ID: 1045203191

View in Genome Browser
Species Human (GRCh38)
Location 8:100008570-100008592
Sequence CTGAAGGAGAAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1582
Summary {0: 1, 1: 1, 2: 10, 3: 151, 4: 1419}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045203185_1045203191 24 Left 1045203185 8:100008523-100008545 CCAATGTCAAGAGTGGCAGAAGG 0: 1
1: 1
2: 0
3: 11
4: 146
Right 1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG 0: 1
1: 1
2: 10
3: 151
4: 1419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045203191 Original CRISPR CTGAAGGAGAAGAGGGAAGA AGG Intronic
900168368 1:1254152-1254174 CAGACGCAGAAGAGGGGAGACGG + Intronic
900522309 1:3111567-3111589 AGGAAGGGGAAGAGGGAGGAGGG + Intronic
901031923 1:6312057-6312079 CTGACGGAGAAGTGAGAAGAGGG + Intronic
901269733 1:7942513-7942535 CAGAAGCAGAAGAAGGCAGACGG + Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
901568728 1:10141691-10141713 CTGGAAGCGAAGAGGGATGATGG + Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901784527 1:11616097-11616119 CTGAGGGAGCAGAGGGCAGTGGG - Intergenic
901882824 1:12204108-12204130 CAGAAGGGGCAGAGGGGAGAGGG - Intronic
902036622 1:13462749-13462771 CTGATTGGGAAGAGGGAAGGAGG + Intergenic
902389713 1:16095970-16095992 TTGGAGGGGAAGAGGGAAAAGGG + Intergenic
902723802 1:18322357-18322379 CTCCACCAGAAGAGGGAAGACGG - Intronic
902777102 1:18682157-18682179 CTCAAGGAGAGGAGGGAGGGAGG - Intronic
902984972 1:20149600-20149622 GTGAAGGAGAGGGGAGAAGATGG + Exonic
903038860 1:20513363-20513385 AGGAAAGAGAAGAGGGAGGAAGG + Intergenic
903313818 1:22484190-22484212 TTGAAGGAGAAGACTGAAGTTGG - Intronic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
904040308 1:27580422-27580444 GAGCAGGAGAAAAGGGAAGAGGG - Intronic
904272985 1:29362580-29362602 TTGCTGGAGAAGAGGGAAAAAGG + Intergenic
904304083 1:29575797-29575819 CTGGAGGAGGGCAGGGAAGAGGG - Intergenic
904401433 1:30259198-30259220 GTAAAGGAGAAGAGGCATGAGGG - Intergenic
904480732 1:30791713-30791735 GAGAAGGAAGAGAGGGAAGAAGG + Intergenic
904581677 1:31548473-31548495 CTCGAGGAGAAGAGGGATGGGGG + Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
904960452 1:34328537-34328559 CTGAAGCAGAACAGGGAGGTGGG - Intergenic
905180924 1:36166095-36166117 CTGAAGGAGGGGAGGGAACGAGG + Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905439509 1:37985863-37985885 TTGAAGGAGCACAGGGAAAAAGG - Intronic
905843315 1:41204464-41204486 ATGAAGTAGAAGAGGTAAGTAGG - Intronic
905867963 1:41386551-41386573 GTGAGAGAGAAGAGAGAAGACGG - Intergenic
905876241 1:41433585-41433607 ATGAAGGCCAAGAGAGAAGACGG - Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
906732750 1:48097332-48097354 CTAAAGGAGAAGGGGGATCAAGG - Intergenic
906837530 1:49100136-49100158 CTGAAGGAGGAGAAAGAAGTAGG + Intronic
907049993 1:51323517-51323539 CTAACAGAGAAGAGAGAAGAAGG - Intronic
907261263 1:53220447-53220469 CTGAAGGAGCAGGAGGCAGAAGG - Intronic
907400530 1:54222309-54222331 CTGAAGGGCAAGTGGGAAGGAGG + Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907670561 1:56471339-56471361 AGGATGGAGAGGAGGGAAGAAGG + Intergenic
908007312 1:59740074-59740096 CTGAAGGAGGACAGGGAGGGAGG - Intronic
908114751 1:60929668-60929690 CTATAGGAGAATAGGGAAGGGGG + Intronic
908416384 1:63916999-63917021 CTGAAGGGGAAGGGAGCAGAAGG - Intronic
908601300 1:65743264-65743286 TTCAAGGAGAAGAGGGATTATGG + Intergenic
909041189 1:70654198-70654220 CCCAAGAAGAAGAGGAAAGAAGG + Intergenic
909229967 1:73075309-73075331 TTGAAGGGGAGGTGGGAAGAGGG - Intergenic
909457962 1:75871106-75871128 CAGAAGGAGAAGGGGAAACAAGG + Intronic
909883355 1:80908787-80908809 CGAAAGGAGAGGAGAGAAGAGGG + Intergenic
910017224 1:82540791-82540813 CAGAAGAAGAAAAGGGAAAAGGG + Intergenic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910548024 1:88441027-88441049 GAAAAGGAGAAGAAGGAAGAAGG + Intergenic
910663270 1:89696480-89696502 GGGAAGGGGAAGAGAGAAGAGGG + Intronic
