ID: 1045188211

View in Genome Browser
Species Human (GRCh38)
Location 8:99858915-99858937
Sequence AAGCCTCCCCGGGACAGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045188211_1045188219 20 Left 1045188211 8:99858915-99858937 CCTCCGCTGTCCCGGGGAGGCTT 0: 1
1: 0
2: 2
3: 12
4: 113
Right 1045188219 8:99858958-99858980 CAAACACCTGCAACCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045188211 Original CRISPR AAGCCTCCCCGGGACAGCGG AGG (reversed) Intronic
900618282 1:3575329-3575351 AGTCCTCCCAGGGACAGGGGAGG + Intronic
900971105 1:5992829-5992851 AAGCTGCTCCGGGACGGCGGCGG + Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901684274 1:10935029-10935051 AAGCATCCCCAGGACTGCAGGGG - Intergenic
901743546 1:11357761-11357783 AAGCTTGCCGGGGACAGCTGGGG - Intergenic
902397053 1:16138098-16138120 ACGCCCCCTCAGGACAGCGGGGG - Exonic
903212808 1:21828226-21828248 AAGCCTGCCCAGGGCACCGGAGG - Intronic
903694528 1:25197243-25197265 AAGCCACCCCGGGCCAGGGTGGG + Intergenic
903788231 1:25875361-25875383 AAGGCTCCGCGGGGCAGGGGCGG - Intergenic
907320881 1:53601588-53601610 AGGCCTCCCTTGGACAGCAGTGG - Intronic
914717121 1:150262426-150262448 GTGCCTGCCGGGGACAGCGGGGG + Intronic
916045769 1:160999014-160999036 ATGCCTCCCCTGGGCAGGGGTGG - Intronic
920336357 1:205247884-205247906 GAGCCTCTCCAGGACAGCTGAGG - Intronic
1063421116 10:5913064-5913086 AAGTCTCCCCTGGACTGTGGGGG - Intronic
1063429703 10:5977722-5977744 ATGCGTCCCGGGGACAGGGGTGG - Intronic
1063570481 10:7210769-7210791 AAGCCTCCCTGGGTCAGCTCTGG + Intronic
1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG + Intergenic
1067936081 10:50613268-50613290 TAGCCTCCCTGGGTCAGGGGTGG - Intronic
1072228570 10:93393216-93393238 TAGCTTCCCGGGGACAGAGGGGG + Intronic
1072661158 10:97364270-97364292 AAGCCTTCCTGGCACAGTGGGGG - Intronic
1075247083 10:120832279-120832301 CAGGCTCCACGGGACAGCTGAGG + Intergenic
1076424646 10:130358990-130359012 AAACCTCCCAGTGACAGAGGAGG + Intergenic
1077063190 11:626612-626634 TGGCCTCCCCGGGTCAGCGCTGG - Intronic
1077140730 11:1023776-1023798 AAGCCTCCCCTGGGCAGCTGGGG + Intronic
1077807620 11:5605214-5605236 AAGCCTCCCAGGGAGAGGGAGGG - Intronic
1077916024 11:6612039-6612061 CAGCCCCGCGGGGACAGCGGGGG - Exonic
1078556545 11:12331516-12331538 AAGCCTCTCCAGGACCGGGGAGG + Intronic
1078913020 11:15750935-15750957 AAGCTCCCCAGGGACAGCTGAGG + Intergenic
1079145427 11:17847053-17847075 AAGCCTCCTGGTGACAGGGGAGG + Intronic
1080779835 11:35419683-35419705 AAGCCTTCCCGGACGAGCGGCGG - Intronic
1083685659 11:64373508-64373530 AGGCCTCCCGGGGACAGGAGGGG - Intergenic
1084492529 11:69486591-69486613 AAGACCCCCCAGGACAGCGAGGG - Intergenic
1089969681 11:122682733-122682755 AAGCTTCCCCGTGACAGTGCTGG - Intronic
1092172709 12:6383885-6383907 AAGCCTCGCAGGGAGAGCAGAGG - Intronic
1095687388 12:45051065-45051087 AAGGCCACCCGGGACGGCGGCGG + Exonic
1101131948 12:101698334-101698356 AAGCCTCCCCTGGGCAGCGGAGG + Intronic
1103195994 12:119044273-119044295 AAGCCTTCTGGTGACAGCGGCGG + Intronic
1116493734 14:45536430-45536452 AAGCCAACCCGGGGCAGAGGTGG - Intergenic
1118801227 14:69191723-69191745 AACTCGCTCCGGGACAGCGGGGG - Intronic
