ID: 1045182963

View in Genome Browser
Species Human (GRCh38)
Location 8:99805975-99805997
Sequence ATCCCTTCTGCCTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045182963 Original CRISPR ATCCCTTCTGCCTGAAGCCC AGG (reversed) Intronic
900031796 1:378063-378085 CTCCCTTCTGCCTGAAGAGATGG + Intergenic
900052344 1:606254-606276 CTCCCTTCTGCCTGAAGAGATGG + Intergenic
900271336 1:1790815-1790837 ATCCCGTCATTCTGAAGCCCAGG - Intronic
900688576 1:3965462-3965484 ATCACTGATGCCTGAACCCCAGG - Intergenic
900740655 1:4328902-4328924 ATCACCTGTGCCTAAAGCCCAGG + Intergenic
901001515 1:6151184-6151206 AAGCCTTCTGGGTGAAGCCCTGG - Intronic
901030115 1:6302215-6302237 AGCCCTCCTGCCTGCTGCCCTGG - Intronic
901216640 1:7558976-7558998 GTCCCCCCTGCCTGAAGGCCAGG + Intronic
901637301 1:10676269-10676291 ATTCCCTCTCCCGGAAGCCCTGG + Intronic
901744023 1:11360760-11360782 GTCCCTTCCTGCTGAAGCCCAGG - Intergenic
902445318 1:16459569-16459591 AACACTGCTGCCTGAAGCTCAGG - Exonic
902873836 1:19329405-19329427 ACCGCATCTGCCTGCAGCCCTGG + Intergenic
904266747 1:29322713-29322735 CTCAGCTCTGCCTGAAGCCCAGG - Intronic
904900070 1:33850081-33850103 ATCCCTTCTGCCTGCTACACTGG + Intronic
905172887 1:36119488-36119510 GTCCCTCCTGCCTGACCCCCAGG + Intronic
905270153 1:36782323-36782345 ATTCCACCTGCCTGAGGCCCTGG + Intergenic
905886441 1:41494450-41494472 CTCCCTTGTGCCTGAGGCCTGGG - Intergenic
906202092 1:43966835-43966857 AGCCCTACTGTCTGAAGTCCTGG - Intronic
907667516 1:56446520-56446542 GTCTCTTCTGCCTGCAGCCTTGG + Intergenic
911262142 1:95699407-95699429 ATCCCTCCTGACTTAATCCCTGG - Intergenic
916090552 1:161305381-161305403 ATACCCTCTGCCTCAAGTCCAGG - Exonic
916556270 1:165896722-165896744 ATCCCCTGTGCCTGAAGTACTGG + Intronic
916782030 1:168044056-168044078 ACTGCTTCTTCCTGAAGCCCAGG - Intronic
917029012 1:170669283-170669305 TTGCTGTCTGCCTGAAGCCCTGG - Intronic
918169534 1:181983340-181983362 ATCCCTGCTAGCTGGAGCCCTGG - Intergenic
919057368 1:192587817-192587839 ACACCTCCTGCCTGAATCCCAGG - Intergenic
920440380 1:205976843-205976865 ATCCAGTCTGCCTGACTCCCAGG + Exonic
921005366 1:211087882-211087904 ATCCCCTGTGCCTGAGGCTCCGG + Intronic
921991334 1:221371146-221371168 ATCTCTTCTGCATGAAGTCTCGG - Intergenic
923624856 1:235605785-235605807 GTCCCTTATTCCTGAAGCCCAGG + Intronic
1064209300 10:13349221-13349243 ATCACTTCTGCATCCAGCCCAGG - Intergenic
1064937401 10:20693305-20693327 ATGCTTTCTGCATGAAGCCCAGG - Intergenic
1066673974 10:37868807-37868829 ATCCATTCTGCATGAAGCATGGG - Intergenic
1067985232 10:51136344-51136366 ATGCTTTCTGCCTGGAGCTCTGG + Intronic
1070289103 10:75103381-75103403 ACTGCTTCTGCCTGCAGCCCAGG - Intronic
