ID: 1045184462

View in Genome Browser
Species Human (GRCh38)
Location 8:99823003-99823025
Sequence ATCAGAACACTGGTTTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 7, 3: 16, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045184462_1045184464 -7 Left 1045184462 8:99823003-99823025 CCTTTGAAAACCAGTGTTCTGAT 0: 1
1: 0
2: 7
3: 16
4: 318
Right 1045184464 8:99823019-99823041 TTCTGATACTATTAACTAGATGG No data
1045184462_1045184465 -6 Left 1045184462 8:99823003-99823025 CCTTTGAAAACCAGTGTTCTGAT 0: 1
1: 0
2: 7
3: 16
4: 318
Right 1045184465 8:99823020-99823042 TCTGATACTATTAACTAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045184462 Original CRISPR ATCAGAACACTGGTTTTCAA AGG (reversed) Intronic
900836327 1:5007205-5007227 ATTAGAACAATGGTTGTCACTGG - Intergenic
901386888 1:8916252-8916274 AGCAGATCAGTGGTTGTCAAGGG + Intergenic
901587527 1:10310351-10310373 TCCAGATCACTGGTTATCAAAGG - Intronic
903088283 1:20883798-20883820 ATCAGAAGACTAGTTTTCACTGG + Intronic
903909590 1:26712962-26712984 AGCAGAATACTTGTTTTTAATGG - Intronic
904249752 1:29214719-29214741 ATCATAACACTGGTGTGTAATGG + Intronic
905759546 1:40543318-40543340 ATCACAACACAGGTTATAAAGGG - Intronic
906198327 1:43943717-43943739 ACCTGATCATTGGTTTTCAAGGG + Intergenic
906369340 1:45239357-45239379 ATCAGAACAGTGGTTCTCTCTGG + Intronic
906453523 1:45973408-45973430 ATCAAATGACTGTTTTTCAAAGG - Intronic
906824267 1:48961908-48961930 TTGAGATCACTGGTTTTGAAAGG - Intronic
907362587 1:53931112-53931134 ATCAGAGCACTGGTTGCCTAAGG - Intronic
907573196 1:55503047-55503069 ATCAGAAAGCTGGTTAGCAATGG + Intergenic
909584382 1:77272753-77272775 ATCAGCAGACTGTTTTCCAAGGG + Intergenic
909627928 1:77739849-77739871 AGCAGAACTCTGGTTGTGAAAGG - Intronic
910493437 1:87798688-87798710 ATTAGGACACTGGCTTTCTATGG - Intergenic
910921134 1:92348427-92348449 ATCAGAAAACAAGATTTCAAAGG - Intronic
911949946 1:104160447-104160469 ATAATAACACTGATTATCAATGG + Intergenic
912042160 1:105404866-105404888 ATCAAAAGACTAGTTGTCAAAGG - Intergenic
912462098 1:109841740-109841762 ATTAGAACAATGCCTTTCAAAGG - Intergenic
913701283 1:121376711-121376733 ATCTGAACACTGTCCTTCAATGG + Intronic
914041840 1:144057178-144057200 ATCTGAACACTGTCCTTCAATGG + Intergenic
914136250 1:144903308-144903330 ATCTGAACACTGTCCTTCAATGG - Intronic
915331596 1:155116265-155116287 ATCAGGAAATTGGTTTTAAATGG - Intergenic
917040399 1:170799881-170799903 AACAGATCAATGGTTTTCAGGGG + Intergenic
917049985 1:170911050-170911072 TTCAAAACATTGTTTTTCAAAGG + Intergenic
917273325 1:173302876-173302898 ATCTTAAAACTGTTTTTCAAAGG - Intergenic
918367065 1:183819620-183819642 ATCAGAACACTTAATTTTAATGG - Intronic
918767920 1:188512682-188512704 ATCAAAATAGTGGTTTCCAAGGG - Intergenic
919090468 1:192972889-192972911 ATCAGATCAGTGGTTTTCAGGGG - Intergenic
920246184 1:204589342-204589364 ATGAGAACACAGGCTTTGAAAGG + Intergenic
920306494 1:205021388-205021410 ATCAGCACACTAGTATTAAATGG + Exonic
920488708 1:206395433-206395455 ATCTGAACACTGTCCTTCAATGG + Intronic
921586913 1:216957950-216957972 ATCAGAACATTGGTTTCCTCTGG - Intronic