1122209569 14:100165992-100166014 GAGCCTGCCCGGGAGAGTGGGGG + Intergenic
1122209589 14:100166038-100166060 GAGCCTGCCCGGGAGAGTGGGGG + Intergenic
1122209608 14:100166084-100166106 GAGCCTGCCCGGGAGAGTGGGGG + Intergenic
1122782102 14:104148011-104148033 AGGCCACCCTGGGACAGCGAGGG - Intronic
1122784283 14:104156702-104156724 AAGCCGCCCCGGGACCCAGGAGG - Intronic
1122955745 14:105070111-105070133 CAGCCTCCCCGAGACAGAAGAGG + Intergenic
1128114239 15:65095286-65095308 AAGCTTCCCAGGGACAGGGAAGG - Intronic
1128457320 15:67838957-67838979 GAGCCACCCAGGGACAGCGGCGG - Intergenic
1129785357 15:78306572-78306594 AAGCCTTCCCGGAACTGGGGCGG - Intergenic
1132637430 16:958970-958992 CAGCATCCCCGGCACAGCGAGGG - Intronic
1132646822 16:1003096-1003118 GAGCCGCCCCTGGCCAGCGGGGG - Intergenic
1136269804 16:29141782-29141804 AATCCTCCACGGCACAGGGGGGG + Intergenic
1138590970 16:57999797-57999819 AAGCCTTCTCGGGACAGAGAGGG + Exonic
1141714111 16:85717042-85717064 AAGCCTCCCCGGAAGTGGGGAGG - Intronic
1141789896 16:86227292-86227314 AAGCCTCCCTGGGCCTGGGGTGG + Intergenic
1145295944 17:21592855-21592877 CAGCCTCCCCGGAAGAGCGCTGG - Intergenic
1145367844 17:22279207-22279229 CAGCCTCCCCGGAAGAGCGCTGG + Intergenic
1146261894 17:31427451-31427473 AAGCCTACCTGGGACAGAGGTGG - Intronic
1150202007 17:63367324-63367346 AAGCCTCCCGGGGACACATGTGG - Intronic
1154360117 18:13653906-13653928 CAGCCTCCCAGGGACAGTGGGGG - Intergenic
1155625065 18:27825265-27825287 AAGCCTTCCAGGGAAAGGGGAGG - Intergenic
1160239651 18:77113928-77113950 AAGCTTCCCCGTGACACTGGAGG + Intronic
1163321325 19:16576715-16576737 AAGCCTGCCCGGGACAGGAGGGG + Exonic
1163516399 19:17766606-17766628 ACCCCACCCCGGGACAGCGCTGG - Intronic
1163737151 19:18988438-18988460 CTGCCTCTCCGGGACAGTGGGGG - Intergenic
1166339639 19:42129754-42129776 AGGCCACCCAGGGACAGCTGTGG - Intronic
1167472666 19:49684308-49684330 AGGCCTCCCCGGGAGAGGTGAGG + Intronic
925329411 2:3046923-3046945 AAGCCTCCCCGAGGCCGCTGCGG + Intergenic
926775561 2:16419145-16419167 CAGCCACCCTGGGACAGAGGTGG + Intergenic
933153017 2:78937461-78937483 AAGCCTACAAGGGACAGAGGTGG - Intergenic
935218725 2:100994186-100994208 AAGCCCCCCCAGGACAGGGAAGG - Intronic
948044494 2:234933059-234933081 AATCCTCCCTGGGAAAGGGGAGG - Intergenic
948379237 2:237541416-237541438 AGGCCTCCCAGGGACAGCTGAGG + Intronic
948392694 2:237624383-237624405 AAGCCTCCACGAGAAAGTGGAGG - Intergenic
1171457968 20:25282594-25282616 AAGCCTTCCCAGGAAAGCTGAGG + Intronic
1172516950 20:35541863-35541885 AATCCCGCCCCGGACAGCGGAGG + Intergenic
1175922558 20:62456977-62456999 CAGCCTCTCCGGGCCAGGGGAGG - Intergenic
1179563989 21:42235019-42235041 CAGCCTCCCTGGGACAGGGGCGG + Intronic
1180866240 22:19121713-19121735 ACTCCTCGCCTGGACAGCGGTGG - Intronic
1181831749 22:25565244-25565266 CACCCGCCCCGGGGCAGCGGAGG - Intronic
1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG + Intronic
953716705 3:45322087-45322109 CAGCCTCCCTAGGACTGCGGAGG - Intergenic
954627551 3:52030778-52030800 AAGCCTCCCAGGGGCTGGGGTGG - Intergenic
968642548 4:1721741-1721763 ACGCTTCCCGGGGAAAGCGGCGG - Intronic