1071116045 10:82221746-82221768 ATCTCTTCTGCCTGAGACTCAGG + Intronic
1071412791 10:85413276-85413298 CTGCCTTCTGACTTAAGCCCAGG - Intergenic
1071969100 10:90884660-90884682 ATCTCTACTTCCTAAAGCCCTGG + Intronic
1073285523 10:102385276-102385298 CTTCCTTCTTCCTGAAGTCCAGG + Intergenic
1073904840 10:108266220-108266242 ATCCCTTCTGCCAGGAGAGCTGG + Intergenic
1076338658 10:129727954-129727976 ATCCCTTCTGGCTGGAGCAGGGG + Intronic
1076589179 10:131571478-131571500 GTCTCTTCCGCCTGAATCCCAGG + Intergenic
1076830809 10:132993277-132993299 ATCCCTCCCTCCTGAAGCCGTGG + Intergenic
1078134141 11:8638414-8638436 TTCCACTCTGCATGAAGCCCAGG + Intronic
1078886021 11:15500681-15500703 TTCCCTTGTGCCTGCAGACCTGG - Intergenic
1079127972 11:17732268-17732290 ATTCCTTCTGCCTCCAACCCTGG + Intergenic
1079532064 11:21466201-21466223 TTGCCCTCTACCTGAAGCCCTGG + Intronic
1080379656 11:31754974-31754996 AACACTTCTTCCTGAAGCCCTGG - Intronic
1080923956 11:36737032-36737054 AAGCCTTGTGCCTTAAGCCCAGG + Intergenic
1082832035 11:57625679-57625701 ACCCCTTCTGACTAAAGCCATGG - Intergenic
1083730045 11:64647997-64648019 ATTGCTGCTGCCTGAAGCTCTGG - Intronic
1085544538 11:77305138-77305160 TTCTCTGCTGCCTGAAGCCTAGG + Intergenic
1086520207 11:87660503-87660525 ATCCCTTCTCCCACTAGCCCGGG + Intergenic
1094065661 12:26358514-26358536 ACCCATTCTGCCTGAAGAGCTGG + Intronic
1094865869 12:34529445-34529467 ATCCCTTGTGCCTGGAGCTGAGG + Intergenic
1098103394 12:67043004-67043026 GTGCCATCTGCCTGCAGCCCTGG + Intergenic
1098737747 12:74127995-74128017 ATCCCTTCACCCTGAATTCCAGG - Intergenic
1103459362 12:121091280-121091302 CTCCCCTTTGCCAGAAGCCCTGG - Intergenic
1103565024 12:121811242-121811264 CTCCCCTCTGCCTGAGGGCCAGG - Intronic
1103848119 12:123913718-123913740 ATCACTTAAGACTGAAGCCCAGG - Intronic
1104415758 12:128595672-128595694 GACCCCTCTGCCTGAGGCCCTGG - Intronic
1104927208 12:132319986-132320008 ATCCCCTCTGCCAGAACCACTGG + Intronic
1105213380 13:18270999-18271021 ATGCCCTCTGCCAGAAGCTCTGG + Intergenic
1108522228 13:51256843-51256865 ATCCCTCCTCCCCGAGGCCCTGG + Intronic
1111803922 13:93014785-93014807 TTCCCTTTTGCCTGAAGTACAGG - Intergenic
1113469128 13:110531873-110531895 TCCCCTTCTGCCTGAACCCTGGG - Intronic
1114501739 14:23174749-23174771 ATCCCTTCTCCCTGGAGATCTGG - Intronic
1114602387 14:23967194-23967216 TTCCCTTCTTCCTGCAGCTCTGG + Exonic
1114612056 14:24049268-24049290 TTCCCTTCTTCCTGCAGCTCTGG + Intergenic
1118172659 14:63403610-63403632 AGACCTTCTTCCTGGAGCCCTGG - Intronic
1118325475 14:64777633-64777655 ATCCCTACTGCATCAAGCTCTGG - Intronic
1119398929 14:74348977-74348999 ATCCCTCGTCCCTGGAGCCCCGG + Intronic