910750270 1:90621484-90621506 CTCAAGAAGAAGAGGGAGAAAGG - Intergenic
910806751 1:91195790-91195812 CTGATAGAGAAGAGGTAAGTAGG + Intergenic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911232560 1:95376485-95376507 CTGATAGAGAAGAGGGCTGAGGG + Intergenic
911720141 1:101182068-101182090 CGGAAGCAGAATTGGGAAGAGGG - Intergenic
912193431 1:107368225-107368247 GAGAAGGAAAAGAAGGAAGAGGG - Intronic
912233555 1:107823124-107823146 CCAAAGGAGAAGGAGGAAGATGG + Intronic
912379260 1:109238286-109238308 CTCAAGGGGAAGGTGGAAGATGG + Intergenic
912398456 1:109367786-109367808 TGTAAGGAGAAAAGGGAAGAGGG - Intronic
912692549 1:111815299-111815321 AAGAAGGAGAAGAGGAAAGAAGG - Intronic
912814134 1:112815451-112815473 GTGAAGGTGAGGAGGGGAGAAGG - Intergenic
913037701 1:114988184-114988206 CAGAAGGAGAAGAGGGAGAGAGG + Intronic
913057776 1:115178214-115178236 CAGAAGGAGAAAAGGAAGGAAGG - Intergenic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913385349 1:118252974-118252996 TTGAAGGGAAAGAGGGAGGAAGG - Intergenic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
913682621 1:121200992-121201014 CAGAAGTAGAAGAGGGGAGTAGG - Intronic
914034464 1:143988621-143988643 CAGAAGTAGAAGAGGGGAGTAGG - Intergenic
914154988 1:145079349-145079371 CAGAAGTAGAAGAGGGGAGTAGG + Intronic
914349807 1:146831276-146831298 CTCCAGGAGGAGAGGAAAGAGGG + Intergenic
914713873 1:150238218-150238240 TTGAAGGGGAAAAGAGAAGAGGG + Intergenic
915016027 1:152734643-152734665 TTGAAAGAAAAGAGGGAACAGGG - Intergenic
915064904 1:153216967-153216989 GTGAAGGGGAAGAGAGAGGAAGG - Intergenic
915270153 1:154747979-154748001 GTGAGGGAGAATGGGGAAGAAGG - Intronic
915841067 1:159213459-159213481 CTGAATGAGAAGAAGTAACAGGG + Intergenic
916087752 1:161283221-161283243 CTGAAGGAGATGAGGAAGTAAGG - Intronic
916238086 1:162610841-162610863 AGGAAGGAAAAGAGGGAGGAAGG + Intergenic
916478380 1:165192226-165192248 GAAAAGGAGAATAGGGAAGAGGG - Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
916662737 1:166936930-166936952 GGAATGGAGAAGAGGGAAGAAGG + Intronic
916718547 1:167465114-167465136 CTGAAGGAGAAGAAAGGAGGTGG - Intronic
916793719 1:168146258-168146280 TGGGAGGAGAAGAGGGAAGTGGG + Intergenic
916816317 1:168356622-168356644 CTCAAGGAAGGGAGGGAAGAAGG - Intergenic
916819185 1:168381564-168381586 CTGAAGTTGAAGAAGGATGAAGG + Intergenic
916851022 1:168703702-168703724 GTAAAGGAGGAGAGGGAAGGAGG + Intronic
917017003 1:170543424-170543446 GGGCAGGAGAAGAGGGAAGAAGG + Intronic
917421249 1:174866079-174866101 GTGAAGGAGAGGAGGGGAGAGGG + Intronic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
918834914 1:189449828-189449850 CTGACAAAGAAAAGGGAAGAGGG + Intergenic
919061627 1:192641400-192641422 AGGAAGGAGGAGAGGGAAGGAGG + Intronic
919066767 1:192701619-192701641 CTCAAGAAAAAGGGGGAAGAAGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919267292 1:195286263-195286285 AAGAAGGAGAAAAGGGAGGAAGG - Intergenic
919267300 1:195286333-195286355 AAGAAGAAGAAGGGGGAAGAAGG - Intergenic
919411470 1:197249435-197249457 GTGAAGGAGAACAGGAAATATGG + Intergenic
919434832 1:197544977-197544999 AGGAAGGGGAAGAAGGAAGAAGG + Intronic
919592776 1:199525473-199525495 CAAAAGGAGAATATGGAAGAGGG + Intergenic
919742722 1:200990462-200990484 CAAAAGGAGCAGAGGGAAGTGGG + Intronic
920099683 1:203509010-203509032 CAGAAGGAGAATAGAGAAAAAGG - Intergenic
920363904 1:205438148-205438170 CTGAAGCCCAAGAGGGAAAATGG + Intronic
920469933 1:206219510-206219532 CAGAAGTAGAAGAGGGGAGTAGG - Intronic
920612861 1:207458631-207458653 CTGAAGGACAAGAAGGAAGAAGG - Intronic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921091045 1:211843408-211843430 CTCAAGGAGAGGAAGAAAGATGG + Intergenic
921133655 1:212241198-212241220 CTGAAGAAGAGGAGGGGACATGG - Intergenic
921202657 1:212822191-212822213 ATGAAGGAAAATAGGAAAGAAGG + Intergenic
921232195 1:213084177-213084199 CTGGGGGAGAAAGGGGAAGAGGG - Intronic
921388373 1:214594406-214594428 CTGAATGATGAGAGGGAAGTGGG + Intergenic
