ID: 1045193726

View in Genome Browser
Species Human (GRCh38)
Location 8:99908760-99908782
Sequence CAGAGAGAAGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045193721_1045193726 6 Left 1045193721 8:99908731-99908753 CCTGACAACAGAGTAAGAATCAG No data
Right 1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG No data
1045193719_1045193726 16 Left 1045193719 8:99908721-99908743 CCTGTTTTTCCCTGACAACAGAG No data
Right 1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG No data
1045193718_1045193726 17 Left 1045193718 8:99908720-99908742 CCCTGTTTTTCCCTGACAACAGA No data
Right 1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG No data
1045193717_1045193726 24 Left 1045193717 8:99908713-99908735 CCTGGCACCCTGTTTTTCCCTGA No data
Right 1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG No data
1045193720_1045193726 7 Left 1045193720 8:99908730-99908752 CCCTGACAACAGAGTAAGAATCA No data
Right 1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045193726 Original CRISPR CAGAGAGAAGAGAAGGAGGA GGG Intergenic
No off target data available for this crispr