1122146088 14:99689611-99689633 ATCCATTCTTCCAGCAGCCCAGG + Intronic
1123025155 14:105420565-105420587 ATCCCTGCTGGGGGAAGCCCCGG - Intronic
1124622171 15:31280025-31280047 ATCCCATCTGCCTGGGGCTCAGG + Intergenic
1126653091 15:50946590-50946612 ATCCTTTCTGCTTTAAGTCCTGG + Intronic
1129392426 15:75227019-75227041 ATCCCCTCTCCTGGAAGCCCTGG + Intergenic
1129471966 15:75761165-75761187 ATCCCCTCTCCTGGAAGCCCTGG - Intergenic
1129953932 15:79615991-79616013 ATCCATCCTGCCGCAAGCCCTGG - Intergenic
1130846621 15:87753704-87753726 TTCCCTTCTTCCAGCAGCCCAGG + Intergenic
1131780740 15:95855394-95855416 ATCACTGCTGCCTGAGGACCCGG - Intergenic
1132356393 15:101174299-101174321 ATCCCTTCCCCCTGAATCTCTGG - Intergenic
1132537296 16:488807-488829 ATGTCTTCTGACTGAAGGCCAGG - Intronic
1132868848 16:2106672-2106694 ACCCCTTCTGCCTGCAGCGGTGG - Exonic
1132899164 16:2244057-2244079 ATCCCTTCTGGGGGAAGGCCAGG - Intronic
1133833208 16:9343112-9343134 ATCCCTTCTGCCTACAACCGTGG - Intergenic
1133988059 16:10683430-10683452 AGCCCTCCTGGCTTAAGCCCTGG - Intronic
1134522738 16:14925987-14926009 ATCCCTTCTGCCTGCAGCGGTGG + Intronic
1134549891 16:15134069-15134091 ACCCCTTCTGCCTGCAGCGGTGG - Intronic
1134710408 16:16324638-16324660 ATCCCTTCTGCCTGCAGCGGTGG + Intergenic
1134718579 16:16368926-16368948 ATCCCTTCTGCCTGCAGCGGTGG + Intergenic
1134892536 16:17853802-17853824 AGCCCACCTGCCTGAAGCACTGG - Intergenic
1134949196 16:18344007-18344029 ATCCCTTCTGCCTGCAGCGGTGG - Intergenic
1134956174 16:18383233-18383255 ATCCCTTCTGCCTGCAGCGGTGG - Intergenic
1135182612 16:20288783-20288805 ATCCCTTGAGCCTTGAGCCCAGG - Intergenic
1136031573 16:27506985-27507007 GTCGCTTCTGCCTGAAGGCGAGG - Exonic
1136565289 16:31066095-31066117 CACCCTTCTGCCTGAAATCCCGG + Intronic
1138422097 16:56905470-56905492 ATCCCTTCTGTCTGATTCCCAGG - Intronic
1138537435 16:57667412-57667434 ATTCCTTTAGGCTGAAGCCCAGG + Intergenic
1141296539 16:82774965-82774987 ATCAGTTCTACCTGCAGCCCAGG + Intronic
1141596852 16:85102386-85102408 ACCCCATCTGCCTGCATCCCAGG - Intronic
1142169160 16:88611540-88611562 GACCCTGCTTCCTGAAGCCCAGG + Intronic
1142600341 17:1050761-1050783 CTCTCTCCTCCCTGAAGCCCGGG + Intronic
1143480107 17:7223252-7223274 AGCCCCTCTCCCTGGAGCCCTGG + Intronic
1143720871 17:8808116-8808138 ATCACCTCTGCCGGAAACCCAGG - Intronic
1143982573 17:10882698-10882720 AGCCCTTCTGCTTGAACCCTAGG - Intergenic
1144429610 17:15179199-15179221 TTGCCTTCTGCCTCAAACCCAGG - Intergenic
1144634624 17:16897310-16897332 ATCCCCTGTGACTGTAGCCCAGG + Intergenic
1145168706 17:20636741-20636763 ATCCCCTGTGACTGTAGCCCAGG + Intergenic
