATATAAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 338}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045180202_1045180205 7 Left 1045180202 8:99772688-99772710 CCCTGTTTTATATGTGTATACTG 0: 1
1: 0
2: 3
3: 26
4: 338
Right 1045180205 8:99772718-99772740 ATAAAAGTGTGCTTGTTATTTGG No data
1045180202_1045180208 28 Left 1045180202 8:99772688-99772710 CCCTGTTTTATATGTGTATACTG 0: 1
1: 0
2: 3
3: 26
4: 338
Right 1045180208 8:99772739-99772761 GGAGTTAGGGTTAAGACATTTGG No data
1045180202_1045180207 15 Left 1045180202 8:99772688-99772710 CCCTGTTTTATATGTGTATACTG 0: 1
1: 0
2: 3
3: 26
4: 338
Right 1045180207 8:99772726-99772748 GTGCTTGTTATTTGGAGTTAGGG No data
1045180202_1045180206 14 Left 1045180202 8:99772688-99772710 CCCTGTTTTATATGTGTATACTG 0: 1
1: 0
2: 3
3: 26
4: 338
Right 1045180206 8:99772725-99772747 TGTGCTTGTTATTTGGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045180202 Original CRISPR CAGTATACACATATAAAACA GGG (reversed) Intronic
902208733 1:14889400-14889422 CACTATAGCCATATAAAGCATGG + Intronic
902943813 1:19819410-19819432 CAGTAAGCACAAATAGAACATGG - Intergenic
905318938 1:37101878-37101900 CAGTTTACACATCTACAAAATGG + Intergenic
907252668 1:53152137-53152159 TAATATACATATATAAAATATGG - Intergenic
908096821 1:60747909-60747931 ATGTATACACATACATAACATGG - Intergenic
908947256 1:69513701-69513723 CATTATAAACAAATAAAACTTGG + Intergenic
908994560 1:70135763-70135785 CAGTATAGACAAATATTACAGGG - Intronic
910054707 1:83018889-83018911 ATGTATACACATATATAGCAGGG - Intergenic
910078960 1:83316003-83316025 CAGGATTCACATAGAAAATATGG + Intergenic
910268229 1:85364093-85364115 CAGTTTACTCATATATAAAATGG - Intronic
910592639 1:88943632-88943654 CAGTACTCACATATACATCAGGG + Intronic
910859093 1:91725930-91725952 CAGAATTCACATCTGAAACAGGG + Intronic
911742482 1:101401813-101401835 CTGTATACCATTATAAAACAAGG + Intergenic
912244070 1:107942540-107942562 CAGGATACACAGATATAAAAAGG - Intronic
912694056 1:111827655-111827677 CAGTTTCCTCATATATAACATGG - Intronic
912720284 1:112014373-112014395 CAGTGTATACCTATAAAGCAAGG - Intergenic
912775269 1:112502692-112502714 GAGTACACACACATAACACAGGG + Intronic
915683952 1:157611886-157611908 ATATATACACATATAAAACATGG - Intergenic
915897255 1:159821776-159821798 GTGTATTCACATACAAAACAAGG - Intergenic
916286161 1:163108246-163108268 CATCATACACACATATAACAAGG + Intergenic
916370122 1:164082799-164082821 GAATATGTACATATAAAACAAGG - Intergenic
916533943 1:165685621-165685643 CAGTATACACATGGTAAACGAGG + Intronic
917915951 1:179702363-179702385 CATTATACTCATGTCAAACAGGG - Intergenic
918273672 1:182929018-182929040 AAGTATACTAACATAAAACAAGG + Intronic
918628764 1:186690280-186690302 AAGAATACACATGTAATACATGG + Intergenic
919097314 1:193053630-193053652 CACCATGCATATATAAAACAAGG + Intronic
919243201 1:194941388-194941410 CAATAAATACATATAAAATAAGG - Intergenic
920529205 1:206689595-206689617 GAGGATACACATGTAAAAAATGG + Intronic
921785858 1:219229052-219229074 CAGTTTACTCATATATAAAATGG - Intergenic
923257925 1:232237405-232237427 CAGAAAAAACATATAAAATATGG - Intergenic
924559379 1:245144785-245144807 CACAATACACATATACACCATGG - Intergenic
1063171443 10:3513429-3513451 CAGTTTCCACATATATAAAATGG + Intergenic
1063926553 10:10983433-10983455 GAGTAAACACATATATAACATGG + Intergenic
1064585068 10:16832061-16832083 GAGTAGACACATATAAAAACAGG + Intronic