921466904 1:215499221-215499243 CTGAATGGGAAGAGGAAAGAGGG + Intergenic
921650394 1:217671586-217671608 CAGAAGGAGAAGAGAAAGGAAGG - Intronic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG + Intergenic
922279641 1:224111530-224111552 CTGCAGGAGAAGAAGAGAGATGG + Intergenic
922381119 1:225027571-225027593 CAGAAGGTGAAGAGGGAAGCAGG + Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922578453 1:226679270-226679292 CAAAAGCAGAAAAGGGAAGAGGG - Intronic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923229494 1:231971536-231971558 AGGAAGGGGAAGAGGGAAAAAGG - Intronic
923232460 1:231999734-231999756 CTGAAGGGGCAGAAGGCAGAAGG - Intronic
923247568 1:232147399-232147421 AAGAAAGAAAAGAGGGAAGAAGG + Intergenic
923619008 1:235562248-235562270 CTGAAGGAGAAGAACAAAGTTGG - Intronic
923699695 1:236288159-236288181 CTGACAAAGAAGAGGGAAGATGG - Intergenic
923806668 1:237265227-237265249 CTGTAGGAGAAAAGGCATGAAGG + Intronic
923818629 1:237408620-237408642 TTGAAGGAGAAGAACGAAGTTGG - Intronic
923844431 1:237713165-237713187 CTGATGGAAAAGAGGGAAAAGGG - Intronic
923875813 1:238045776-238045798 CTTGGGGAGAAGAGGGGAGAGGG + Intergenic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
924067250 1:240236609-240236631 CAGAAGGTGAAGAGGGGAGCAGG + Intronic
924166624 1:241289844-241289866 CTGAGTGAGAAGAGGAAAGATGG + Intronic
924652342 1:245940743-245940765 TTGAAGGAGAAGAGGCACTATGG - Intronic
924699327 1:246435159-246435181 TTAAAGGAGAAGAGGAAAGGAGG + Intronic
924929281 1:248713242-248713264 TTGAAAGAGAAAAGGGAAGATGG - Intergenic
1062863501 10:829150-829172 CTGCATGACAAGAGGGGAGACGG + Intronic
1063256428 10:4332370-4332392 GTGATAGAGAAGAGGGAACAAGG - Intergenic
1063374494 10:5545991-5546013 TTGCAGGGGAAGAGGGGAGAAGG - Intergenic
1063394946 10:5678004-5678026 AGGAAGGAGGAGAGGGAAGCTGG - Intergenic
1063639117 10:7813558-7813580 CTGAAAGAGCAGATGCAAGATGG + Intergenic
1064405683 10:15060050-15060072 CAGAAGGAGAGAAGAGAAGAGGG - Intronic
1064592637 10:16910187-16910209 GAGAAGGAGAAGAGGGAGAAGGG - Intronic
1065838047 10:29677165-29677187 CTGAAGGCAAAAAGGGAAGGGGG - Intronic
1066300431 10:34091186-34091208 GTGGAGGAGACGAGGGAACAAGG + Intergenic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1067150349 10:43727748-43727770 CGGAAGGAGATGAGGGAAAGGGG + Intergenic
1067235752 10:44447714-44447736 CTGCAGGAGAAGGGGAAAAAAGG + Intergenic
1067720466 10:48724050-48724072 GTCAAAGAGAAGAGGAAAGATGG - Intronic
1067807912 10:49405909-49405931 GAGAAGGAAAAGGGGGAAGAGGG - Intergenic
1068715466 10:60182909-60182931 CTGAAGGAGAACACGGAACATGG - Intronic
1069058738 10:63871747-63871769 CTGGAGGGCAAGAGGGAAGTGGG + Intergenic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069694904 10:70379539-70379561 ATGAGGGATAAGAAGGAAGAGGG + Intronic
1070182322 10:74026135-74026157 TTGAAAAAGAAAAGGGAAGATGG + Intronic
1070449095 10:76539658-76539680 CTGAAGGAGGTCAGGAAAGATGG - Intronic
1070505457 10:77108865-77108887 CTGAAGAAAAATAGGCAAGAGGG + Intronic
1070839826 10:79476823-79476845 CTGAAGGTGATGAGGGGAAAAGG + Intergenic
1070887922 10:79921142-79921164 CAGCAGGAGAAGAAGGAAAAGGG - Intergenic
1070974965 10:80599274-80599296 CTGAAGGAGAAGACAGAAGAAGG + Intronic
1071250937 10:83818944-83818966 TTGGAGGAGAGAAGGGAAGAAGG - Intergenic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071468422 10:85961543-85961565 AGGAAGGAGGAAAGGGAAGAAGG - Intronic
1071522642 10:86340699-86340721 TAGAAGGGGAGGAGGGAAGAAGG + Intronic
1071586563 10:86828322-86828344 ATAAAGGAGAAGTGGGTAGAGGG + Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071998425 10:91169821-91169843 CTGAAGGAGAAGAACAAAGTTGG + Intronic
1072005939 10:91247571-91247593 ATGAAGGAGATGAGGCAGGAAGG + Intronic
1072259171 10:93651405-93651427 CTGAAGGAGAAGGGGAAGCAAGG + Intronic
1072591322 10:96831391-96831413 GAGAACGAGAAGAGAGAAGATGG - Intergenic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072702189 10:97650675-97650697 GAGATGGAGAAGAGGGAAAAAGG + Intronic
