ID: 1045189061

View in Genome Browser
Species Human (GRCh38)
Location 8:99865473-99865495
Sequence CTGGCGGAGGCCTGTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045189061_1045189066 4 Left 1045189061 8:99865473-99865495 CCAACAAAACAGGCCTCCGCCAG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1045189066 8:99865500-99865522 AATCAGAAAAGTCCCCTCCGAGG No data
1045189061_1045189067 5 Left 1045189061 8:99865473-99865495 CCAACAAAACAGGCCTCCGCCAG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1045189067 8:99865501-99865523 ATCAGAAAAGTCCCCTCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045189061 Original CRISPR CTGGCGGAGGCCTGTTTTGT TGG (reversed) Intronic
900299465 1:1969643-1969665 CTGGCGCAGGCCTGGCATGTAGG - Intronic
900572216 1:3364268-3364290 TGGGCGGAGGTCTGTATTGTGGG + Intronic
901170942 1:7256821-7256843 CTGGCGAGGGCCTGTTTCCTGGG + Intronic
903256829 1:22108209-22108231 CCGGCCGAGGCCTGGTTTTTGGG + Intergenic
905912813 1:41665249-41665271 CTGGTGGAGGCCTGGTCTGCAGG - Intronic
906776604 1:48535334-48535356 ATGGGGGAGGCTTATTTTGTGGG - Intronic
907360989 1:53914781-53914803 CTGGGGGAGGCATCCTTTGTGGG - Intergenic
908930938 1:69315433-69315455 CTGGCAGAGGCATGTGTTCTGGG + Intergenic
909165793 1:72222252-72222274 CTGGGGTAGACCTGTTTTTTAGG - Intronic
909505135 1:76379658-76379680 CTGGGAGAGGCCTGTTTTTCTGG - Intronic
911298224 1:96143330-96143352 CTCCCGGAGGCTTTTTTTGTAGG + Intergenic
913167692 1:116203633-116203655 CTGGCGGCCGTCTGTTTTATGGG - Intergenic
915290904 1:154882596-154882618 CTGGAAGAGGCCTGTTGTGGCGG + Intergenic
923118925 1:230971812-230971834 GTGGGGAAGGCCTGTTTTGTTGG - Intronic
1063448276 10:6133987-6134009 CTGGCCGAGGCCAGCTTTGTCGG + Intergenic
1063827384 10:9912732-9912754 CTGGAGGAGGCGTTTTTTGAAGG - Intergenic
1067375009 10:45719870-45719892 CTGGAGGTGGCCTGTTCAGTGGG - Intergenic
1067882823 10:50061511-50061533 CTGGAGGTGGCCTGTTCAGTGGG - Intergenic
1067886417 10:50093331-50093353 CTGGAGGTGGCCTGTTCAGTGGG + Exonic
1069811460 10:71163112-71163134 CTGGCGGAGGCTGGTCGTGTGGG - Intergenic
1073186026 10:101615497-101615519 CTGGGGGAGACCTGTTTCCTTGG + Intronic
1077129555 11:963996-964018 CTGGCTGACGCCTCTGTTGTGGG - Intronic
1086798749 11:91144190-91144212 ATGGCAAAGCCCTGTTTTGTAGG + Intergenic
1091769490 12:3141795-3141817 CTGGCCCAGACCTGTTCTGTGGG + Intronic
1094714589 12:32999979-33000001 ATGGTTGAGGCCTCTTTTGTAGG + Intergenic
1108609641 13:52071533-52071555 CTGGCTGGGGCCAGTGTTGTGGG - Intronic
1111751920 13:92343940-92343962 ATGGTGGAAGCCTGTTTTTTGGG + Intronic
1115178603 14:30595149-30595171 CAGGATGAAGCCTGTTTTGTTGG + Intronic
1115506398 14:34098025-34098047 CTGTCTGAGGCCTTTTCTGTGGG - Intronic
1120038963 14:79730336-79730358 ATGGAGGAGGCCTGTGTAGTGGG - Intronic
1129741334 15:77991082-77991104 CTGGCTGAGGACTCTTTTCTAGG - Intronic
1130912878 15:88283072-88283094 CAGGTGGAGGCCTGTTTAGAGGG + Intergenic
1131557947 15:93415529-93415551 CAGGAGGAGGCCTGGTTTGCTGG + Intergenic
1134607792 16:15584743-15584765 ATGGAGAAGGCCTGTGTTGTAGG - Intronic
1143029679 17:3960942-3960964 CTGGTGGACGCTTGTGTTGTTGG - Intronic
1146039063 17:29433883-29433905 CTGACAGGGGCCTGTTTTGGGGG + Intronic
1151797316 17:76354860-76354882 ATGGCTGAGGCCTGTAATGTCGG - Intronic
1155391014 18:25336710-25336732 CTTTCTGAAGCCTGTTTTGTGGG - Intronic
1156470740 18:37375906-37375928 CTGGAGGAGGCCTTTTTAATTGG + Intronic
1158734856 18:60068068-60068090 CTGTCGGAGGCATCTTCTGTTGG + Intergenic
1163568344 19:18065216-18065238 CTGGCTAAACCCTGTTTTGTGGG + Intronic
1167037912 19:47005176-47005198 CTGGCCGAGGCCTCTCCTGTGGG - Intergenic
1167509136 19:49887200-49887222 CGGGCAGAGGTCTGTTTCGTCGG + Intronic