921903176 1:220469319-220469341 ATCAAAACACTGGTTTTTAATGG - Intergenic
922141219 1:222889281-222889303 AGCAAAACCCTGGCTTTCAAAGG - Intronic
922599848 1:226841886-226841908 ATCAGAACAGTGGTTTCCTCTGG - Intergenic
1063032480 10:2249578-2249600 GTGAGAACACTGGTTCTCAGGGG + Intergenic
1063676517 10:8145273-8145295 TTGAGAACACTGATTTTCCATGG - Intergenic
1063737535 10:8777333-8777355 AGCAGAAAACAAGTTTTCAAGGG + Intergenic
1064726797 10:18288244-18288266 ATCAGAACATTGTAATTCAAAGG + Intronic
1065210389 10:23396924-23396946 ATCAGAAAACTGGTTGTAACAGG + Intergenic
1065875156 10:29991513-29991535 ATCACAGCACTGGTTTTCCTGGG - Intergenic
1067142191 10:43667379-43667401 ATCAGCACAGTGGTTTTCCGAGG - Intergenic
1067935290 10:50606282-50606304 AGTAGAACAGTGGTTTTCCAGGG + Intronic
1069780767 10:70954008-70954030 ATCTGCACACTGAGTTTCAAGGG - Intergenic
1069908310 10:71745201-71745223 ATGAAAACACTGGTGTGCAATGG + Intronic
1070089378 10:73269827-73269849 ATCAGAACTCTTTTCTTCAAAGG + Intronic
1072133525 10:92520329-92520351 ATATGAATACTGATTTTCAAGGG + Intronic
1073068466 10:100778576-100778598 ATCAGAAAAGTGGCTTCCAAAGG + Intronic
1073954032 10:108847127-108847149 ATCAGAACAGTGGTTTTCTATGG + Intergenic
1074655035 10:115575913-115575935 AGAATAACAGTGGTTTTCAAGGG - Intronic
1074699008 10:116076726-116076748 ATAATCACACTTGTTTTCAAGGG + Intronic
1079371616 11:19858229-19858251 AGCAGAACAGTGGTTTACCAGGG - Intronic
1079435732 11:20447227-20447249 TCTAGAACAGTGGTTTTCAATGG + Intronic
1080439820 11:32282324-32282346 TTCAGTACACTTGTTTTGAAGGG - Intergenic
1083051511 11:59780908-59780930 CTCAGAATACTTGTTTTCATTGG + Intronic
1083073993 11:60018268-60018290 ATTAGAATACTGGTTCTCAGCGG + Intergenic
1083202300 11:61127859-61127881 TTTAGAAAACTGTTTTTCAAGGG + Intergenic
1086546924 11:88008403-88008425 ATTAGAACAGTGGTTCTCAAAGG + Intergenic
1086943505 11:92822133-92822155 ATCAAAACACTAGCTGTCAAAGG + Intronic
1087321682 11:96668465-96668487 AGCAGAATAGTGGTTTTCTACGG - Intergenic
1087507593 11:99045813-99045835 ATGTTACCACTGGTTTTCAATGG - Intronic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1092312946 12:7377945-7377967 ATCAGAAGACTTGTATTGAATGG - Intronic
1093653162 12:21667230-21667252 ATCAGAACTCTGGATTTTAGGGG - Intronic
1093962508 12:25290459-25290481 ATCAGAACTCTGATTGTGAAGGG + Intergenic
1095293536 12:40503372-40503394 CTAAGAACTCTGGTTTCCAAAGG - Intronic
1101041932 12:100764183-100764205 ATCATAAAAATGGTTCTCAAAGG + Intronic
1102370370 12:112378031-112378053 AACAGAACACTGGAATCCAAAGG + Intronic
1102370574 12:112379965-112379987 CACAGAAGAATGGTTTTCAAAGG - Intronic
1102577924 12:113868650-113868672 CTCAGGACACTGGTATTCCATGG + Intronic
1103174250 12:118848237-118848259 AACTGACCACTGGTTTTCAGAGG + Intergenic
1103429410 12:120869913-120869935 ATCTGAAAACTGGATTTCACTGG + Intronic
1103687468 12:122743411-122743433 ATATGAACACAGATTTTCAAGGG + Intergenic
1104638711 12:130453655-130453677 AACAGAACAGTGGTTTCCAGGGG + Intronic
1105516584 13:21096268-21096290 AACAGATCAGTGGTTGTCAAGGG - Intergenic
1106058323 13:26260383-26260405 ATCAGACCCCTGGATTTCAGAGG - Intronic