1072923438 10:99595894-99595916 CTGAAGGGGTAGGGGGAAGCAGG + Intergenic
1073031582 10:100530017-100530039 GGGAAGGATAAGCGGGAAGAAGG + Intronic
1073531013 10:104232100-104232122 CGGAGGGAGAGGAGGGAGGAGGG + Intronic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1073566050 10:104536590-104536612 GTGAAGGAGGAGAGGAGAGAGGG + Intergenic
1073787772 10:106909092-106909114 GTGAAGGAGAAGGGTGGAGAGGG - Intronic
1073816190 10:107209973-107209995 GTGGGGGAGAAGAGGGGAGAGGG + Intergenic
1073921847 10:108467757-108467779 CTGAAAGATAGGCGGGAAGAAGG + Intergenic
1073925872 10:108514563-108514585 CTGAAGGGGATGAGGGAAAATGG - Intergenic
1074258492 10:111828177-111828199 TATAAGGGGAAGAGGGAAGACGG + Intergenic
1074467331 10:113695224-113695246 CTGAGGGTGAACTGGGAAGAGGG - Intronic
1074567684 10:114596082-114596104 CTGAATGGGAGGAGTGAAGAGGG - Intronic
1075396680 10:122132820-122132842 CTGCAGGAGAAAAGAGAGGAGGG - Intronic
1075415846 10:122263315-122263337 CAGAAAGAGAAGAGAGAAAAGGG - Intergenic
1075779292 10:125006443-125006465 CTGAAGGAGCACTTGGAAGATGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075845540 10:125542390-125542412 GTGAGGGAGAAGAGGGAAGCTGG - Intergenic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1076199690 10:128548040-128548062 AAGAAGGAAAAAAGGGAAGAAGG + Intergenic
1076242595 10:128920908-128920930 CAGAAGGAAAAGAGCGAAGCTGG + Intergenic
1076517746 10:131058119-131058141 CTGGAAGAGAAGAAGGGAGAGGG + Intergenic
1076558765 10:131347277-131347299 ATGAAGGATAGAAGGGAAGAAGG - Intergenic
1076984787 11:227553-227575 CTGAAGGAGAAGAACAAAGGTGG + Intronic
1077058583 11:607893-607915 TTGATGGAGAAGAGGGGTGAGGG - Exonic
1077065160 11:637797-637819 GGGAAGGAGAAGAGGAACGAGGG - Intronic
1077304910 11:1864685-1864707 CTGAAGTAGGAGAGGGGAAAGGG + Intronic
1077493051 11:2870947-2870969 CCAAAGGTGCAGAGGGAAGAGGG - Intergenic
1077514484 11:2993086-2993108 CTGAAGCAGAGCAGGGCAGAGGG + Intergenic
1077531304 11:3096922-3096944 CGGGAGGAGGAGAGGAAAGAGGG + Intronic
1077531312 11:3096954-3096976 GAGGAGGAGAAGAGGAAAGAGGG + Intronic
1077531322 11:3096986-3097008 GAGGAGGAGAAGAGGAAAGAGGG + Intronic
1077531347 11:3097075-3097097 AAGGAGGAGAAGAGGAAAGAGGG + Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077791254 11:5442477-5442499 CTGAAGGAAAAGAGGCAGAAAGG - Intronic
1077923203 11:6656165-6656187 CTGAGGGAGAAGAGGGGAATAGG - Intergenic
1078187206 11:9062165-9062187 CTGAAGGAGTTGGGGGAAGAGGG - Intronic
1079181047 11:18193799-18193821 ATGAAGAAGAAGAGGAGAGAGGG + Intronic
1079185292 11:18230999-18231021 CTGAAGAAGAAGTGGGAATTTGG + Intronic
1079393125 11:20039432-20039454 GGGAAGGAGAGGAGGGAGGAAGG - Intronic
1079802118 11:24882606-24882628 CCGAAGGTTAAGAGGGAGGAAGG - Intronic
1079868714 11:25768096-25768118 AGGAAGGAAAAGAGGGAGGATGG + Intergenic
1080039504 11:27744508-27744530 ATGAATGAGAAATGGGAAGAGGG + Intergenic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1080310355 11:30883214-30883236 CTGAATGACAAGAGGAGAGAAGG + Intronic
1080714014 11:34780611-34780633 TTAAAGAAGAAGAGGAAAGATGG - Intergenic
1080720354 11:34842291-34842313 CTGAAGGAGAAGAAGGGTGTTGG + Intergenic
1080751615 11:35155826-35155848 GTGCAGTAGAAAAGGGAAGACGG - Intronic
1080981743 11:37415748-37415770 CTTCAGTAGAAGAGGGAATAGGG + Intergenic
1081387757 11:42492288-42492310 CTGAAGGAGTACAGGGAAGACGG - Intergenic
1081607418 11:44536093-44536115 ATGATGCAGAAGAGGGAGGAGGG + Intergenic
1081758290 11:45559959-45559981 GTGAAGGAAGAGATGGAAGAAGG - Intergenic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1081997856 11:47376624-47376646 AAGAAGGAGGACAGGGAAGAGGG - Intronic
1082728118 11:56761371-56761393 CAGAAGGAGAAGAGAGTAGATGG - Intergenic
1082731565 11:56804380-56804402 ATGAAAGAGAAGGGAGAAGAAGG + Intergenic
1082777624 11:57259656-57259678 CAAAGGGAGAAGTGGGAAGAGGG - Intergenic
1082910486 11:58368289-58368311 CTAAAGGCGAAGGAGGAAGATGG - Intergenic
1082976502 11:59077421-59077443 TTGAAGAAGAAAAGGGAAGTGGG - Intergenic
