ID: 1045194138

View in Genome Browser
Species Human (GRCh38)
Location 8:99912857-99912879
Sequence ATTCAATACAATAGATATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045194138_1045194142 14 Left 1045194138 8:99912857-99912879 CCAACATATCTATTGTATTGAAT No data
Right 1045194142 8:99912894-99912916 ATTCTTCCAAATCTTTCTTCTGG No data
1045194138_1045194144 29 Left 1045194138 8:99912857-99912879 CCAACATATCTATTGTATTGAAT No data
Right 1045194144 8:99912909-99912931 TCTTCTGGAGTTCTCCCTCCTGG No data
1045194138_1045194145 30 Left 1045194138 8:99912857-99912879 CCAACATATCTATTGTATTGAAT No data
Right 1045194145 8:99912910-99912932 CTTCTGGAGTTCTCCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045194138 Original CRISPR ATTCAATACAATAGATATGT TGG (reversed) Intergenic
No off target data available for this crispr