1106986746 13:35361858-35361880 AACAGATCAGTGGTTTTCAAGGG + Intronic
1107591963 13:41917907-41917929 ATCACAACACAAGATTTCAAAGG + Intronic
1107872373 13:44759379-44759401 ATCAGAAGAATGAATTTCAAGGG + Intergenic
1113508472 13:110832628-110832650 TCCAGAACCCTGGTTTTCACGGG - Intergenic
1116035828 14:39626262-39626284 ATCAGAACAGTAGTTTTGACTGG - Intergenic
1116210519 14:41935995-41936017 TTCAAAACACTTCTTTTCAAGGG + Intergenic
1116579120 14:46615973-46615995 AGCAGAAAACTGGGTTTGAAGGG + Intergenic
1118257132 14:64215086-64215108 AGCAGGACACTGGGTATCAAAGG - Intronic
1118891304 14:69911532-69911554 AACAGACCACTGGTTGTCAGGGG - Intronic
1121907061 14:97756121-97756143 ATCAGAACATTACTTTGCAAGGG + Intronic
1122199451 14:100113663-100113685 AGCACAACACTGGACTTCAAAGG - Intronic
1124173592 15:27401328-27401350 AATAGAACCCTGGTTTTTAAAGG - Intronic
1124800113 15:32824277-32824299 AGCCCAACACTGGTTTTCAGAGG + Intronic
1125100416 15:35906097-35906119 ATCAGAAATTTGGTTTTCAGAGG + Intergenic
1125386459 15:39142196-39142218 ACAAGAACAATGGTTTTCATTGG - Intergenic
1126465050 15:48954294-48954316 GTCAGAGCAATGGTTCTCAACGG - Intronic
1126466682 15:48967045-48967067 AGCAGAACTCTGTTTTCCAAGGG - Intergenic
1127079268 15:55360435-55360457 ATCAGAACGCTGCTGTTCGAAGG + Exonic
1127106328 15:55620456-55620478 ATCAGAGCTGTGGTTTTCAGTGG - Intronic
1127903829 15:63361298-63361320 CAAAGAACACTGTTTTTCAAAGG + Intronic
1128077183 15:64834883-64834905 ATCAGAACAGAGGTTGTCTAAGG - Intergenic
1128703733 15:69822768-69822790 ACGAGAGCACTGGTTTTCAAAGG + Intergenic
1129975991 15:79822178-79822200 ATCAGAAAACTTTTTTTTAAAGG - Intergenic
1130086328 15:80780614-80780636 ATCAGAAGATTAGTTTTTAAAGG - Intronic
1131807641 15:96139295-96139317 ATCAGAAAAGTGGTTTTGAGGGG - Intergenic
1134906412 16:17983339-17983361 ATGCTAACACTGGTCTTCAAGGG + Intergenic
1136614878 16:31392566-31392588 ATCAGAAGAGTGGTTGTCTATGG - Intergenic
1137475771 16:48809234-48809256 AAAAGATCAGTGGTTTTCAAGGG + Intergenic
1137717041 16:50604334-50604356 CCCAGAACACTTGTTTTCAGAGG - Intronic
1137904039 16:52300751-52300773 ATCAGAAAACTGGATTTTAGGGG - Intergenic
1138398564 16:56727435-56727457 AACAGAATCCTGTTTTTCAAAGG - Intronic
1138399958 16:56737537-56737559 ATCAGAATACTGGTTATCCTTGG - Intronic
1139678558 16:68542015-68542037 AACAGAACACTGGTCCTAAACGG + Intronic
1139690309 16:68637419-68637441 ATTAGAACACTGAGTTCCAAGGG + Intronic
1140770512 16:78199522-78199544 ATGAGAACACTGGCTTTCCTGGG - Intronic
1141142436 16:81505433-81505455 ATTTGCACCCTGGTTTTCAAAGG + Intronic
1142728803 17:1836550-1836572 ACCAGAACACTGGTTGCCTAGGG - Intronic
1143283784 17:5774265-5774287 ATCAAAACACTGTGTTTCGAAGG - Intronic
1144086487 17:11813646-11813668 ATGAGATCATTGGTTTTCCAAGG - Intronic
1144774869 17:17780383-17780405 TTCAGAAAACTGGTTTTCTTGGG - Intronic
1146023106 17:29295484-29295506 AACAGAACAGTGGTTATCAAGGG - Intergenic
1146308892 17:31751835-31751857 AGCAGAACAGTGGTTACCAAGGG + Intergenic
1148399911 17:47348751-47348773 ATAAGAACACAATTTTTCAATGG - Intronic
1148536369 17:48442421-48442443 ATCATATCCCTGATTTTCAAGGG - Intergenic