1146277758 17:31525871-31525893 GTCCTCTCTGCCAGAAGCCCAGG - Intronic
1147307193 17:39572367-39572389 ATAGATTCTGCCTGAAGTCCAGG - Intergenic
1147367018 17:39965788-39965810 ATCCCTTCTGCCTGGTGCTGAGG + Exonic
1147740400 17:42668084-42668106 TTCCCTCCTGCCTGCAGCCTGGG - Exonic
1148072141 17:44914802-44914824 ATGCCTTCTGCCAGGAGTCCAGG - Intronic
1148234725 17:45961102-45961124 ATCTCTGCTCCCTGCAGCCCAGG - Intronic
1148867552 17:50636659-50636681 AGCCCTTGTGCCTGAAGCTTGGG - Intronic
1149562811 17:57620840-57620862 ATCCCTTCTGCCTGGACCTCTGG - Intronic
1150712557 17:67544371-67544393 ATCCCTTCCCACTGAAGCCCAGG + Intronic
1151471680 17:74322297-74322319 ATCACTGCTGCCTGCAGCCTGGG - Intergenic
1151977994 17:77493093-77493115 TTCCCATCTGTCTGGAGCCCCGG - Intronic
1152643069 17:81457218-81457240 ATCCCTTCAGGCTGGAGGCCAGG + Intronic
1152650591 17:81490789-81490811 GACCCATTTGCCTGAAGCCCGGG + Intergenic
1152947861 17:83207651-83207673 CTCCCTTCTGCCTGAAGAGATGG - Intergenic
1156214028 18:34977740-34977762 ATCTCTTCTGCAGGGAGCCCCGG + Intronic
1156456582 18:37298140-37298162 ATCACTCCTTCCTGCAGCCCTGG - Intronic
1157800327 18:50615214-50615236 ATCCCTTCATCAGGAAGCCCTGG - Intronic
1160429400 18:78801152-78801174 ATCCGTTCTTCCTGCAGCCTGGG - Intergenic
1160442203 18:78901551-78901573 GGCCCTTCTGCCAGAAGCACTGG + Intergenic
1160936531 19:1598799-1598821 CTCCCTACTGCGTGGAGCCCGGG - Intronic
1162763104 19:12900160-12900182 ATCCCCTCTGCCCACAGCCCTGG - Intronic
1164053085 19:21599589-21599611 TTCCCTCCTGCCTAAACCCCTGG + Intergenic
1164304626 19:23994614-23994636 ATACCTGCTGCCCCAAGCCCAGG - Intergenic
1164377815 19:27704741-27704763 ATCCATTCTGCCTGGAGCTGAGG - Intergenic
1164775463 19:30850109-30850131 ATCCCTGCCCCCTGAAGGCCTGG - Intergenic
1165224550 19:34345335-34345357 AACCCTTGTGCCTGCAACCCTGG + Intronic
1166688803 19:44810857-44810879 ATCCCTTCTCCCTGCATCTCTGG - Intronic
1167499224 19:49836061-49836083 CTGCCTTCTGCCTAAAGCCCTGG - Intronic
1168153825 19:54462583-54462605 GTCACTTCTGCTTGTAGCCCAGG + Exonic
1168230254 19:55026910-55026932 CTCCCAGCTGCCTGTAGCCCAGG + Intronic
925345543 2:3169587-3169609 ATCCCTCCTGCCGCCAGCCCTGG - Intergenic
925724940 2:6863551-6863573 CTCCTTTATTCCTGAAGCCCGGG - Exonic
927072161 2:19542125-19542147 CTCCCTACTACCTGAAACCCAGG - Intergenic
927808719 2:26170274-26170296 ATACCTGCTGTCTGGAGCCCAGG + Intergenic
929811271 2:45190919-45190941 TCCACTTCTGCCTGCAGCCCAGG - Intergenic
929811667 2:45193904-45193926 AGCTCTCCTGTCTGAAGCCCAGG - Intergenic
931248644 2:60511245-60511267 ATCCCTTCTACCTGAGAGCCCGG + Intronic
931721815 2:65072298-65072320 ATCCCTACTGCCTGGGGCTCTGG - Exonic