1084360402 11:68665222-68665244 CGGGAGGAGATGAGGGAAGAGGG + Intergenic
1084475660 11:69387199-69387221 CTGACCGAGCAGAGGGAGGAAGG - Intergenic
1084665204 11:70572545-70572567 CTAAGGGAGGAGAGAGAAGAGGG + Intronic
1085153021 11:74267319-74267341 CTGGGAGAGAACAGGGAAGAAGG + Intronic
1085186229 11:74578365-74578387 CTGAAGAGGAAGGTGGAAGAAGG + Intronic
1085322575 11:75583803-75583825 AAGAAGGAGAGGAGGGAGGAGGG + Intergenic
1085420485 11:76354142-76354164 CTAAGGTAGAAGAGGGAAGCAGG + Intronic
1085547349 11:77332321-77332343 AGGAAGGGGGAGAGGGAAGAGGG + Intronic
1085675013 11:78508284-78508306 CGAAAGGAGAAGAGAGAAAAAGG + Intronic
1085807659 11:79651055-79651077 AGGAAGGAGAAGAAGGAAGATGG - Intergenic
1085807663 11:79651078-79651100 GAGAAGGAGAAGAAGGAAAAAGG - Intergenic
1085999637 11:81966442-81966464 CTGAACTTGAAGATGGAAGAAGG + Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086593702 11:88545551-88545573 CTCAAGGAGAAGAGGTTTGAAGG - Intronic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1086890025 11:92246554-92246576 GAGGAGGAGAAGAAGGAAGAAGG + Intergenic
1086918339 11:92557140-92557162 CAGAAGGTGAAGATGGAGGAGGG - Intronic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1087417016 11:97870293-97870315 CTAAAGGACAATAGGGAGGAAGG - Intergenic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1088041543 11:105390256-105390278 GTGAAAAAGAAAAGGGAAGATGG + Intergenic
1088288402 11:108210457-108210479 CAGAAGGTGAAGGGGGAAGCTGG - Intronic
1088615475 11:111623000-111623022 CTGAAGGAGAAGAGAGGGGGTGG - Intronic
1088702332 11:112424559-112424581 CTGAAAGAGAAGTGGGAAAAAGG + Intergenic
1088793208 11:113244940-113244962 CTGAGGGAGAAGGGCAAAGAAGG - Intronic
1088935807 11:114399544-114399566 GTGAAGGGGGAGATGGAAGATGG + Intronic
1089119311 11:116122358-116122380 CTGGAGGAGAAAGGGGAAGACGG + Intergenic
1089283609 11:117391712-117391734 CTGGAGTAGAAGAGGGAGTATGG - Intronic
1089523503 11:119081436-119081458 CTGCAGGAGAAGAGGAGGGAAGG - Intronic
1089590304 11:119536026-119536048 GAGCAGGAGAAGAGAGAAGAGGG + Intergenic
1089715859 11:120358442-120358464 CTGACTGATAAGATGGAAGATGG + Intronic
1089822310 11:121239757-121239779 CTGAATGAGAAGATGCAACAAGG + Intergenic
1089842662 11:121431797-121431819 CAGAAGGAGAAGAGGTTAAAAGG - Intergenic
1089999024 11:122937720-122937742 ACGAAGGAGAAGAGTGAAGAGGG - Intronic
1090204083 11:124875359-124875381 TGGATGGACAAGAGGGAAGAAGG + Intronic
1090287219 11:125510333-125510355 CTAAGGGAAAAGAGGGAAGGAGG + Intergenic
1090402341 11:126456760-126456782 AGGAAGGAGAGGTGGGAAGAGGG + Intronic
1090430908 11:126645630-126645652 CTGAAGAAGAAAAGGTAAGAAGG + Intronic
1090441574 11:126729096-126729118 CTGCTAGAGATGAGGGAAGATGG - Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090640742 11:128726903-128726925 CTGAAGGAGGGGAGGGACAACGG + Intronic
1090878086 11:130808978-130809000 GGGAAGGAGAATTGGGAAGAAGG + Intergenic
1090964407 11:131585440-131585462 CTGCAGGAAAGGAGGGTAGAGGG + Intronic
1091053400 11:132395718-132395740 CTGGAAGAGAAGAGAGATGATGG + Intergenic
1091112192 11:132979841-132979863 CTGATGGAGAAGAAGGCAGGGGG + Intronic
1091191722 11:133701277-133701299 TTGAAGGAGAAGAGGGAAAGAGG - Intergenic
1091192931 11:133709247-133709269 CTGAAGGTGGGGAGGGGAGAGGG - Intergenic
1091490266 12:926579-926601 CAGAAGGTGAAGAGGGAACGTGG - Intronic
1091528294 12:1328656-1328678 CTGAGGGAGAAAAGGGGAGGGGG - Intronic
1091528473 12:1330616-1330638 GGGAAGGGGAAGAGAGAAGAAGG - Intronic
1091751324 12:3022856-3022878 CTGAAGGGGAGTGGGGAAGAGGG - Intronic
1091841653 12:3625701-3625723 CTGACGGAGATGGGGGATGAGGG + Intronic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1092231515 12:6778189-6778211 CGGAAGGAGGAGAAGGATGAAGG - Intronic
1092534887 12:9378631-9378653 CTGATGGAGAATGGGGGAGATGG - Intergenic
1092884781 12:12915605-12915627 GAGAAGGAGGAGAAGGAAGAAGG - Exonic
1092984301 12:13830788-13830810 CTGCAAGAGAAGAGGAAATAAGG + Intronic