1065687560 10:28302056-28302078 CAATATTCACATTTAAAAAAGGG - Intronic
1068562856 10:58535825-58535847 CAGGAGACACATCTAACACAAGG + Intronic
1068708319 10:60102422-60102444 CACTTTACACATTTAAACCAAGG + Intronic
1070174985 10:73962592-73962614 CAGAATACACATATACAACCTGG + Intergenic
1070232924 10:74590038-74590060 TATTATACAGATAAAAAACACGG - Intronic
1072514039 10:96159769-96159791 CAGCAGTCACATTTAAAACAGGG - Exonic
1073036426 10:100567097-100567119 CTCAATACACATATAAAATAGGG + Intergenic
1073214449 10:101828856-101828878 CAGTGCACAAATAAAAAACATGG + Intronic
1073932431 10:108591214-108591236 CACTACACACATACATAACATGG + Intergenic
1074203796 10:111263115-111263137 CAGTATGGAGATATCAAACACGG - Intergenic
1078054615 11:7997600-7997622 CAGGAGACACATCTAAAACAAGG + Exonic
1079841842 11:25412385-25412407 CAGTATATACATTTGAAAAAGGG - Intergenic
1080190283 11:29537238-29537260 AAGGTTACACAGATAAAACATGG + Intergenic
1081689033 11:45063807-45063829 CAGAAAACACACATATAACAAGG + Intergenic
1084987779 11:72892261-72892283 TAGTAGACACATAAAAAATAAGG - Intronic
1088111048 11:106261857-106261879 AAACATACACATATAAATCAAGG - Intergenic
1088344721 11:108809976-108809998 CAGTAACCACATATAAAAGAAGG - Intronic
1090453955 11:126831109-126831131 CTGTCTGCACCTATAAAACAGGG + Intronic
1091419409 12:323050-323072 CAGTATATGCATACAAAAGAAGG + Intronic
1092444597 12:8542645-8542667 GAGAATACACATATTAAATATGG - Intergenic
1093762050 12:22921636-22921658 GAGGAAACAGATATAAAACATGG - Intergenic
1094266727 12:28568189-28568211 CAGTTTACTCATAGAAAACCAGG - Intronic
1094349476 12:29507798-29507820 CAGAATACAGATCTAAAAGAGGG - Intronic
1095330514 12:40956251-40956273 CTGTATACATATATAACACAGGG + Intronic
1095642284 12:44500033-44500055 CAGAATATACATGTATAACAAGG - Intergenic
1096612559 12:52812452-52812474 GAGTATAGATATTTAAAACAAGG + Intronic
1096725749 12:53560690-53560712 CAGTCTACTCTTCTAAAACAAGG - Intronic
1096759417 12:53827805-53827827 CCATATATACATATAAAACATGG - Intergenic
1097448259 12:59703207-59703229 AAATACACACATATAAAATATGG - Intronic
1097823515 12:64151625-64151647 CAGTACACGAGTATAAAACATGG + Exonic
1098411758 12:70192955-70192977 CAGTATACATCTATAATTCATGG + Intergenic
1098708844 12:73727823-73727845 AACTATTCACACATAAAACAAGG + Intergenic
1098772139 12:74566036-74566058 TAGTACACACATATAGAAAAGGG + Intergenic
1099746731 12:86714346-86714368 CAGTAAATACATACAAAGCAGGG + Intronic
1100475284 12:94929883-94929905 CATTTAACACATATATAACATGG + Intronic
1101139938 12:101784845-101784867 CATTTTACACATAAAAACCACGG + Intronic
1101579322 12:106027582-106027604 CAGTCTCCTCACATAAAACATGG - Intergenic
1102742484 12:115220502-115220524 CATTATATACATATATAAAAAGG + Intergenic
1104312815 12:127669860-127669882 CAGTATACACACATACACAATGG - Intergenic
1106677698 13:31978595-31978617 CAGGATACACTTATACATCAAGG - Intergenic
1107162544 13:37248384-37248406 AACTATACACATATATAAAAAGG + Intergenic
1107234249 13:38149727-38149749 CACTATAAACATCAAAAACATGG + Intergenic
1108447505 13:50524626-50524648 CAGTATACCCATCTATAACATGG - Intronic
1108450042 13:50552332-50552354 AAATATAGACATTTAAAACAGGG + Intronic
1108983802 13:56557078-56557100 CAGTAAAGCCATGTAAAACATGG + Intergenic
1109005315 13:56868224-56868246 AAGAATAAATATATAAAACAAGG + Intergenic
1109428227 13:62197013-62197035 CAGTATATAAATGCAAAACAGGG - Intergenic
