ID: 1045184422

View in Genome Browser
Species Human (GRCh38)
Location 8:99822561-99822583
Sequence GCTACTTTGTTAGGTGCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045184422_1045184425 26 Left 1045184422 8:99822561-99822583 CCTCTAGCACCTAACAAAGTAGC 0: 1
1: 0
2: 1
3: 14
4: 94
Right 1045184425 8:99822610-99822632 TGAATCAATGAATGTACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045184422 Original CRISPR GCTACTTTGTTAGGTGCTAG AGG (reversed) Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
903948967 1:26982992-26983014 GCCACTGTGCAAGGTGCTAGAGG - Intergenic
904790591 1:33017436-33017458 GCAACTTTGGGAGGGGCTAGGGG + Intronic
912384864 1:109266198-109266220 GCTCCTTTGGTAGGTGTTGGAGG + Exonic
914782248 1:150796175-150796197 GATACTGTGTTAGGTGCTGGAGG - Intergenic
915047883 1:153034042-153034064 GTTAATTGGTTAGGTGCTAGAGG - Intergenic
917567475 1:176227870-176227892 TCTACTTTGTTGGGGCCTAGTGG + Intergenic
918062344 1:181072827-181072849 GCTACTGTCATAGGTGCCAGAGG + Intergenic
920191118 1:204194506-204194528 GGTGCTGTGCTAGGTGCTAGGGG + Intronic
920952881 1:210589054-210589076 GCTACTTTTTTCGGGGTTAGAGG - Intronic
921216891 1:212945391-212945413 GTTACATTGTGAAGTGCTAGGGG + Intergenic
921595111 1:217046267-217046289 GATACTGTGCTAGGTGCTATAGG - Intronic
924353870 1:243148811-243148833 GTTAATTTGTTAGATGTTAGTGG + Intronic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1071247249 10:83778466-83778488 GCCACTTTTTTTGGTGGTAGAGG + Intergenic
1071419205 10:85473475-85473497 GCTACTTTGTAAGATACCAGTGG + Intergenic
1073252036 10:102126411-102126433 GGTACTCTGTTAGATGCTGGAGG - Intergenic
1079201264 11:18379305-18379327 GCTGCTTTGTTAAGTCCCAGAGG - Intergenic
1081554719 11:44147877-44147899 GCTACTATTTTAGGTGCTGTGGG + Intronic
1084918560 11:72450328-72450350 GCCACCATGTTGGGTGCTAGGGG + Intergenic
1085712815 11:78845225-78845247 TCTACTTTGCTGAGTGCTAGAGG - Intronic
1086393850 11:86393815-86393837 TCTACTTTGTTAGTTTCCAGAGG - Intronic
1091654691 12:2337063-2337085 GGTCCTTTGCTAGGTACTAGGGG + Intronic
1098581841 12:72109131-72109153 GGCAATTTGTCAGGTGCTAGTGG + Intronic
1099019878 12:77390326-77390348 GGTATCTTGTTAGGTGCTATTGG + Intergenic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1101067486 12:101037868-101037890 GCTACTTTGTGAGGTCCCAGAGG - Intronic
1102215053 12:111154958-111154980 GCTGCTGTGGTAGGTGCTATGGG + Intronic
1103525787 12:121567300-121567322 GCTACATTCTGAGGTGCTGGGGG - Intronic
1110587544 13:77212045-77212067 GCTACTTGGATAGGTGCAAGTGG - Exonic
1117626633 14:57646516-57646538 TCTTCTTTATTAGTTGCTAGCGG + Intronic
1117701476 14:58417712-58417734 TCTTCTTTTTTAGGTGCTTGAGG - Intronic