1149275398 17:55028522-55028544 TTCAGAGCAGTGGTTCTCAAGGG + Intronic
1150780764 17:68120007-68120029 GTCAGAATGGTGGTTTTCAAGGG + Intergenic
1151157296 17:72134415-72134437 ATCAGACCAGTGGTTGTCTATGG - Intergenic
1152490335 17:80627494-80627516 ATCAGATCAATGGTTTCCAGAGG - Intronic
1154285894 18:13056249-13056271 AGGAGTACACTGGTTTTCAGAGG - Exonic
1155525168 18:26708640-26708662 GTCAGAACACTGGTTGTCTCTGG - Intergenic
1155596656 18:27495713-27495735 ATCAGCAGAATGGTTTTGAAGGG + Intergenic
1156515336 18:37674473-37674495 ATCATATCACTGGCTTTCTAGGG + Intergenic
1156791997 18:40986915-40986937 AGTAGAACACTGGTTACCAAGGG + Intergenic
1158356679 18:56629009-56629031 ATCACTACACTGTTTTTCAAAGG + Intronic
1158744309 18:60180835-60180857 ATCAGACCACTGGTTGCCGAGGG - Intergenic
1159936100 18:74368856-74368878 ATCTGAAGAAAGGTTTTCAAAGG - Intergenic
1161150882 19:2708331-2708353 AGCCAAACACTGGTTTTCAGTGG - Intergenic
1161688479 19:5716471-5716493 GTCAAAACACTGGCTCTCAAAGG - Intronic
1162610220 19:11743867-11743889 GTCAGAACACAGGATATCAATGG + Intergenic
1162689881 19:12420703-12420725 GTCAAAACACTGGACTTCAATGG + Intronic
1164544479 19:29148309-29148331 ATTAGAACACTTCTTTTCCATGG - Intergenic
1165547062 19:36548249-36548271 TTCAAAACACTGGTTCTCAGTGG - Exonic
1166104819 19:40592333-40592355 ATCACAAGACTGATTTTCATTGG + Intergenic
1166865455 19:45833663-45833685 ATCAGAACACTGGTTTTCTCTGG + Intronic
1167769765 19:51507860-51507882 ATCTGAACACTTGTACTCAAAGG - Intergenic
926852311 2:17213424-17213446 ATATGAAAAATGGTTTTCAATGG + Intergenic
927790643 2:26006703-26006725 ATTAGAACCCTGGTTTTCCTTGG - Intergenic
927858723 2:26544352-26544374 ATCAGAGCACTGGTTACTAAGGG - Intronic
927923553 2:26992895-26992917 AACAGAACACTGGATTTCTCAGG - Intronic
928621631 2:33094518-33094540 GTCTGAACACTGCTTTTCATCGG + Intronic
928878304 2:36067041-36067063 ATAAGAAACCTGGTTTGCAAGGG + Intergenic
931639709 2:64370968-64370990 ATCAGAACAGTGGTTGCCCATGG - Intergenic
932276833 2:70458053-70458075 ATAAGAACACTGACTTTCAACGG + Intronic
932543700 2:72684783-72684805 ATCAGAACAATGGTTGCCCATGG + Intronic
932646123 2:73504437-73504459 AACAGATCACTGGCTTTCAGGGG - Intronic
933968171 2:87447544-87447566 GTCAGGACTCTGCTTTTCAATGG + Intergenic
934060497 2:88288063-88288085 ATCAGAACACTTTTCTTAAAGGG + Intergenic
935320141 2:101878936-101878958 ATCAGCACTCTAGTTTTAAATGG - Intronic
936897043 2:117439451-117439473 AGTAGAACAGTGGTTATCAAGGG + Intergenic
937177941 2:119960835-119960857 ATCAGTACATTGCTTGTCAAGGG + Exonic
938852567 2:135276002-135276024 AACACAACAATGGGTTTCAATGG + Intronic
940058201 2:149535693-149535715 AGCAGAACTCTGTTTTCCAAAGG - Intergenic
940373521 2:152927772-152927794 CTCAGAACACTGGAATTCACTGG - Intergenic
940768238 2:157812930-157812952 TTCAGATCAGTGTTTTTCAAAGG + Intronic
940927035 2:159375557-159375579 ATCAGAACTATGCTTTCCAAAGG + Intronic
941359180 2:164530891-164530913 AGCAGAAAACTGATTTTAAAAGG + Intronic
942617034 2:177802663-177802685 ATCAGAACACTGGTTGTGTCTGG + Intronic
943942489 2:194017515-194017537 ATGAGAATACTTGCTTTCAATGG - Intergenic