934991420 2:98924642-98924664 TTAGGGGAGGCATGTTTTGTGGG - Intronic
937072153 2:119072721-119072743 ATGGCAGAGGCCAGTTTGGTTGG - Intergenic
941651261 2:168094864-168094886 CTGGAGGGGGCCTGGTTTGCAGG - Intronic
941810310 2:169748818-169748840 CAGGCGGAGGGCTGCTGTGTGGG - Intronic
942061258 2:172230698-172230720 ATGGAGGAGGCTTGTTTAGTGGG + Intergenic
942500971 2:176590881-176590903 ATGCCAGAGGCCTGTTTTCTAGG + Intergenic
942503705 2:176619217-176619239 CTAGCGGAGGCCTGTGCTGCCGG + Intergenic
944650078 2:201821195-201821217 TTGGCAGAGCCCTGTTTTGCTGG - Intronic
945668009 2:212765895-212765917 CTGGAGGAGGACTGGTGTGTGGG - Intergenic
948899137 2:240947344-240947366 CTGGCTGGGGCCTGTGTTCTGGG - Intronic
1169135179 20:3192949-3192971 CTGCCTGATCCCTGTTTTGTAGG - Intronic
1170107143 20:12763935-12763957 CTGGAGGAGGCTTGTTCAGTAGG - Intergenic
1173163050 20:40666399-40666421 CTGGTGGGGGACTGTGTTGTGGG + Intergenic
1174598344 20:51702941-51702963 CTGCCGGAGGCCTGTTAGGAGGG - Intronic
1179960109 21:44763421-44763443 CTGGCAGAGGACTGTCTCGTTGG - Intergenic
1181665342 22:24391662-24391684 CTGGCGGAGGCATGGTCTGTTGG + Intronic
950408874 3:12821439-12821461 CTGCCAGGGGCCTGTTATGTGGG + Intronic
953042324 3:39266439-39266461 TTGGCTGAGGCCTGTTATATTGG - Exonic
954669195 3:52278949-52278971 CTGCTGGAGGCCGGTTTTGGGGG + Intronic
962654473 3:137529262-137529284 CAGGTGGGGGCCTGTTTTGATGG - Intergenic
968475959 4:808617-808639 CTGCCTGATGCCTGTTTTATGGG - Intronic
968666774 4:1826708-1826730 CTGGCGGAGCCCAGCTTAGTGGG - Intronic
968878194 4:3285377-3285399 CCAGCAGAGGCCTGTTTTGGGGG + Intergenic
969228931 4:5816447-5816469 CTGGAGGAGCCCTGTCATGTGGG - Intronic
969272912 4:6115003-6115025 CTGGCTGAGCCTTGTGTTGTTGG - Intronic
971214316 4:24649437-24649459 CTGGCAGTGGCTTGTTTTGTGGG - Intergenic
974319251 4:60323731-60323753 CTGGTGGAAGCTTGTTTTGTAGG + Intergenic
976381775 4:84407714-84407736 CTGGCGGGCGGCTGGTTTGTTGG - Intergenic
990092106 5:52064412-52064434 CTGGGGTATGTCTGTTTTGTGGG + Intronic
996121999 5:119683032-119683054 ATGGAGGAGGTCTTTTTTGTTGG + Intergenic
997600678 5:135136296-135136318 CTGGGGTAGGTCTGTTTTGGGGG + Intronic
999228337 5:150046029-150046051 CTCTGGGAGGCCTGTTTTGAAGG - Intronic
1000119197 5:158180488-158180510 CTGGATGATGCCTGTTTTATGGG - Intergenic
1018786820 6:167114627-167114649 CTGGCCGAGGCCTGCTGTGACGG + Intergenic
1024247148 7:47479308-47479330 CTGGCTGAAGCCTGTTTTCCTGG - Intronic
1026788422 7:73316617-73316639 CTGGTGGAGGCCTGGCTTGAAGG + Exonic
1027002015 7:74659998-74660020 CAGGCTGAGGCCTGTGGTGTGGG + Intronic
1029352414 7:100023635-100023657 CTGGAGGAGGCGTGTCCTGTAGG - Exonic
1035206754 7:157298619-157298641 CTGGAGGAAGCCTGTTCTGTGGG - Intergenic
1036596951 8:10221898-10221920 GTGGCGGAGGCCTGTGTGGCTGG + Intronic
1043756670 8:84012118-84012140 CTGGCAAAGGCCTGCTTTCTAGG - Intergenic
1045189061 8:99865473-99865495 CTGGCGGAGGCCTGTTTTGTTGG - Intronic
1048799847 8:138185560-138185582 CTGTGGGCAGCCTGTTTTGTTGG - Intronic
1049601955 8:143512100-143512122 CTGCCCCAGGCCTGTTCTGTGGG - Intronic
1051340524 9:16105927-16105949 CTGCCAGTGGCCTGTTTTCTTGG - Intergenic
1055704120 9:78979111-78979133 CTGGTGGAGGCATTATTTGTTGG - Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1061715367 9:132515305-132515327 CAGGCGGAGGCCTGTGTCTTTGG + Intronic
1061838730 9:133345559-133345581 CTGTGGGAGCCCTGTTTGGTAGG + Intronic
1062422666 9:136490869-136490891 CTGCCGGGGGCCTGATTTGTGGG + Intergenic
1191779180 X:64848079-64848101 CAGATGGGGGCCTGTTTTGTAGG - Intergenic
1200234354 X:154461033-154461055 CTGGCGGTGGCCCGTGATGTTGG + Intronic
1200964999 Y:9027670-9027692 CTGGGAGATGCCTGTTTTTTTGG + Intergenic
1201387455 Y:13457641-13457663 CTGGCTGAGGCATGTTTGTTAGG - Intronic