ID: 1045198294

View in Genome Browser
Species Human (GRCh38)
Location 8:99952326-99952348
Sequence TGGAGTAGATGGAGCACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045198294_1045198296 -7 Left 1045198294 8:99952326-99952348 CCATAGGTGCTCCATCTACTCCA No data
Right 1045198296 8:99952342-99952364 TACTCCATCTACACAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045198294 Original CRISPR TGGAGTAGATGGAGCACCTA TGG (reversed) Intergenic
No off target data available for this crispr