ID: 1045198296

View in Genome Browser
Species Human (GRCh38)
Location 8:99952342-99952364
Sequence TACTCCATCTACACAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045198290_1045198296 9 Left 1045198290 8:99952310-99952332 CCCAGGCTCCATAATTCCATAGG No data
Right 1045198296 8:99952342-99952364 TACTCCATCTACACAGTGAAAGG No data
1045198293_1045198296 1 Left 1045198293 8:99952318-99952340 CCATAATTCCATAGGTGCTCCAT No data
Right 1045198296 8:99952342-99952364 TACTCCATCTACACAGTGAAAGG No data
1045198292_1045198296 8 Left 1045198292 8:99952311-99952333 CCAGGCTCCATAATTCCATAGGT No data
Right 1045198296 8:99952342-99952364 TACTCCATCTACACAGTGAAAGG No data
1045198289_1045198296 16 Left 1045198289 8:99952303-99952325 CCAGAGACCCAGGCTCCATAATT No data
Right 1045198296 8:99952342-99952364 TACTCCATCTACACAGTGAAAGG No data
1045198294_1045198296 -7 Left 1045198294 8:99952326-99952348 CCATAGGTGCTCCATCTACTCCA No data
Right 1045198296 8:99952342-99952364 TACTCCATCTACACAGTGAAAGG No data
1045198288_1045198296 20 Left 1045198288 8:99952299-99952321 CCTTCCAGAGACCCAGGCTCCAT No data
Right 1045198296 8:99952342-99952364 TACTCCATCTACACAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045198296 Original CRISPR TACTCCATCTACACAGTGAA AGG Intergenic
No off target data available for this crispr