1093348754 12:18071065-18071087 CTGAATGCGAAGATGGAACAAGG + Intergenic
1093492552 12:19721823-19721845 GGGAAGAAGAAGAGGGAAGAAGG - Intergenic
1093563588 12:20574691-20574713 CTGAAGGATCAGAGAAAAGAAGG - Intronic
1093602529 12:21046295-21046317 GAGAAGGAGAAGAAGCAAGAAGG - Intronic
1093743720 12:22716067-22716089 AGGAAGGAGCAGAGGGATGAAGG + Intergenic
1094098506 12:26735471-26735493 GGGAAGGAGAAGAGAGGAGAGGG + Intronic
1094123831 12:27001621-27001643 TTGAAGGAAAAGAGAGAGGATGG - Intronic
1094129869 12:27063317-27063339 GAGAAGGAGAAGAAAGAAGAAGG - Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094309499 12:29063176-29063198 CTGAAGGAGAAGAACAAAGTTGG - Intergenic
1094459530 12:30679542-30679564 GGGAAAGAGAAGAGGGAAGGAGG - Intronic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1095335006 12:41013254-41013276 CTGAGAAAGAAAAGGGAAGATGG + Intronic
1095484636 12:42672426-42672448 ATGAAAGAGAAAAGGGAAGGGGG + Intergenic
1095636066 12:44435063-44435085 CAGAAGGTGAAGAGGGGAGCAGG - Intergenic
1095879329 12:47115544-47115566 GGGAAGGAGAAGAGGGAGGAGGG - Intronic
1095943652 12:47741405-47741427 CCCAGGGAGAAGAGGGAGGAGGG - Intronic
1096590530 12:52655982-52656004 CAGAAGCAGAAGAGGAGAGAGGG + Intergenic
1096661787 12:53129902-53129924 TGGTAGGAGGAGAGGGAAGAGGG - Intergenic
1096785218 12:54013384-54013406 CTGAAGGAGAGGAGAAAGGAAGG + Intronic
1096896522 12:54826243-54826265 CTCACAGTGAAGAGGGAAGAGGG - Intergenic
1097119577 12:56721040-56721062 CTGAAGGAGGTGAAGTAAGAAGG + Exonic
1097156278 12:57014520-57014542 CTCAAGGAGAAGGGGTAGGATGG + Intronic
1097259524 12:57709097-57709119 CTGAAAGAAAAGAGTAAAGAAGG - Intronic
1098061972 12:66572592-66572614 CTGAAGGAGGAGGGGGCAGTTGG + Intronic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1098167784 12:67715809-67715831 GTGATGGCAAAGAGGGAAGAGGG + Intergenic
1098341939 12:69460680-69460702 ATGAAGGAGAAGAGAAAGGATGG + Intergenic
1098827132 12:75310503-75310525 CTAGAGGAGAATAGGTAAGAGGG + Intronic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099170215 12:79355138-79355160 CTGAACGAGAAGGGGACAGACGG - Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100226097 12:92557291-92557313 CTTGAGGAGATGAGCGAAGAAGG + Intergenic
1100452406 12:94720061-94720083 AGGAAGGGGAAGTGGGAAGATGG + Intergenic
1100549366 12:95632814-95632836 CTGAAGGAAATTAGGGGAGAGGG - Intergenic
1100550727 12:95644333-95644355 AGGAAGGAGAAGAAGGAGGAAGG - Intergenic
1100591707 12:96035793-96035815 CTGAAGAAGAGGAGGGGAGTAGG + Intronic
1100642664 12:96497334-96497356 TTGAAGGAGAAGAAGAAAGTTGG + Intronic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1100936264 12:99670782-99670804 CTGACAGAGAAAAGGGGAGATGG + Intronic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101410998 12:104468231-104468253 TTGAAGGAGATGAGGGTAGATGG + Intronic
1101483479 12:105127106-105127128 CTGAAACAGAAAAGGGAAAAGGG - Intronic
1101584433 12:106072665-106072687 GGGAGGGAGAAGAGGGAGGAAGG - Intronic
1101860947 12:108481973-108481995 CCCAAGGAGAAGAGGGAGGTGGG + Intergenic
1102047673 12:109840007-109840029 ATGATGGGGAGGAGGGAAGAGGG - Intergenic
1102669209 12:114602685-114602707 AGGAAGGAGAAAAGGAAAGAGGG + Intergenic
1102763186 12:115407474-115407496 GTGGAGGAGAAGAGGCATGAGGG + Intergenic
1102900057 12:116629412-116629434 CAGAAGGAGAGGAGAGAAGGCGG + Intergenic
1103024282 12:117560870-117560892 CAGAAGGAGAAGGGGGAGCAGGG - Intronic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103195779 12:119042655-119042677 AGAAAGGAGAAGAGGAAAGAAGG + Intronic
1103500396 12:121397318-121397340 CTGAAGGAGGAGGGGGGAAATGG - Intronic
1103615489 12:122149116-122149138 CTGAAGGAAAAGAGTGGAGATGG - Intergenic
1103682032 12:122701840-122701862 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103683780 12:122715301-122715323 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103941423 12:124503339-124503361 TGGAGGGAGAAGATGGAAGAGGG + Intronic
