ID: 1045188219

View in Genome Browser
Species Human (GRCh38)
Location 8:99858958-99858980
Sequence CAAACACCTGCAACCCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045188211_1045188219 20 Left 1045188211 8:99858915-99858937 CCTCCGCTGTCCCGGGGAGGCTT No data
Right 1045188219 8:99858958-99858980 CAAACACCTGCAACCCAAGAAGG No data
1045188213_1045188219 10 Left 1045188213 8:99858925-99858947 CCCGGGGAGGCTTTAGAGAGAAC No data
Right 1045188219 8:99858958-99858980 CAAACACCTGCAACCCAAGAAGG No data
1045188207_1045188219 27 Left 1045188207 8:99858908-99858930 CCTGGTGCCTCCGCTGTCCCGGG No data
Right 1045188219 8:99858958-99858980 CAAACACCTGCAACCCAAGAAGG No data
1045188212_1045188219 17 Left 1045188212 8:99858918-99858940 CCGCTGTCCCGGGGAGGCTTTAG No data
Right 1045188219 8:99858958-99858980 CAAACACCTGCAACCCAAGAAGG No data
1045188214_1045188219 9 Left 1045188214 8:99858926-99858948 CCGGGGAGGCTTTAGAGAGAACC No data
Right 1045188219 8:99858958-99858980 CAAACACCTGCAACCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045188219 Original CRISPR CAAACACCTGCAACCCAAGA AGG Intronic