1110487428 13:76062980-76063002 CAGTCTAAAAATAAAAAACAGGG + Intergenic
1111191650 13:84815951-84815973 AAGTATACATATTTTAAACACGG - Intergenic
1111466563 13:88620187-88620209 CAGAACATACATACAAAACAAGG + Intergenic
1112493874 13:99890292-99890314 CAGTTTCCTCATCTAAAACAGGG + Intronic
1113946307 13:114045834-114045856 CACTAAACACATAAAACACAGGG + Intronic
1114396583 14:22368632-22368654 ATGTATACACATATATACCATGG + Intergenic
1116378689 14:44236349-44236371 GAATATACACATATAATAAAAGG + Intergenic
1116485713 14:45445705-45445727 AAGTATACACAAAGAAGACAGGG + Intergenic
1116561235 14:46381938-46381960 GAGTTTACACATATAACCCAGGG + Intergenic
1116929969 14:50680852-50680874 CAACATACACAAATCAAACATGG - Intergenic
1119280642 14:73404524-73404546 TAGAATACACATATAAAGCATGG + Intronic
1119630970 14:76231898-76231920 AAATATATATATATAAAACAGGG + Intronic
1120162406 14:81160246-81160268 CAGTATACACTTAAAACACATGG + Intergenic
1120680475 14:87475150-87475172 AAATATTCACATATAAAACTTGG - Intergenic
1121597386 14:95175425-95175447 AATTATACATAGATAAAACAAGG + Intergenic
1121901855 14:97700059-97700081 CAGAAGACACACAGAAAACACGG - Intergenic
1124417874 15:29489127-29489149 CAGTAAAGAAAAATAAAACATGG + Intronic
1124550132 15:30673201-30673223 CAATATACACATAAAATATAGGG - Intronic
1125302264 15:38268779-38268801 CAGTAAAAACTTAGAAAACAAGG - Intronic
1125552597 15:40557700-40557722 TAGTATACACATGTCAAACCAGG - Intronic
1127375405 15:58380167-58380189 CAGTATACATATATAAAATAAGG + Intronic
1128345681 15:66851083-66851105 GAATATACATATATAAAATATGG + Intergenic
1130287949 15:82571218-82571240 CACCATACACACATACAACATGG - Intronic
1130870091 15:87963932-87963954 CAGTTTGCTCTTATAAAACACGG - Intronic
1135944280 16:26852197-26852219 CAGTACACACAAAAAAGACATGG + Intergenic
1137562266 16:49510528-49510550 CAGTTTACCCATTTACAACAAGG - Intronic
1138716029 16:59023261-59023283 AAATATACATATATAAAAGAAGG + Intergenic
1139133102 16:64169720-64169742 CATAATACACATAAAGAACATGG - Intergenic
1139197424 16:64936423-64936445 CAGGATAGGCATATAAATCAAGG + Intergenic
1140314688 16:73884253-73884275 TAATATACAAAAATAAAACAAGG - Intergenic
1142442355 16:90107061-90107083 CAGTATTTACACTTAAAACACGG - Intergenic
1143086387 17:4419169-4419191 TAATATACACAGATAAGACAGGG + Intergenic
1143387564 17:6540962-6540984 CAGTATACATTTAAAAACCAAGG - Intronic
1143413504 17:6727441-6727463 GTGTATATATATATAAAACATGG - Intergenic
1144231321 17:13207088-13207110 TGGTATACACATATACACCATGG - Intergenic
1145118493 17:20234028-20234050 CAGAATATACATAAGAAACATGG - Intronic
1146406760 17:32545259-32545281 CAGTTTCCTCATATAAAAAATGG + Intronic
1147728464 17:42581696-42581718 CAGCATACAAATATAATTCAGGG + Exonic
1148976248 17:51532124-51532146 CAGTATACAGATATAATAAGAGG + Intergenic
1150340435 17:64362330-64362352 CAGGATACAGATTTAAAAAATGG + Intronic
1153040181 18:805351-805373 CAGTATAAAAAAATAAAAAATGG + Intronic
1153278226 18:3390058-3390080 TAGTATACACAACCAAAACAAGG - Intergenic
1153535078 18:6093560-6093582 CAGTATACAGTGATAAATCAGGG + Intronic
1153828300 18:8897399-8897421 CAGGAGACACATCTAAGACACGG - Intergenic
1154445900 18:14435279-14435301 CTGTATTCTCATATAAAATACGG + Intergenic
1154476058 18:14759160-14759182 CAGTCTTCACATATAAAAGTAGG + Intronic
1155648546 18:28111746-28111768 CAGTATACTAATATGCAACAGGG + Intronic
1157401165 18:47389734-47389756 CAATTTACAAACATAAAACAAGG - Intergenic