1104325705 12:127795064-127795086 CTGGAGGAGAAGAGCATAGAAGG - Intergenic
1104577328 12:129979873-129979895 CTGGAGGATGAAAGGGAAGAGGG + Intergenic
1104715429 12:131013082-131013104 CTGAAGGGCAAGATTGAAGAAGG - Intronic
1105662157 13:22508426-22508448 CTGGAGGAAAAATGGGAAGAAGG - Intergenic
1105744563 13:23364728-23364750 TTGAAGGAGAGGAGAGAACAAGG - Intronic
1105968401 13:25405197-25405219 CAGAAGGAGAAGAGGAGGGAAGG + Intronic
1106241502 13:27917196-27917218 GTGAAGGGAAAGGGGGAAGAGGG + Intergenic
1106406652 13:29480509-29480531 CTGGAGGAGAAGAGAGGAGCGGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106752174 13:32785888-32785910 CTGAAGAAGAATAGAGAAAATGG - Intergenic
1106777181 13:33019767-33019789 GAGAAGGAGAAGAGGGGAGAGGG + Intronic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1107117050 13:36758208-36758230 CTGATGGATATCAGGGAAGATGG + Intergenic
1107117478 13:36762532-36762554 CTGACAAAGAAAAGGGAAGATGG + Intergenic
1107563444 13:41578137-41578159 AAGAAAGGGAAGAGGGAAGAAGG - Intronic
1107667003 13:42700765-42700787 AAGAAGGAAAAGAGGAAAGAAGG + Intergenic
1107838959 13:44436096-44436118 CTGAAAAAGAGGAGGGAAAAAGG + Intronic
1108591895 13:51919929-51919951 ATGAAGGAGAAAAGGAAGGAAGG + Intergenic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1109017444 13:57036082-57036104 CTGAATTAGAACAGGGAAAAGGG + Intergenic
1109260422 13:60138780-60138802 AAGAAGGGGAAGAGGGAAGAGGG + Intronic
1109576879 13:64271214-64271236 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1109842741 13:67941216-67941238 CAGAAGGAGAAAAGGAAAGAAGG + Intergenic
1109971743 13:69779396-69779418 GGGAAGGAAAGGAGGGAAGAGGG - Intronic
1110036544 13:70693163-70693185 CTGAAGGAGAAGCTGGGAGCTGG + Intergenic
1110642569 13:77842493-77842515 CAGAAGGCGAAGGGGGAACAAGG - Intergenic
1111424426 13:88060547-88060569 CAGAAGAAGAAAATGGAAGAGGG - Intergenic
1111647701 13:91051449-91051471 GTGAAGGAAAGCAGGGAAGAGGG - Intergenic
1111689733 13:91548654-91548676 TTGAAGGAGAAGAACGAAGTTGG + Intronic
1111804286 13:93020313-93020335 CTGCAGGAGAAGCTGGGAGAAGG + Intergenic
1111806388 13:93043979-93044001 CTGAATGCGAAGACGGAACAAGG + Intergenic
1112171823 13:96980590-96980612 CATAAGAAGAAGAGTGAAGATGG + Intergenic
1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG + Intergenic
1112265572 13:97920352-97920374 TCGGGGGAGAAGAGGGAAGATGG - Intergenic
1112331111 13:98477711-98477733 GTGAAGGAGGAGATGGGAGATGG - Intronic
1112537436 13:100273921-100273943 ATGAAAGAAAAAAGGGAAGAAGG - Intronic
1112541495 13:100318043-100318065 AGGAAGGGCAAGAGGGAAGATGG - Intronic
1112626569 13:101111459-101111481 CAGAAGGAGGAGGGGCAAGAGGG - Intronic
1112769172 13:102776775-102776797 CTGGCTGAGAAGATGGAAGAGGG + Intergenic
1113043038 13:106125274-106125296 CTGGAGGGGAAGGAGGAAGAAGG - Intergenic
1113222776 13:108124244-108124266 CTGACAAAGAGGAGGGAAGATGG - Intergenic
1113748187 13:112760621-112760643 CTGAGCAAGAAGAGGGAACAGGG - Intronic
1114260112 14:21030514-21030536 GTGAAGGAGAAGGGGGAGGGAGG - Exonic
1114695942 14:24627853-24627875 CTGGAGGAAAAGAGGGATGGTGG + Intergenic
1114761985 14:25326151-25326173 CTGAAGGAGAGCAGGAAAAAAGG - Intergenic
1114832131 14:26157309-26157331 CAGAAGGAGAAGAGAGATGAAGG - Intergenic
1115450613 14:33543133-33543155 CAGAAAGAGATGAGGGAAGGAGG - Intronic
1115492322 14:33969355-33969377 CTTAAGGAGAACAGGGTGGAGGG + Intronic
1115945736 14:38658097-38658119 CTGAAAGAGAAAAGGGAAAGTGG - Intergenic
1116752882 14:48909102-48909124 CTGAAGGAGGGGAAGAAAGAAGG - Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1117089527 14:52236134-52236156 CTGAAGGAGATGGGGAAGGAAGG + Intergenic
1117128095 14:52653224-52653246 CTGAAGGAGAAGGTCCAAGAAGG - Exonic
1117225023 14:53648350-53648372 CAGAAGGAGAAGAGAGAGAATGG + Intergenic
1117272367 14:54158024-54158046 CTGAAGGAGAAGAGAAGAAATGG - Intergenic
1117628491 14:57665058-57665080 GGAAAGGAGAAGATGGAAGAGGG - Intronic
1117774523 14:59169087-59169109 ATGAAGGAGAAGAATGAAGTTGG + Intergenic