968756413 4:2418428-2418450 CAGCCTCCCTGCGACAGCGCGGG - Exonic
969239371 4:5888803-5888825 AGGCCTCCCCGGAACATCTGCGG + Intronic
969511156 4:7618652-7618674 AAGCCTCCTAGGCACAGGGGAGG - Intronic
971476609 4:27078515-27078537 CTGCCTCACCGGGACAGTGGTGG - Intergenic
972738126 4:41865372-41865394 AGGCCACCCAGGGACTGCGGCGG - Intergenic
987109720 5:14674263-14674285 AAGTCTCCACGGACCAGCGGAGG - Intronic
990395067 5:55369501-55369523 AAGCATCCCTGGTACAGTGGAGG + Intronic
993651636 5:90529501-90529523 GAACTTACCCGGGACAGCGGCGG - Exonic
994660046 5:102642220-102642242 AAACCTCCCCGGGCCAGTGGTGG + Intergenic
996862655 5:128083714-128083736 AAGCCTCGGCGGGGCTGCGGCGG - Intergenic
997869858 5:137497975-137497997 AAACCTCCCCGGGGCAGCGGTGG - Intronic
999964848 5:156798380-156798402 AAGCCTCCCCTGGAAAGGGGAGG + Intergenic
1001845918 5:174921384-174921406 AAGCCTCCCGGGGTCCGCGCAGG + Intergenic
1002508774 5:179699077-179699099 TAGCCTCCCGGGGACCGCGGGGG - Exonic
1015793722 6:136989745-136989767 AAGCCACCCCGGGAAAGATGTGG + Intergenic
1018080857 6:160258488-160258510 AAGCCTCCCCAAGACAGTGTAGG - Exonic
1018695579 6:166388791-166388813 AAGCCTCCCAGGGGCTCCGGTGG + Intergenic
1019151141 6:170006764-170006786 AAGCCTCCTCTGGACAGCGCTGG - Intergenic
1021340288 7:19456043-19456065 AAGCCTCCATGGGACAGCCAAGG - Intergenic
1022904541 7:34843097-34843119 CAGCCTCCCCAGCACAGTGGTGG + Intronic
1023768807 7:43536368-43536390 GAGCCTCCCCTGGGCAGTGGAGG - Intronic
1026909472 7:74083901-74083923 CCGCCTCCCCGGGCCGGCGGCGG + Intronic
1030455748 7:109772320-109772342 CAGGCTCCCTGGGACAGCTGAGG + Intergenic
1034535176 7:151721576-151721598 AGGCCTGCCCGTGACAGTGGGGG + Intronic
1035172036 7:157022156-157022178 CAGCCTCCCCCGGTCAGGGGAGG + Intergenic
1037818414 8:22124031-22124053 AAGCCTTCCAGGGACATTGGAGG + Intronic
1039589584 8:38735400-38735422 CAGCCTCCCAGGCACAGCGCGGG - Intronic
1040298236 8:46174350-46174372 AAGCCTGCCTGGGACAGCTGTGG - Intergenic
1040303525 8:46200380-46200402 CAGCCTGCCCGGGACAGCCCTGG - Intergenic
1040325232 8:46338263-46338285 CAGCCTGCCCGGGACAGGTGGGG - Intergenic
1040333885 8:46406338-46406360 CAGCCTGCCCGGGACAGCTCTGG - Intergenic
1040337476 8:46423379-46423401 CAGCCTGCCCGGGACAGCCCTGG - Intergenic
1040338609 8:46428633-46428655 AATCCTGCCCGGGACAGCCCTGG - Intergenic
1040338820 8:46429678-46429700 TAGCCTGCCCGGGACAGCCTGGG - Intergenic
1040340615 8:46438684-46438706 CAGCCTGCCCGGGACAGCCCTGG + Intergenic
1040341323 8:46442608-46442630 CAGCCCACCCGGGACAGCTGTGG + Intergenic
1045188211 8:99858915-99858937 AAGCCTCCCCGGGACAGCGGAGG - Intronic
1045232204 8:100316362-100316384 CAGGCTGCCCGGGACAGCAGTGG - Intronic
1048161289 8:132024387-132024409 AAGGCTCCAAGGGACAGAGGAGG + Exonic
1060413101 9:123412776-123412798 AAGCCTCCCGGGGATTGCTGTGG - Intronic
1060732365 9:126046762-126046784 AAGTCTCCCCAGGAGAGGGGAGG - Intergenic
1061280940 9:129597393-129597415 CAGCCTTCCCGGGACAGGGCCGG - Intergenic
1185890313 X:3816351-3816373 GAGACTCCCCGGGGCTGCGGGGG + Intergenic
1186515684 X:10164786-10164808 TGGCCTCCCAGGGACAGCAGAGG + Intronic
1191942728 X:66498463-66498485 AAACCTTCCCGGGACTGCTGTGG + Intergenic