1157645945 18:49271215-49271237 TAGTACACAAATAAAAAACAGGG + Intronic
1157989535 18:52478109-52478131 CAGGATATACATATAGACCAGGG - Intronic
1158672245 18:59486839-59486861 AACTATACCCAAATAAAACAAGG + Intronic
1159018574 18:63123510-63123532 CACTGTACACATAAAAAATACGG - Exonic
1159165139 18:64689478-64689500 CAGTATGCACAGATAAAAGTTGG - Intergenic
1159254154 18:65924034-65924056 CAGGATACACATATGAACAATGG + Intergenic
1161805266 19:6439909-6439931 CAGTTTACACATCTATAAAATGG - Intronic
1162499483 19:11043674-11043696 CAGAATACTTATTTAAAACATGG + Intronic
1162837489 19:13330460-13330482 CAGTTTACACATCTGAAAAATGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168563340 19:57402211-57402233 GAGAATCCACATATAAACCATGG - Intronic
1168656971 19:58137075-58137097 CAGTTTAAACATGTAAAAAATGG + Intronic
925040506 2:729893-729915 AAGTATACACTTGTAAAATAGGG - Intergenic
925567123 2:5268528-5268550 CAGTATACAAATATGTAGCATGG - Intergenic
925742011 2:7014002-7014024 CAGTTTTCACATATGAAAAATGG + Intronic
926265134 2:11309410-11309432 CAGTATACACAAAATAAAGATGG + Intronic
926486503 2:13466879-13466901 TACTATACATATATATAACATGG + Intergenic
926766698 2:16328555-16328577 CAGTATCCACATCTAAACTATGG + Intergenic
927035613 2:19172444-19172466 CAGTATTTAAATAGAAAACAAGG + Intergenic
929611327 2:43272942-43272964 AAGTAGACACATATAAATGATGG + Intronic
930544699 2:52751555-52751577 ATATATATACATATAAAACATGG - Intergenic
934995457 2:98954157-98954179 CAGGATAGACATATATATCAAGG + Intergenic
935141096 2:100353806-100353828 AAGTTTCCCCATATAAAACAAGG + Intergenic
935188231 2:100753624-100753646 CAGTTTACCCATATGCAACAAGG - Intergenic
935806717 2:106756105-106756127 CAGTAGACAAATATGAAAAATGG + Intergenic
936559152 2:113521384-113521406 CATTATAAACACATAATACATGG + Intergenic
937016019 2:118606497-118606519 CAGAAAACACATACAAACCATGG - Intergenic
938189423 2:129262259-129262281 CACTAAACACATATAAAAATAGG - Intergenic
938655733 2:133431285-133431307 CAGTTTAAATATATAAAACATGG - Intronic
938742670 2:134247743-134247765 CAGTTTCCACATGTATAACATGG - Intronic
939056126 2:137366449-137366471 CTGAATACACATGTAAAGCAAGG - Intronic
940272520 2:151907091-151907113 CAGTAAACATTTATAAAACTAGG - Intronic
940982564 2:160019944-160019966 AAGTACACACAGAAAAAACATGG - Intronic
941207815 2:162595999-162596021 CAGTATACAGATATTTAACCTGG - Intronic
942929532 2:181473049-181473071 CAGCATACACATAGAATAAATGG - Intronic
943118214 2:183701311-183701333 CATTATACACATATTAAGGAAGG + Intergenic
943745838 2:191462120-191462142 CAGCAAACACACATAAAATAAGG - Intergenic
943845565 2:192641857-192641879 GAATATACAGCTATAAAACAAGG + Intergenic
943957681 2:194213729-194213751 CAGTATAGTCAGATAAAATAGGG + Intergenic
944296038 2:198063742-198063764 CAGTATACAAATTTAAATAATGG - Intronic
944320516 2:198335969-198335991 CAATATAAACTTATAAAACAGGG + Intronic
944326354 2:198409290-198409312 GTGTATACATATACAAAACAAGG + Intronic
944434915 2:199677675-199677697 AAGAATACATATATAAAGCAAGG + Intergenic
945741287 2:213665669-213665691 AAATAAACACACATAAAACAAGG - Intronic
946582917 2:221150142-221150164 CAGCATCAACATATAAAATAGGG + Intergenic
1169924550 20:10769115-10769137 GAGTCTACATTTATAAAACAGGG + Intergenic
1170446331 20:16431722-16431744 CCCTAGACACATATATAACATGG + Intronic
1173400297 20:42720299-42720321 CAGTATTCACATATGTAAAATGG - Intronic