944359408 2:198835155-198835177 ATTAGAACAGTGGTTTCCACTGG + Intergenic
944616096 2:201462390-201462412 ATCATAACACTGAATGTCAATGG - Intronic
945166947 2:206956368-206956390 ACCAAACCAGTGGTTTTCAAAGG + Intronic
945441472 2:209885089-209885111 AAAAAAACACTGGATTTCAAAGG + Intronic
946454015 2:219807047-219807069 ATTAGAACACTGGGTGTGAATGG + Intergenic
946768999 2:223068774-223068796 AGCAGATCAGTGGTTTTCTAAGG - Intronic
946996613 2:225399869-225399891 GTAAGAACATTTGTTTTCAATGG + Intergenic
947513919 2:230784628-230784650 ACCAGAAGAATGGTTTTCAGAGG + Intronic
948282360 2:236757091-236757113 ATCAGAACTGTGGTTGTCATTGG - Intergenic
1168748071 20:261812-261834 AGCAGATCACTGGTTGTCAGGGG + Intergenic
1169780417 20:9303356-9303378 AGCAGAACAGTGGTTACCAAAGG - Intronic
1169889860 20:10440669-10440691 AACAGATCACTGGTTGCCAAAGG - Intronic
1169936835 20:10892729-10892751 ATCAGAATTGTGTTTTTCAAAGG + Intergenic
1170541230 20:17390223-17390245 ATCAGAACAGTGGTTGCCTAAGG + Intronic
1170594555 20:17795172-17795194 ATTAGAACACTGCCATTCAAAGG - Intergenic
1173142402 20:40495567-40495589 ATCCAAACAATGGTTTGCAAAGG - Intergenic
1173346241 20:42202846-42202868 CACAGATCATTGGTTTTCAAAGG + Intronic
1175296308 20:57911135-57911157 ATCAGAGTCCAGGTTTTCAATGG - Intergenic
1175447598 20:59034486-59034508 ATCAAAACACTGGTTTTTAATGG + Exonic
1177056455 21:16309818-16309840 ATGAGAACCTTGCTTTTCAAAGG + Intergenic
1177634881 21:23774425-23774447 CTCAAAACTCTGGTTATCAAAGG + Intergenic
1177744411 21:25194096-25194118 TTGAGAACAGTAGTTTTCAAAGG - Intergenic
1177876155 21:26633891-26633913 ATCAGAACAATGGCTATCTATGG - Intergenic
1178605508 21:34033258-34033280 ATCAGAACACTGGTTGTCTGGGG - Intergenic
1179043886 21:37828702-37828724 AGCAGAACACTGAATTTTAAAGG - Intronic
1180977985 22:19860995-19861017 AAGAGAACACTGGTTTCTAAGGG - Intergenic
1181898112 22:26129082-26129104 ATCAGAAGCCAGGTCTTCAATGG - Intergenic
1183372780 22:37444151-37444173 ATCAAAGGAATGGTTTTCAATGG - Intergenic
952436646 3:33277972-33277994 ATCAGAATGCTGATTTTGAAAGG - Intronic
952514169 3:34087421-34087443 ATCAGAATACTGGTTATGCAGGG - Intergenic
952686828 3:36159721-36159743 ATTATAACAGTGGTTTTAAAAGG + Intergenic
953812150 3:46122110-46122132 AACAGAATAGTGGTTTTCAGGGG - Intergenic
955730094 3:61976003-61976025 ATTAGAACACGGTTCTTCAAGGG - Intronic
956142420 3:66159232-66159254 ATTAAAACACTGGTTTGCACAGG - Intronic
956650314 3:71498885-71498907 TTTAGAGCACTGGTTCTCAAAGG - Intronic
957664631 3:83210249-83210271 ATTACATCACTGGTTTTCATGGG + Intergenic
958785023 3:98588557-98588579 ATTAGAATACTGGTTTTAAGTGG - Intronic
959108401 3:102092760-102092782 ATCAGAACTATGGTTTGCCACGG - Intergenic
959492999 3:107014127-107014149 ATCATAATAGTGGTTTTCTATGG + Intergenic
959903980 3:111690559-111690581 CTCAGAACACTGGTCTTCAAGGG + Intronic
960416858 3:117395798-117395820 ATCAGAACCCTGATGTCCAATGG + Intergenic
961031884 3:123613299-123613321 ATAAGAATCCTGGTTTACAAAGG + Exonic
961460703 3:127048404-127048426 TGCAGAACACTGGTTGTCAGGGG - Intergenic
963029514 3:140954062-140954084 ATGAGATCAGTGGTTTCCAAGGG - Intronic
