ID: 1045198288

View in Genome Browser
Species Human (GRCh38)
Location 8:99952299-99952321
Sequence ATGGAGCCTGGGTCTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045198288_1045198296 20 Left 1045198288 8:99952299-99952321 CCTTCCAGAGACCCAGGCTCCAT No data
Right 1045198296 8:99952342-99952364 TACTCCATCTACACAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045198288 Original CRISPR ATGGAGCCTGGGTCTCTGGA AGG (reversed) Intergenic
No off target data available for this crispr