1174423745 20:50417478-50417500 CAGTTTCCACATTTATAACATGG - Intergenic
1174423753 20:50417548-50417570 CAGTTTCCACATCTATAACATGG - Intergenic
1175048616 20:56131508-56131530 CAGTATATATATATACACCATGG + Intergenic
1176652105 21:9558856-9558878 CATTAGACACATATTACACATGG + Intergenic
1176875926 21:14128067-14128089 CATTATTTACATAAAAAACAAGG - Intronic
1177133135 21:17281123-17281145 CAGAAAACACATTTAAAAAATGG + Intergenic
1177171254 21:17658644-17658666 CAGTTTACAGTTAGAAAACAAGG - Intergenic
1177513670 21:22121394-22121416 CAGCATGCACCCATAAAACAGGG - Intergenic
1177595673 21:23239113-23239135 TTGTATACACATTTAAAACAGGG + Intergenic
1178009990 21:28273632-28273654 CTGTAAACACATGCAAAACAAGG - Intergenic
1178206793 21:30477274-30477296 CTTTATAAACATATAAAAAATGG - Intergenic
1178746644 21:35257712-35257734 AACAATACACATATAAATCACGG - Intronic
1184486133 22:44780756-44780778 AAGTCTACAAAGATAAAACATGG - Intronic
951490051 3:23260239-23260261 CATTATAAACATATAATAAATGG - Intronic
951499944 3:23373817-23373839 CACTATACACATAACAAAAATGG + Intronic
951830945 3:26926482-26926504 CAGCATACACAACTAAATCAAGG - Intergenic
954499270 3:50995510-50995532 GAGAATGCACATATAAAATATGG + Intronic
955275408 3:57542431-57542453 CAGTATACTCATCTAAACAATGG + Intronic
956587817 3:70882907-70882929 CAGTTTCCACATGTAAAATAGGG + Intergenic
957157649 3:76566086-76566108 CAGTCTACACATATAAGATAAGG - Intronic
958039712 3:88212021-88212043 CAGTATAAAGTTGTAAAACAAGG + Intergenic
958161943 3:89828729-89828751 TATTATATCCATATAAAACAGGG + Intergenic
958163783 3:89852744-89852766 AAGTATAAACATATAACACCTGG + Intergenic
958209168 3:90446706-90446728 AAGTATCTTCATATAAAACAAGG - Intergenic
958515912 3:95115529-95115551 CTGTATACACATCTAAAACACGG + Intergenic
958538882 3:95442550-95442572 CAGTAAAAACCTATCAAACATGG - Intergenic
959417039 3:106087958-106087980 TAGATTACACATATAAGACAAGG + Intergenic
959850462 3:111080948-111080970 GAGTTTAGACAGATAAAACAGGG + Intronic
960649649 3:119932798-119932820 CAGTATTCAAACAGAAAACATGG + Intronic
961587001 3:127938835-127938857 CTGAATACAACTATAAAACATGG + Intronic
962855304 3:139339784-139339806 CAGTTTATGCATATAAAAGATGG + Intronic
963376005 3:144465885-144465907 CATTATACAGAAATAAAACAAGG + Intergenic
964165083 3:153694596-153694618 CAGTATTCACAAATAATACATGG + Intergenic
965169279 3:165240410-165240432 CATTAGGCACTTATAAAACAAGG + Intergenic
966326098 3:178756432-178756454 CATAAAACACACATAAAACAAGG - Intronic
966464942 3:180220655-180220677 CAATATCCACATACAAAAAAAGG - Intergenic
966555547 3:181255937-181255959 AAATATACACATATAAAATAGGG - Intergenic
968337710 3:197927740-197927762 CATTTTACACATATACACCATGG + Intronic
968352489 3:198071422-198071444 GAGTATCCATGTATAAAACAGGG - Intergenic
970455819 4:16223458-16223480 CAGTAACCACATATGCAACAAGG + Intronic
970781792 4:19746336-19746358 CAGTACACAAATATGAGACAGGG - Intergenic
970879753 4:20914762-20914784 CAGTATAGAAATAAACAACATGG + Intronic
970950911 4:21754285-21754307 CTGTATAGACAAATAAAGCAAGG - Intronic
971766355 4:30836969-30836991 CTTGAGACACATATAAAACATGG + Intronic
971927501 4:33032109-33032131 CAGTATACACAGACATAACATGG + Intergenic
974313625 4:60247350-60247372 CAGAATATACATATAGACCAGGG + Intergenic
974534715 4:63159711-63159733 CAGTACACATACATAAAAAATGG - Intergenic
974560673 4:63512682-63512704 CAGTATACTAATATATAAAAAGG + Intergenic