963309876 3:143698345-143698367 ACCAGCACTCTGTTTTTCAAAGG - Intronic
964309230 3:155374699-155374721 TTCAGAACAGTGGTTTTAATAGG - Intergenic
964820388 3:160762462-160762484 AACATAACACTGCTTTTCACAGG - Intronic
965080857 3:164029880-164029902 AATAGAACAGTTGTTTTCAATGG - Intergenic
966024982 3:175267897-175267919 ATCATTACACTGGTTTTACAAGG - Intronic
967415296 3:189210680-189210702 ATCAACACACTTGTTCTCAAAGG + Intronic
968639308 4:1703502-1703524 CTTAGAACAGTGGTTTTCAAAGG - Intronic
969244891 4:5925597-5925619 AGCATAACACTGGGTTTCTATGG + Intronic
971268912 4:25118833-25118855 TTCAGATCACAGGTTTTCAGGGG + Intergenic
971923588 4:32976377-32976399 ATTACAACATTGGTTTTTAAAGG - Intergenic
972881751 4:43432925-43432947 GTCAGAACACAGGATTTCTAGGG + Intergenic
973965195 4:56154673-56154695 GTCAGGAGACTGGCTTTCAAAGG - Intergenic
974282544 4:59816559-59816581 TATAGAACAGTGGTTTTCAACGG - Intergenic
975839284 4:78456603-78456625 AGGACAACACTGGTTTTCAAGGG + Intronic
978395815 4:108278640-108278662 ATCAAAATACTTGTTCTCAATGG + Intergenic
978594384 4:110361077-110361099 ATAAGATGACTGGTTTTAAAAGG - Intergenic
978859666 4:113433084-113433106 ATCAGAACACTAATTTTCTCCGG - Intergenic
980795243 4:137674285-137674307 ATCAGAACATGGATTGTCAAAGG - Intergenic
980844587 4:138308759-138308781 AACAGAACACTGCATTTTAAGGG - Intergenic
981507266 4:145516149-145516171 TTCAGAACAGTGGTTACCAAAGG - Intronic
982300161 4:153870086-153870108 TCTAGAACAGTGGTTTTCAAAGG - Intergenic
982341997 4:154309890-154309912 TGCAGAAGACTGTTTTTCAAAGG + Intronic
983486682 4:168340440-168340462 ATCAGAATACTTCTTTACAAAGG - Intergenic
984053103 4:174891664-174891686 ATGACAACACTGGTTTTCCTGGG + Intronic
984371094 4:178864877-178864899 ATTAGAAAAGTGGTTTTAAAGGG + Intergenic
985357145 4:189133454-189133476 AGCAGAACATTTTTTTTCAAGGG - Intergenic
986251755 5:6065991-6066013 AAAAGATCACTGGTTGTCAAGGG + Intergenic
987025783 5:13925257-13925279 ATCAGAAAACAGAATTTCAAAGG + Intronic
987356983 5:17072406-17072428 ATCAGATGAGTGGTTTTCTAGGG - Intronic
989566636 5:42907690-42907712 ACCAAAACACTGGTTTTTAATGG + Intergenic
990083893 5:51951695-51951717 AACAGAGAACTGGTATTCAAAGG + Intergenic
990171139 5:53051082-53051104 ATTAGAACACTGTTTTTAACAGG - Intronic
991099013 5:62771155-62771177 ATCAGAACACTCATTTTTACTGG - Intergenic
991148840 5:63341463-63341485 ATCAGATCAGTGGTTGCCAAGGG - Intergenic
991895011 5:71386232-71386254 AGGAGAACAGTGGTTTCCAAGGG - Intergenic
991910390 5:71554075-71554097 TTGAGAACACGGGTTTTAAAAGG - Intronic
992172615 5:74119318-74119340 ATCAGGACACTGCTTATCAAAGG - Intergenic
993626725 5:90234399-90234421 TGCAGTACACTGGTTCTCAAGGG + Intergenic
994272437 5:97796248-97796270 ATCAGAAGACTTGATTTCACAGG - Intergenic
994488661 5:100412287-100412309 CTGAGAACACTTGTTTTCATGGG + Intergenic
994573706 5:101548173-101548195 AGCAGATCAGTGGTTTTCAGGGG + Intergenic
994781835 5:104098902-104098924 ATCACAAAAGTGGTTTTCACAGG + Intergenic
995141456 5:108740081-108740103 AACAGATCACTGGTTGTCAGGGG + Intergenic
996178168 5:120386074-120386096 TTCAAAACACTGGTTGTCCAGGG + Intergenic
