ID: 1045188211 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:99858915-99858937 |
| Sequence | AAGCCTCCCCGGGACAGCGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1045188211_1045188219 | 20 | Left | 1045188211 | 8:99858915-99858937 | CCTCCGCTGTCCCGGGGAGGCTT | No data | ||
| Right | 1045188219 | 8:99858958-99858980 | CAAACACCTGCAACCCAAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1045188211 | Original CRISPR | AAGCCTCCCCGGGACAGCGG AGG (reversed) | Intronic | ||