932144258 2:69305050-69305072 ATTCCTTTTTCCTGCAGCCCGGG - Intergenic
932180834 2:69644222-69644244 ATCCCTTGTGCCAGGAGGCCAGG - Intronic
932335469 2:70928584-70928606 ATCCCATCTTCCTGCAGCTCTGG - Intronic
934300943 2:91775745-91775767 ATGCCCTCTGCCAGAAGCTCTGG - Intergenic
934983114 2:98863893-98863915 ATCCCTTCTCCCTCAGCCCCTGG - Intronic
940046937 2:149420020-149420042 TTCCCTTTTGCCTGAATCCCAGG + Intronic
944118759 2:196217516-196217538 CTCCCCTCTGCCAGAAGCCCTGG - Intronic
944675513 2:202032394-202032416 AGCCCTTCTGCCTCAGTCCCGGG - Intergenic
945137231 2:206641903-206641925 ATTTCTCCTGCCTGTAGCCCTGG - Intergenic
945271450 2:207944395-207944417 ATCCCTTCTGCCTGTATTCATGG - Intronic
946051852 2:216869426-216869448 ATTACTTAGGCCTGAAGCCCAGG + Intergenic
946247908 2:218397829-218397851 GCGCCTTCTGCCTGGAGCCCTGG - Intergenic
948180680 2:235977594-235977616 ATCTCTACTTCCTGAAGCCCAGG - Intronic
948823808 2:240564662-240564684 ATCCCCACTGCCTGATGTCCTGG + Intronic
948912329 2:241010876-241010898 CTGCCTGCAGCCTGAAGCCCAGG - Intronic
1174439585 20:50539745-50539767 ATCCTTTGTTCCTCAAGCCCAGG - Intronic
1176301863 21:5102371-5102393 ATACACTCTGCCTGGAGCCCAGG + Intergenic
1179237008 21:39556477-39556499 AAACCTTCAGCCTGAAGACCCGG + Exonic
1179855168 21:44159529-44159551 ATACACTCTGCCTGGAGCCCAGG - Intergenic
1180816212 22:18791399-18791421 ATGCCCTCTGCCAGAAGCTCTGG + Intergenic
1181202401 22:21225731-21225753 ATGCCCTCTGCCAGAAGCTCTGG + Intronic
1181699305 22:24610883-24610905 ATGCCCTCTGCCAGAAGCTCTGG - Intronic
1181881064 22:25980413-25980435 AGCCCTTCTGCCTGAAGATAAGG + Intronic
1182040175 22:27232252-27232274 ATCTCTTCTGCATGAAGCTGGGG - Intergenic
1183427720 22:37748368-37748390 ATCCCAACTCCCTGAAGCCCCGG - Intronic
1184721978 22:46320096-46320118 TTCCCTTCTGCCTGAATGCCTGG + Intronic
1185192736 22:49448846-49448868 ATCGCTTCTCCCTGAGCCCCTGG - Intronic
1203224512 22_KI270731v1_random:69682-69704 ATGCCCTCTGCCAGAAGCTCTGG - Intergenic
1203266315 22_KI270734v1_random:17110-17132 ATGCCCTCTGCCAGAAGCTCTGG + Intergenic
951532334 3:23709690-23709712 TTCCCTTCTGTCTGAAACCCAGG + Intergenic
952250448 3:31648294-31648316 TTCTCTTGTGCCTCAAGCCCTGG - Intergenic
954899273 3:54005313-54005335 TTCACATCTGCCTGATGCCCAGG + Intergenic
954923612 3:54213393-54213415 ACCCCTCCTGCCTTAACCCCCGG + Intronic
955160859 3:56464353-56464375 ATCCCTTCAGCCTGGGCCCCAGG + Intronic
955280844 3:57593095-57593117 ATCCCTCCTGCCTTAGGCTCTGG - Intronic
955422469 3:58752317-58752339 ATCCCTTCTGCCTGTCACCCTGG - Intronic
955968529 3:64413451-64413473 ACCCTTTCTGCCTGAAACCATGG + Intronic