997006251 5:129819868-129819890 ACCAGAAAACTTGTTTCCAAAGG + Intergenic
997609420 5:135204378-135204400 GTGAAAACATTGGTTTTCAAAGG + Intronic
998916681 5:147020343-147020365 ATCAGACCACTGACTTTCACTGG + Intronic
999778588 5:154830586-154830608 ACCAGAACACTGGTCTTGACTGG + Intronic
999861680 5:155654514-155654536 AACAGATCAATGGTTTTCAGGGG + Intergenic
1000620291 5:163477327-163477349 ATTAAAACACTTGTTGTCAAAGG + Intronic
1003022052 6:2518379-2518401 ATTCCAACACTGATTTTCAATGG + Intergenic
1003123084 6:3333985-3334007 TTCAGAACACTGCTTTTCAAAGG - Intronic
1004118110 6:12790938-12790960 AACAGCACACTGATTTTAAAGGG - Intronic
1004324790 6:14664922-14664944 ATCAGGATAATGGTTTTGAAGGG - Intergenic
1007215278 6:40232536-40232558 AATGGAACACTGGCTTTCAACGG + Intergenic
1009333263 6:62452847-62452869 AAAAGATCACTGGTTGTCAAAGG - Intergenic
1010402120 6:75457920-75457942 CCTAGAACATTGGTTTTCAATGG + Intronic
1010523555 6:76872646-76872668 ATCATCATACTGCTTTTCAATGG + Intergenic
1012148560 6:95717648-95717670 ATGAGATCAATGGTTTTAAAAGG - Intergenic
1012479598 6:99651590-99651612 ATTAGAACAGTAGTTTTCCATGG + Intergenic
1012527142 6:100191525-100191547 ATCACGACACTTGTTTTCATAGG + Intergenic
1012556765 6:100522783-100522805 ATGAAGACACTGGTTTACAAAGG + Intronic
1013198355 6:107865994-107866016 TATAGAACACTGATTTTCAAAGG - Intergenic
1013760802 6:113514893-113514915 TTCAGAACACTGCTTTTACAAGG - Intergenic
1014672655 6:124325707-124325729 ATCAGAACAGTGGTCTTCTCAGG + Intronic
1015065897 6:129027002-129027024 AACAGAAAACTAGTATTCAATGG + Intronic
1015369263 6:132432887-132432909 ATCAGAAAACTTGTTTTAACTGG - Intergenic
1015399360 6:132771072-132771094 ATGAGAAAATTGGTTTTGAATGG - Exonic
1018618029 6:165706351-165706373 ATCAGGACACAGGTTTCCATGGG + Intronic
1019943127 7:4306810-4306832 ATCAGAACAGTGGTTCCCTATGG - Intergenic
1020682128 7:11250330-11250352 ACTAGTACACTGGTTTGCAAAGG - Intergenic
1021326421 7:19274747-19274769 ATCACTACACTGTTTTTCATAGG + Intergenic
1021683665 7:23159829-23159851 ACCAGAAAACTGGTTTAGAAAGG - Intronic
1025258638 7:57402156-57402178 ACAATAACACTGCTTTTCAAAGG + Intergenic
1026385253 7:69840530-69840552 ATAAGAACACTGGGCTTCACAGG + Intronic
1029192394 7:98781111-98781133 ATCAGAACACTGGATCTCCCTGG - Intergenic
1030031773 7:105376408-105376430 ATTATAGCACAGGTTTTCAATGG - Intronic
1030350577 7:108480911-108480933 AACAGATCAGTGGTTGTCAAGGG - Intronic
1030654215 7:112148464-112148486 ATCAGAACTTTGCTTTTTAAGGG - Intronic
1031891356 7:127296692-127296714 ATCAAAACACTGGTTTTGAATGG - Intergenic
1033821946 7:145145392-145145414 ATCAGAACAGTGGTTTCCTCTGG + Intergenic
1034195849 7:149246719-149246741 ATCAGATCAGTGGTTGCCAAGGG - Intronic
1034753612 7:153593512-153593534 ATCAGAGCACTGATTCTCTAGGG + Intergenic
1034791155 7:153969855-153969877 AGCAGAGCACTGATTTCCAAGGG - Intronic
1035980137 8:4361195-4361217 ATTAGACAACTGGTTTTCAGTGG + Intronic
1036196446 8:6720404-6720426 GTCAGAACAGTGCTTGTCAAGGG + Intronic
1036559627 8:9890573-9890595 ATGAGAACCCTGGTTATTAATGG + Intergenic
1037460528 8:19103860-19103882 ATCAGAAGACTATTTTTAAATGG - Intergenic