974967537 4:68780354-68780376 CAAAATACACCTATAGAACAAGG - Intergenic
975198260 4:71552199-71552221 CAGTATTCTCATTTAAAAGAGGG - Intronic
975261788 4:72311300-72311322 CCGTATAAACAAATAAAATAAGG + Intronic
976348048 4:84027904-84027926 GTTTATACACCTATAAAACATGG - Intergenic
976638809 4:87315452-87315474 AAGTATAAAAATATATAACATGG + Intronic
977077169 4:92469513-92469535 AAATATACAAATAGAAAACATGG - Intronic
977109011 4:92926969-92926991 TAGGAGACACATTTAAAACATGG + Intronic
977279173 4:95017718-95017740 CAGTATACACATTGAAAAATGGG - Intronic
978825074 4:113012784-113012806 CAATAAACACATATAAAAGTAGG - Intronic
978990618 4:115077641-115077663 CATTATATACATATAAAATTAGG + Intronic
979027941 4:115600706-115600728 CAATACATACCTATAAAACATGG - Intergenic
979399796 4:120234739-120234761 CAGCAGACAAATACAAAACATGG - Intergenic
980865310 4:138547291-138547313 CAAAACAGACATATAAAACAAGG + Intergenic
981082597 4:140649923-140649945 CTGTATTCAAATATAAAATATGG - Intronic
981328627 4:143482479-143482501 AAGAATACACATATAATACATGG + Intergenic
981617896 4:146661763-146661785 CAGTATAGACATATATAGCAAGG + Intergenic
981843228 4:149136455-149136477 CTGTATAAACATAAAAAAGAAGG - Intergenic
982529312 4:156518991-156519013 CAGTAGCAACACATAAAACAGGG - Intergenic
982853081 4:160343177-160343199 CACTGTACACATGTAAAATAGGG - Intergenic
983031307 4:162805264-162805286 CACCACACACACATAAAACAAGG + Intergenic
983614524 4:169687157-169687179 CAGAAGACATATATAAAAGATGG + Intronic
984967314 4:185150909-185150931 AAGTATAAACACATAAAACAAGG + Intergenic
985141743 4:186847022-186847044 ATGTATACACATATACAAAATGG - Intergenic
987213959 5:15713560-15713582 CAATATAAACCTATAAGACAGGG - Intronic
987860781 5:23485368-23485390 CATTATACACATAGAAGACGAGG + Intergenic
989593326 5:43132047-43132069 TACTATATACATATAAAGCAAGG - Intronic
990033521 5:51291484-51291506 CTATATGCACATTTAAAACAAGG + Intergenic
990488563 5:56282347-56282369 AAAGACACACATATAAAACAAGG + Intergenic
992165095 5:74041621-74041643 CAGTGTACCAATATTAAACAAGG + Intergenic
992554566 5:77890766-77890788 CACTACACAAATATAGAACAAGG + Intergenic
993468346 5:88275579-88275601 CATTATAAATATATAAAACTTGG + Intergenic
995212645 5:109558103-109558125 AAATATACACATTTAAAAAAAGG + Intergenic
996676558 5:126181877-126181899 CAGTTTAGATATATAAAATAAGG - Intergenic
996692887 5:126359787-126359809 CAGAATGCACATATGAGACACGG + Intergenic
998686908 5:144537673-144537695 CAGTATACACGACTAATACAAGG - Intergenic
999881482 5:155869494-155869516 CAGTATCCACATCTATAAAATGG - Intergenic
1000137160 5:158364001-158364023 TCGTATACACATATATAGCATGG + Intergenic
1000644793 5:163748239-163748261 CAGTATATACAGCTAAAAAAAGG + Intergenic
1001548031 5:172582707-172582729 CAGTGTCCACATATAGAACCAGG + Intergenic
1001723201 5:173873566-173873588 GAATATACACATTTAAAATACGG - Intergenic
1002872755 6:1182033-1182055 CAGTATTCTCATCTAAAAGATGG - Intergenic
1004077607 6:12358992-12359014 CAGTATATTCACATAAAAAAAGG + Intergenic
1004625793 6:17376018-17376040 CAGTCTACAGATAAAAAACTTGG + Intergenic
1005906707 6:30267509-30267531 AAGTATAGAAATATAAAAAAGGG + Intergenic
1006986969 6:38182310-38182332 GTGTACACACATAAAAAACAGGG - Intronic
1007499240 6:42282897-42282919 AAGCAGACACATATAAAACAAGG - Intronic
1008272806 6:49509332-49509354 AACAAAACACATATAAAACAAGG - Intronic
1008776781 6:55049775-55049797 CTGTATACACTTTTAAAAGAAGG + Intergenic