958552614 3:95636602-95636624 CTCCCTCCTCCCTCAAGCCCTGG + Intergenic
960184189 3:114618340-114618362 ATCCCTTATCCCTTGAGCCCAGG - Intronic
961001390 3:123376443-123376465 GTTCTTTCTGCCTGAGGCCCAGG + Intronic
961287090 3:125814853-125814875 AATCCTTCTGGCTGCAGCCCAGG + Intergenic
961813633 3:129536183-129536205 ATACCCTGTGCCTGAAGCCCCGG - Intergenic
962786710 3:138775491-138775513 ATCCCTTCTGGTTGAGGCTCTGG - Intronic
965093454 3:164192230-164192252 ATCCCTTATTCCAGAAGCCAAGG - Intergenic
967622591 3:191651083-191651105 ACCCCTGCTGTGTGAAGCCCAGG - Intergenic
968196622 3:196712363-196712385 TTCCCAGCTGCCTGCAGCCCCGG - Intronic
968609208 4:1549491-1549513 ATCCCTCCTGCCTGGGGCTCTGG - Intergenic
969802792 4:9582705-9582727 AATCCTTCTGGCTGCAGCCCAGG + Intergenic
972564206 4:40255514-40255536 ATCGCTTCTGTCTGCAGCCCGGG + Intergenic
972663328 4:41139746-41139768 ATTTCTTCTTCCTGAACCCCTGG - Intronic
973824470 4:54691477-54691499 ATCCCTTCTGCCTGTGTCCCTGG - Intronic
974016774 4:56655718-56655740 ATCGCTTCTGCCCGCATCCCAGG - Intronic
975410233 4:74039990-74040012 ATGGCATCTGCCTGAAGCACAGG + Intergenic
981848931 4:149205123-149205145 AGCCCTTCTTCCTGAAGACAGGG - Intergenic
981897008 4:149813993-149814015 ATACTTTCTTCATGAAGCCCTGG - Intergenic
986239331 5:5943459-5943481 ATGGCTTCTCCCTGAAGGCCCGG - Intergenic
986445439 5:7816771-7816793 TTCCTTTCTGCCTAAAGCTCAGG + Intronic
986959203 5:13192478-13192500 ATCCCTTCTGGATGTAGCCTGGG + Intergenic
988672616 5:33397999-33398021 ATCACCTGTGCCTGAAGGCCAGG - Intergenic
990003675 5:50922354-50922376 ATCCCTCCTGCCTGGGGCTCTGG + Intergenic
992615635 5:78543594-78543616 ATCCCTGCAGCCAGAAGGCCAGG - Intronic
994699418 5:103114435-103114457 ATCACTTCTGTCTGAAGCTCTGG + Intronic
995254496 5:110030771-110030793 CTTCCATCTGCCTGAAGCCAAGG - Intergenic
997836022 5:137194143-137194165 CTGCCTTCTGCCAGCAGCCCAGG - Intronic
998360744 5:141584555-141584577 ATCTCTTCAGACTGAAGCACTGG + Intronic
998545691 5:143025514-143025536 TTCCCTTCTGCCTTAAGGCCCGG - Intronic
999393124 5:151208680-151208702 CTCCCTTCTTCCTCCAGCCCAGG - Intronic
999775337 5:154808391-154808413 ATCCTTTCTCCCTGAAGCAAGGG + Intronic
1000463402 5:161548156-161548178 TTCCCTTCCTCCTGAAGCTCAGG + Intronic
1001079148 5:168654202-168654224 ATCTCTTCTCCCTGAAGCTTTGG + Intergenic
1001349037 5:170938297-170938319 TTCCCTTCTGCTGGAAGCCAGGG - Intronic
1002679828 5:180952656-180952678 ATCCCTTCTGGCCTTAGCCCAGG + Intergenic
1002742024 5:181440805-181440827 CTCCCTTCTGCCTGAAGAGATGG - Intergenic
1003109556 6:3242164-3242186 TTCACTTCTGCCTGACCCCCAGG + Intronic
1003162829 6:3650806-3650828 ATCCATTCTGCCTGGGACCCTGG - Intergenic