1038153356 8:24962529-24962551 ATCAGAACAGTGGTTTCCTCAGG + Intergenic
1039540990 8:38369688-38369710 ATAAGAACACTGATCTTCAGTGG + Intronic
1039727235 8:40231774-40231796 ATGAAAACAATGATTTTCAATGG - Intergenic
1041178054 8:55217807-55217829 CTCAGAAGACTGCTTTGCAATGG + Intronic
1041180557 8:55243351-55243373 AAGAGATCAGTGGTTTTCAAGGG - Intronic
1041985148 8:63912867-63912889 ATTAGAACAGTGGTTACCAAGGG - Intergenic
1043127103 8:76412823-76412845 ATCACAACACTGATTTGAAATGG - Intergenic
1043278832 8:78437519-78437541 ATCAGAACACTGTAGTGCAATGG - Intergenic
1044145112 8:88703485-88703507 ATCAGAAAACTGGGTTTTCAGGG + Intergenic
1045108729 8:98919467-98919489 ATCAGAACAATGGTTGCCTAGGG + Intronic
1045184462 8:99823003-99823025 ATCAGAACACTGGTTTTCAAAGG - Intronic
1048707953 8:137175652-137175674 TTCAGAACACAGGTTTTGATGGG - Intergenic
1048944246 8:139429509-139429531 GTCACAACACTTATTTTCAAGGG - Intergenic
1049753302 8:144296081-144296103 ACCTGACCACTGGCTTTCAATGG - Intronic
1050266292 9:3893658-3893680 TCCAGAGCAATGGTTTTCAAAGG + Intronic
1050318352 9:4425949-4425971 CTCAGAACAGTGGTTTGCAAAGG + Intergenic
1052323359 9:27192047-27192069 ACCAGAAAACTGATTTGCAATGG - Intronic
1054768308 9:69061125-69061147 ATCAGGCCACTCTTTTTCAAAGG - Intronic
1056444679 9:86654208-86654230 ATGAGATCTCTGGTTTTAAAGGG + Intergenic
1056462977 9:86826034-86826056 AGCAGAACCAAGGTTTTCAAAGG + Intergenic
1056538274 9:87550200-87550222 ATCAGAACACTGGTTTCCTTTGG - Intronic
1058266727 9:102908800-102908822 ATCAGATTAGTGGTTTTCAGGGG - Intergenic
1058329503 9:103741364-103741386 ATTAGAAAACTGGGGTTCAAAGG - Intergenic
1058658669 9:107248800-107248822 ATAATAACACTTGTTTTCCAAGG - Intergenic
1058933080 9:109741158-109741180 ATCAGAACACTGGTTACCTCTGG - Intronic
1059442856 9:114319826-114319848 ATCAGATCAGTGGTTGCCAAGGG - Intergenic
1185528322 X:796796-796818 ATCAGAACTCTGGATTCCCAGGG - Intergenic
1186025932 X:5311978-5312000 CTCAGAAAACTGGAATTCAAAGG - Intergenic
1186916258 X:14225073-14225095 ATCAGAACAGTGGTTGTCTCTGG + Intergenic
1188268492 X:28108902-28108924 AACAGCACACTGGTTTCCAGTGG - Intergenic
1188859127 X:35235882-35235904 ATCAGAACAGTGGTTCTGGAGGG - Intergenic
1189551043 X:42094142-42094164 AACAGAACAGTTGTTTTCATCGG - Intergenic
1191024158 X:55895687-55895709 AACAGAATACAGGATTTCAAGGG - Intergenic
1193137280 X:77985839-77985861 AACAGAACAGTGGTTTCCAGGGG - Intronic
1193548772 X:82862845-82862867 AACAGAACAGAGTTTTTCAATGG + Intergenic
1195278737 X:103310066-103310088 TTCAGAGCCCTGGATTTCAAAGG + Intronic
1196055904 X:111354792-111354814 ATCAGAATTCCAGTTTTCAATGG + Intronic
1198002532 X:132453776-132453798 TTCAGACCACTGGTTTGAAAGGG - Intronic
1198865900 X:141122523-141122545 AGCAGAACACTGGTCTTCTATGG + Intergenic
1199866298 X:151853034-151853056 ATAAAAACTCTGTTTTTCAAAGG - Intergenic
1201473944 Y:14361060-14361082 CTCAGAACATTTTTTTTCAAGGG - Intergenic
1201990313 Y:20016619-20016641 AGCAGAACTCTAGTTTTGAAAGG + Intergenic
1202354332 Y:24029759-24029781 TGCAGAACAGTGGTTTTCCAGGG - Intergenic
1202516447 Y:25640353-25640375 TGCAGAACAGTGGTTTTCCAGGG + Intergenic