1120151172 14:81035722-81035744 GCTTCTTTGTTTGATGCTGGGGG + Intronic
1120815179 14:88849171-88849193 GGTACTTTGATGGGTGCTAGGGG + Intronic
1122277471 14:100602127-100602149 TTTACTTTGTTAGGTGTTGGAGG + Intergenic
1132352078 15:101146065-101146087 GCTTCTTTGTAAGGTGCAGGTGG - Intergenic
1141954819 16:87363662-87363684 GCTACATGGTTAAGTGCTACGGG + Intronic
1147773355 17:42883140-42883162 GGTACTGTGCTAGGTGCTGGCGG + Intergenic
1151584562 17:75001334-75001356 GCTGCTTGGTTAGGTACTGGGGG - Exonic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1154171301 18:12053571-12053593 GCTAATTTTTTACGTGCTGGAGG - Intergenic
1156448272 18:37252799-37252821 GCTACTGTGTTAGGTACTTGGGG - Intronic
1156479231 18:37425877-37425899 GGTTCTCTGTTAGGTGCTGGGGG + Intronic
1158986837 18:62826573-62826595 GCCACTATGCTAGATGCTAGAGG - Intronic
1159915029 18:74181146-74181168 GCCACATTGTAAGGTACTAGAGG + Intergenic
1160683749 19:424039-424061 GCTGCTTTGTCAGGTGGTGGAGG + Intronic
1165722916 19:38092532-38092554 GCTAGTTTTGTAGGTGCTGGGGG - Intronic
927723619 2:25404121-25404143 TCTACTTTGAAAGGTGTTAGGGG + Intronic
929383149 2:41377100-41377122 GCTACATGGTTAGGTGGAAGAGG - Intergenic
929390611 2:41464632-41464654 GATAATATGTTAGGTGCCAGTGG - Intergenic
930617533 2:53608916-53608938 GCTACTTTGTTACTTGCTCTGGG - Intronic
933611402 2:84439817-84439839 GCTACTTGGTTAGTTCCTTGAGG - Intronic
938970521 2:136426882-136426904 GACACTGTGTTAGGTGCCAGGGG + Intergenic
939527757 2:143318796-143318818 GATACTTTTCTAGGTGCTGGGGG - Intronic
940736384 2:157457493-157457515 GCCACTCTTCTAGGTGCTAGAGG - Intronic
942022607 2:171881742-171881764 GGTACTGTGCAAGGTGCTAGAGG - Intronic
945124192 2:206490000-206490022 GTTACATTCTTAGGTACTAGGGG - Intronic
1172586843 20:36091704-36091726 CCTCCTTTGTTAGATGCTAAAGG - Intronic
1175195658 20:57241626-57241648 GCCTCCTTGTTAGGTGCTGGGGG + Intronic
1179615122 21:42578794-42578816 TCTATTTTCTTAGGTGCTTGTGG - Intronic
1183771340 22:39928554-39928576 CCTACTGTGTTGGGTGCTATGGG + Intronic
1185162414 22:49237901-49237923 GCTCCTTGGTGAGGTGCCAGGGG - Intergenic
953382965 3:42487986-42488008 GCTACATTTTGAGGTACTAGGGG - Intergenic
953754392 3:45634006-45634028 GCTACCTTGCTGGGTGCTAGGGG + Intronic
958517289 3:95133444-95133466 GGTACTTTGATTTGTGCTAGAGG - Intergenic
965966232 3:174493786-174493808 AGTATTTTGTTAGGTGCTATGGG + Intronic
969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG + Intronic
970138375 4:12951429-12951451 GCTACATTCTGAGGTACTAGGGG + Intergenic
979039937 4:115776937-115776959 GTTACTTTCTTAGGTGCCAAGGG - Intergenic
979247935 4:118530817-118530839 GTTAATTTGTTAGATGTTAGTGG - Intergenic
980791884 4:137631592-137631614 GCTGCTTTGAGAGGTGGTAGTGG + Intergenic