1005264846 6:24101041-24101063 ATCCATTCTGCTGGCAGCCCTGG - Intergenic
1006143575 6:31945290-31945312 ATCTCTTCCGCATGCAGCCCTGG + Exonic
1007096725 6:39217831-39217853 ATCCTTTCTGCCTGAGGCCCTGG + Intronic
1007222110 6:40286877-40286899 CACCCCTCAGCCTGAAGCCCGGG - Intergenic
1007350531 6:41270114-41270136 ATGCCTCCAGCCTGAAGGCCTGG - Intronic
1007585987 6:42989767-42989789 TTCCCTTCTGCCTCACCCCCTGG - Intronic
1007821552 6:44564056-44564078 TTCTTTCCTGCCTGAAGCCCAGG - Intergenic
1009031502 6:58063980-58064002 AACACTTTTTCCTGAAGCCCCGG - Intergenic
1009207349 6:60818433-60818455 AACACTTTTTCCTGAAGCCCTGG - Intergenic
1009390676 6:63140004-63140026 ATCACCTCTGCCTTAACCCCTGG + Intergenic
1011346145 6:86371185-86371207 CTCCCTGCTGTATGAAGCCCAGG - Intergenic
1015544152 6:134345139-134345161 AGTTCTTCTGCTTGAAGCCCAGG - Intergenic
1017851901 6:158311432-158311454 CTTCCTACTGCCTGAAGTCCAGG - Intronic
1018627471 6:165793459-165793481 CTCCCTGCTGCCTGAGACCCGGG + Intronic
1018802020 6:167230497-167230519 TTCACTTCTGCCTGATGTCCTGG + Intergenic
1019247161 6:170716543-170716565 CTCCCTTCTGCCTGAAGAGATGG - Intergenic
1019372632 7:670873-670895 AGCCCCTCTGCCTGACGCCGTGG - Intronic
1019707428 7:2503159-2503181 ATCCCTTCTTCCTGCTGTCCCGG - Intergenic
1020099734 7:5388327-5388349 AGCTCTTCGGCCTGGAGCCCGGG - Exonic
1021570942 7:22064762-22064784 CTCTCTTCTCCCTGAAACCCTGG - Intergenic
1022114448 7:27249967-27249989 ATCTCTTCTCCCTCAATCCCTGG - Intergenic
1023070858 7:36431817-36431839 ATCCCTTCTGCCTTAAATTCTGG + Intronic
1024295042 7:47835030-47835052 TTTCCTTCTGCAGGAAGCCCCGG - Exonic
1026609216 7:71842488-71842510 AACCCTGCTGCCAGAATCCCAGG - Intronic
1026880585 7:73904607-73904629 ATCCCCACTGCCTAGAGCCCAGG - Intergenic
1028457552 7:91055046-91055068 GTCATTTCTGCCTGCAGCCCTGG + Intronic
1029474320 7:100773933-100773955 CTCCCTGCTGCCTGTAGCACTGG + Intronic
1031117579 7:117684629-117684651 AACTCTGCTGTCTGAAGCCCAGG - Intronic
1031490640 7:122383630-122383652 ATCCTTACTTCATGAAGCCCAGG + Intronic
1032405935 7:131655483-131655505 ATCCCTTCTCCCTAAAGAACAGG + Intergenic
1033051354 7:138007225-138007247 AACCGTTCTGCCTGAAGCCAAGG + Intronic
1035500976 8:91391-91413 CTCCCTTCTGCCTGAAGAGATGG + Intergenic
1036252201 8:7171949-7171971 AATCCTTCTGGCTGCAGCCCAGG - Intergenic
1036278340 8:7377320-7377342 ACCCCTTCTGCATGTAGCCAAGG + Intronic
1036343183 8:7934570-7934592 ACCCCTTCTGCATGTAGCCAAGG - Intronic
1036365290 8:8115511-8115533 AATCCTTCTGGCTGCAGCCCAGG + Intergenic
1037689240 8:21168867-21168889 ATCCTCTCTGGCTGGAGCCCAGG - Intergenic
1039111562 8:34045850-34045872 AACCCTTCTGCCTTAATCACAGG - Intergenic