1009711651 6:67329965-67329987 CAGTATACAGAACTCAAACAGGG - Intergenic
1009889975 6:69668900-69668922 CAGTACAAACATGTGAAACATGG - Intergenic
1010011978 6:71058492-71058514 CAGAATACACATAAAAATCATGG + Intergenic
1010086875 6:71930510-71930532 CAGTTTTCATCTATAAAACAAGG - Intronic
1010182955 6:73108994-73109016 GTATATACACACATAAAACATGG - Intronic
1011080044 6:83479862-83479884 CTGTATAGACATATAAAATAAGG - Intergenic
1011150158 6:84263410-84263432 CAGTATTCTCATATATAAAAGGG - Intergenic
1013345444 6:109255806-109255828 GAGCCTACACATATAAAACTTGG + Intergenic
1013560449 6:111298376-111298398 CAATCTACACATATAAAAGGGGG + Intergenic
1013661844 6:112306017-112306039 GAGAATACACATATAAATGAGGG + Intergenic
1014182644 6:118402176-118402198 CAGACTACAGCTATAAAACATGG + Intergenic
1014474587 6:121856727-121856749 TAGTATCCACATTTAAAAAAAGG + Intergenic
1016453853 6:144211029-144211051 GAGTATACACATATCCTACATGG - Intergenic
1017142689 6:151206068-151206090 CCTTGCACACATATAAAACACGG + Intergenic
1017245451 6:152219384-152219406 CATTATACACATATAACCTATGG + Intronic
1018158600 6:161014562-161014584 CAGCATCCTCATATAAAAAAAGG - Intronic
1018500103 6:164399041-164399063 CAATATAAACTTTTAAAACAAGG - Intergenic
1018550765 6:164996101-164996123 CAGTAAACACACATAAAGTAAGG - Intergenic
1019253054 7:30682-30704 CAGTATTTACACTTAAAACACGG + Intergenic
1020127550 7:5541462-5541484 CAGTTTACCCATCTGAAACATGG - Intronic
1020284322 7:6668539-6668561 CAGTATAAACATACAAAATTTGG - Intergenic
1020903050 7:14029550-14029572 CAGTAATAACACATAAAACATGG - Intergenic
1023525613 7:41099516-41099538 CAGAATTCACAGATACAACAGGG + Intergenic
1024159520 7:46660009-46660031 ATGTATACACATATGATACAGGG - Intergenic
1024958773 7:54953553-54953575 CAGTATAAAGATATAAGAAAAGG - Intergenic
1025247380 7:57327606-57327628 CAGTTTCCACATCTATAACATGG + Intergenic
1026395296 7:69946625-69946647 CAATACACACATATAACAGAGGG - Intronic
1026402848 7:70033293-70033315 CACTATACACATACATTACAAGG - Intronic
1026404133 7:70047425-70047447 CAGTAAAAACATAAAAAATAGGG - Intronic
1026432749 7:70363976-70363998 CTGTGTACACAAATAACACAAGG - Intronic
1027296734 7:76781278-76781300 CAGGATTCACATAGAAAATATGG + Intergenic
1027536031 7:79402962-79402984 CAGTTTACACATCCATAACATGG + Intronic
1027740329 7:81994759-81994781 CACTATTTACTTATAAAACAGGG - Intronic
1027869127 7:83684307-83684329 AAGAAGAAACATATAAAACAAGG + Intergenic
1030717961 7:112832919-112832941 AAGTAAATATATATAAAACAAGG - Intronic
1030766261 7:113413472-113413494 CAGAATACCCAGATTAAACATGG - Intergenic
1031067511 7:117121353-117121375 AAGGGTACACATATAAAAGATGG - Intronic
1031801239 7:126248591-126248613 CAGTATAAGAAAATAAAACATGG - Intergenic
1032489361 7:132312417-132312439 CAGTTTTCACATCTGAAACATGG - Intronic
1032684251 7:134215194-134215216 CAGTAAACACATAAAACACCTGG + Intronic
1033074807 7:138238836-138238858 CAGAAAACCCAAATAAAACAAGG + Intergenic
1033590387 7:142803738-142803760 CAGTTTCCACATCTATAACATGG - Intergenic
1033898269 7:146102771-146102793 CAGTGTACACATATATAATTTGG - Intergenic
1034076134 7:148232948-148232970 CAGTCTCCACATAGATAACAGGG + Intronic
1034945372 7:155258601-155258623 AATTATATACATATAAAACAAGG - Intergenic
1035823667 8:2621401-2621423 AAGTTAACACATATAAAATAAGG - Intergenic
1036011146 8:4726091-4726113 CAGAACGCACATATAACACACGG + Intronic