982819369 4:159927183-159927205 GGTACTTTGGGAGGTGCTAGTGG + Intergenic
983301567 4:165933109-165933131 CCTACTTTGTTTGCTGCTGGTGG + Intronic
989696954 5:44212727-44212749 GCTACTTTTTCAGGTGCATGGGG - Intergenic
992388213 5:76306157-76306179 GCTACTTTGTAAGCTGATGGGGG - Intronic
992423091 5:76626598-76626620 ACTACATTGTTAGGTCCTTGAGG + Intronic
994155601 5:96500410-96500432 GCTACTTTGTTTTGTGCTGTTGG + Intergenic
1000198261 5:158981729-158981751 GCCATTTTGTTAGGAGCTTGTGG - Intronic
1000408977 5:160918160-160918182 GACACTATGTTAGGTGCTAAGGG + Intergenic
1003657383 6:8025257-8025279 TCTACTTTGCTAGGTGCCACAGG - Intronic
1003765923 6:9236515-9236537 GCTACTTTGTGAGGTGGCAGAGG + Intergenic
1005436028 6:25813204-25813226 CCTGCTTTGATAGGTGCTTGTGG - Exonic
1010339932 6:74737476-74737498 GCTACTTTTTTGGGTGGCAGGGG + Intergenic
1011361578 6:86531113-86531135 GCTACTATGATAGATGTTAGTGG + Intergenic
1012559646 6:100564672-100564694 CCTACTATGTTAGGTACAAGAGG - Intronic
1017216680 6:151916193-151916215 GCTACTTTGTTTGGTTTTAATGG + Intronic
1021800287 7:24298677-24298699 GGTACTCTGCTAGGTTCTAGGGG + Intergenic
1023014836 7:35956466-35956488 GGTACTGTGCTTGGTGCTAGGGG + Intergenic
1024066168 7:45738554-45738576 GGTACTGTGCTTGGTGCTAGGGG - Intergenic
1027612527 7:80378938-80378960 GCTTCTTTCTTAGGTGCTATTGG + Intronic
1028635816 7:92988139-92988161 GCTACTTTGTTGTCTGTTAGAGG - Intergenic
1029154809 7:98508994-98509016 GATACTTTCCTATGTGCTAGTGG + Intergenic
1034202388 7:149290523-149290545 GGCACTGTGTAAGGTGCTAGAGG - Intronic
1037681872 8:21104363-21104385 GCTACTTGGTTGGGTGTTGGGGG - Intergenic
1037952375 8:23027744-23027766 GCTTCTTTTTTAGGTGGTGGTGG - Exonic
1038914817 8:32009404-32009426 GATGCTGTTTTAGGTGCTAGGGG + Intronic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1046256821 8:111710255-111710277 GCTACTCTGTTAAGTGCTTTAGG - Intergenic
1048114438 8:131505835-131505857 TCTAGTTTGATAGGTGCTTGTGG - Intergenic
1048727211 8:137400343-137400365 GCTGCTTAGAGAGGTGCTAGGGG + Intergenic
1048954990 8:139528630-139528652 GCTACTTTGTTTGGTGGAATAGG + Intergenic
1052376576 9:27724307-27724329 GCTACTTTGTTAAGTGCTTGGGG - Intergenic
1056030629 9:82549605-82549627 GCTCCCTCGTTTGGTGCTAGTGG - Intergenic
1191204486 X:57819937-57819959 GCCACATTGATAGGAGCTAGTGG + Intergenic
1191893721 X:65971334-65971356 GCTTCCTGGTTAGGTCCTAGGGG + Intergenic
1192672169 X:73156858-73156880 GATACTTTTTTAGTTTCTAGTGG - Intergenic
1193964497 X:87968533-87968555 CCTACTACATTAGGTGCTAGAGG - Intergenic
1197259833 X:124306056-124306078 GGTACTATGCTAGGTGCTAGGGG + Intronic
1198126939 X:133654193-133654215 GCTATTGTGTTAGGTGCCATGGG + Intronic
1201418034 Y:13767600-13767622 GCCACTTTCTGAGGTACTAGGGG - Intergenic