1039217979 8:35294226-35294248 ATGCCTCCTGCCTTAAGTCCTGG + Intronic
1039738111 8:40354311-40354333 ATCCCTTGTTCCTGAATCACTGG - Intergenic
1039755579 8:40518670-40518692 TTTCCTTCTTCCTGAAGCCCTGG + Intergenic
1039788407 8:40854540-40854562 ATCCCTTCTGCCTGATGCATTGG - Intronic
1040976051 8:53195493-53195515 ATCCCTTCTCTCTGAAGAACTGG + Intergenic
1041196733 8:55408561-55408583 AGCCCTTCTGCCTGACGCTCTGG - Intronic
1041250125 8:55925539-55925561 AGCCCTTCTCCCTTAAGGCCTGG - Intronic
1045182963 8:99805975-99805997 ATCCCTTCTGCCTGAAGCCCAGG - Intronic
1047232430 8:123008917-123008939 ATGCCTACTGCCTGAATCCCTGG + Intergenic
1048134878 8:131738899-131738921 ATCCCTTCTGCCTCAAACTACGG + Intergenic
1049277276 8:141726141-141726163 TTCCCTGCTGTCTGATGCCCAGG - Intergenic
1051488591 9:17635758-17635780 CTCCCTTGTGCCTGAACCCCTGG - Intronic
1052569141 9:30198786-30198808 ATCCCTGCAGGCTGCAGCCCAGG + Intergenic
1053109794 9:35448544-35448566 CTACCTTCTTCCTGAAGCCTGGG + Intergenic
1053320982 9:37098684-37098706 ACCCATTCTTCCTGAGGCCCAGG + Intergenic
1057313290 9:93954653-93954675 TTCCCTTCGGCCTCCAGCCCGGG - Intronic
1057568104 9:96182727-96182749 TTCACTTCTGCATGAAGTCCTGG + Intergenic
1059043088 9:110836019-110836041 CTCCCTTCAGCCTAGAGCCCTGG - Intergenic
1059421632 9:114196063-114196085 AGCTCTTCTGCCTGAAGACCTGG - Intronic
1059423199 9:114205546-114205568 ACCCCCTCTGCTTGCAGCCCAGG - Intronic
1061048291 9:128179297-128179319 AGACCTGCTGCCTGAGGCCCTGG - Exonic
1062067177 9:134534799-134534821 ATCCCAGCTGCGTGGAGCCCCGG + Intergenic
1062273499 9:135720284-135720306 ACCCCTTCTGCTTGGAGGCCTGG - Intronic
1062598627 9:137310315-137310337 CTCACTGCAGCCTGAAGCCCCGG + Intronic
1203607936 Un_KI270748v1:72021-72043 CTCCCTTCTGCCTGAAGAGATGG - Intergenic
1186606799 X:11100702-11100724 TTCCCTTCTGTCTGAAGCAGAGG - Intergenic
1187069803 X:15877297-15877319 ATCCATTCGGCCTGAAGAGCTGG + Intergenic
1187383361 X:18825348-18825370 ATCTCGGCTGCCTGAAGCCAAGG - Intronic
1187701654 X:21969232-21969254 ACCCCTTCTTCCCCAAGCCCAGG + Intronic
1189291344 X:39888064-39888086 CCCCCATCTGCCTGAGGCCCTGG + Intergenic
1189299694 X:39943526-39943548 ATCCCTGCTCCCTGATGTCCAGG - Intergenic
1189509440 X:41647386-41647408 ATCCATTCTGCCTGGAGCTGAGG + Intronic
1190472913 X:50800679-50800701 AACCGTTCTGCCTGAAAACCTGG + Intronic
1194423655 X:93708896-93708918 ATTCCTTTTGACAGAAGCCCAGG - Intronic
1196439358 X:115704151-115704173 ACCCCTTCTCCCTGAAGGGCAGG - Intergenic
1199697636 X:150354319-150354341 CTCCCTCCTCCCTGAGGCCCAGG - Intergenic
1200161456 X:154011961-154011983 TCCCCTACTGCCAGAAGCCCTGG + Intronic