1038234873 8:25742992-25743014 CATTCTACATATAAAAAACATGG - Intergenic
1039990560 8:42484284-42484306 CAGTATAAACACACTAAACAAGG + Intronic
1040135950 8:43853959-43853981 AAATATACCCAGATAAAACATGG + Intergenic
1040761126 8:50845432-50845454 CAATATACACATATTAAGTAGGG + Intergenic
1041837878 8:62237524-62237546 AAGTATATATATATAAAAAAAGG - Intergenic
1042817824 8:72897485-72897507 CAGATTACACATGCAAAACAAGG - Intronic
1043193643 8:77260503-77260525 CATTATACAGTTCTAAAACATGG + Intergenic
1043467322 8:80524439-80524461 CAGTCCACAAATATACAACATGG - Exonic
1043840420 8:85096224-85096246 CACTATATATATATAAAACCTGG + Intergenic
1044758818 8:95495222-95495244 CAGTCTACAGAAATCAAACAAGG - Intergenic
1045180202 8:99772688-99772710 CAGTATACACATATAAAACAGGG - Intronic
1045613018 8:103870223-103870245 CAGTTTACACATCTGAAAAATGG + Intronic
1045617516 8:103935383-103935405 CAGAGCACACATATATAACATGG - Intronic
1045745392 8:105413405-105413427 CAAAATATACATATAAAAAAGGG - Intronic
1047846510 8:128811876-128811898 CTGTATACATATTTAAAAAATGG - Intergenic
1048711064 8:137211198-137211220 CATGATACAAATAGAAAACAAGG + Intergenic
1049893702 9:94811-94833 CATTATAAACACATAATACATGG - Intergenic
1050090425 9:2013002-2013024 GAATATACACATATAACAAAGGG + Intergenic
1052372162 9:27677145-27677167 GAGTATACACATATTAACTAGGG - Intergenic
1052555764 9:30014544-30014566 CAATTTACAAATATAAAAGAGGG - Intergenic
1052912189 9:33893493-33893515 CACTATTCACATATACAAAAGGG - Intronic
1053394657 9:37762174-37762196 CAGTATCCATCTTTAAAACAGGG - Intronic
1054693458 9:68336516-68336538 CATTATAAACACATAATACATGG + Intronic
1054719171 9:68586423-68586445 CTGTATATACATATATAAAATGG - Intergenic
1056509125 9:87285873-87285895 CAGTTTACTCATATGAAAAATGG + Intergenic
1057153813 9:92820946-92820968 GAGTATCCATGTATAAAACAGGG + Intergenic
1057681651 9:97193034-97193056 CAGTATCCATGTATAAAACAGGG - Intergenic
1057897186 9:98918554-98918576 CATTGTACACATGGAAAACAGGG - Intergenic
1058354781 9:104071593-104071615 CAGTTTACACAACTAAAAAATGG + Intergenic
1058548166 9:106083425-106083447 CAGTTTACCCATATATAATATGG + Intergenic
1058597966 9:106636162-106636184 CAGAATATACATATATACCATGG - Intergenic
1059580610 9:115544090-115544112 CAGCATAAACATACAGAACATGG + Intergenic
1059649465 9:116302226-116302248 CAGTATAGACACACAACACAAGG + Intronic
1203629833 Un_KI270750v1:62401-62423 CATTAGACACATATTACACATGG + Intergenic
1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG + Intergenic
1186640749 X:11452446-11452468 CATTGTAGAAATATAAAACATGG - Intronic
1189140257 X:38597571-38597593 AAACAAACACATATAAAACAAGG + Intronic
1190472033 X:50791845-50791867 CAGTATGTACATATAGAGCAAGG + Intronic
1193291582 X:79779311-79779333 CAGTTTACACATCTATAAAAAGG - Intergenic
1194465034 X:94223287-94223309 CATAAAAGACATATAAAACAAGG - Intergenic
1195523173 X:105853891-105853913 CAGGATACATATGCAAAACAAGG - Intronic
1195800993 X:108709921-108709943 CAGAACAGACATAAAAAACATGG - Intergenic
1195958625 X:110361699-110361721 AAGTATAAAGAAATAAAACATGG - Intronic
1196069266 X:111501483-111501505 CAGTATACAAAAAGAAAAAAGGG + Intergenic
1196070010 X:111510009-111510031 CAGTTTTCACCTATAAAAGAGGG - Intergenic
1197329720 X:125138771-125138793 CAGTCTGCACATTTAAAATAGGG + Intergenic
1198219085 X:134583551-134583573 CAGTTTCCTCATATAAAATAGGG + Intronic
1199114490 X:143975051-143975073 TATTATTCACATATGAAACAGGG + Intergenic