1118157292 14:63254628-63254650 GTCAAGGAGAAGAGAGAAGCGGG + Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119409617 14:74422245-74422267 AGGAAGGAGAAGAGAGAATAAGG + Intronic
1119526999 14:75330746-75330768 GTGCAGGAGAAGAGGGGTGAAGG + Intergenic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119633747 14:76257162-76257184 CTGAAGGAGAAAAGGAAAACTGG - Intergenic
1119729097 14:76939874-76939896 CTGAAGGAAAAGTGAGAGGATGG + Intergenic
1119922209 14:78456966-78456988 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1119946747 14:78703323-78703345 CTGAGGGAGAGAAGGGAAGTGGG + Intronic
1120388359 14:83874009-83874031 CAGAAGGAGCAGACGGGAGAAGG + Intergenic
1120648558 14:87102703-87102725 AAGAAGGGCAAGAGGGAAGAGGG - Intergenic
1120757407 14:88257181-88257203 AGGAAGGAGAAACGGGAAGAAGG - Intronic
1121076458 14:91073052-91073074 TAGAAGGATAAGATGGAAGATGG + Intronic
1121090165 14:91175777-91175799 GTGAAGGAGAATAGGGATTAAGG - Intronic
1121120553 14:91373194-91373216 CAGAGGGAGAAGAGAGAAGGTGG - Intronic
1121431026 14:93888602-93888624 CTGAAGGGCAAGGAGGAAGAGGG + Intergenic
1121553909 14:94822114-94822136 CCGAAGCTGTAGAGGGAAGATGG + Intergenic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1121777023 14:96597983-96598005 AGGAAGGAGAAGAGGGGAGGAGG - Intergenic
1121777036 14:96598023-96598045 AGGGAGGAGAAGGGGGAAGATGG - Intergenic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1122319436 14:100845039-100845061 CTGGAGGAGACCAGGGAAGCGGG - Intergenic
1122320719 14:100854002-100854024 CTGATGGATAAGAGGGTGGAAGG + Intergenic
1122392799 14:101401846-101401868 ACGAAGAAGAAGAGGGAAGAGGG - Intergenic
1122407779 14:101510423-101510445 CTGAAACAAGAGAGGGAAGAGGG + Intergenic
1123510417 15:20993024-20993046 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123567632 15:21566773-21566795 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123603891 15:22004066-22004088 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123792337 15:23734330-23734352 AAGAAGGAGAAGAAAGAAGAAGG + Intergenic
1123952096 15:25289254-25289276 ATAAAGGAGAAGAGAGAAAAGGG + Intergenic
1124035610 15:26051267-26051289 CTGAAAGGGAACAGGGAGGAAGG + Intergenic
1124211936 15:27770829-27770851 AGGAAGGAAAAGAGGGAGGAAGG - Intronic
1124330023 15:28803486-28803508 CTGAAGAAGAGGAGGAAGGAGGG + Intergenic
1124442135 15:29693736-29693758 CAGAAGGAAAAGAGAGAAAAGGG + Intergenic
1124475457 15:30029398-30029420 GGGAAGGAGGAGAGGGAAGATGG - Intergenic
1125069297 15:35532761-35532783 AGGAAGGAAAAAAGGGAAGAAGG + Intronic
1125204072 15:37131334-37131356 ATGCAGGAAAAGAGGGAAGAGGG + Intergenic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125384607 15:39124042-39124064 CAGAAGTAGAAGTGGGAATAAGG + Intergenic
1125388295 15:39163119-39163141 CTGAAGGAGTAGAGAGAAAGAGG - Intergenic
1125397102 15:39261025-39261047 GAGAAGGAGAGGAGAGAAGAAGG + Intergenic
1125413592 15:39429945-39429967 CTCAAGGATAAGAGGTAGGAAGG - Intergenic
1125886782 15:43235315-43235337 GGGAAGGAGAAGAGGGAAGGAGG + Intronic
1126052096 15:44695386-44695408 CTGACAAAGAAAAGGGAAGATGG - Intronic
1126375634 15:47994170-47994192 AAGAAGGAGAAGGAGGAAGACGG + Intergenic
1126385940 15:48093479-48093501 CTGAGGAAGATGAGGGAAGGGGG - Intergenic
1126402001 15:48281540-48281562 CTGAAGGAGAAGAGAGAAGAGGG + Intronic
1126409934 15:48362784-48362806 CTGATGGGGAAGAGGCATGAGGG - Intergenic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1126697342 15:51337733-51337755 ATAGAGGAGAAGAGGAAAGAGGG + Intronic
1126781953 15:52146391-52146413 CTCCAGGAGAATAGGGAATAAGG + Intronic
1127150568 15:56070673-56070695 TTGAAGGAGAAGAACAAAGATGG + Intergenic
1127636262 15:60873000-60873022 AAGAAGGAGAAGAGGAAAGAGGG - Intronic
1127859418 15:62980742-62980764 CTGAAGGAGAACAGAGGATAAGG - Intergenic
1128056408 15:64702978-64703000 CTGGAGCAGATGAGGGAGGATGG + Intronic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128095660 15:64952740-64952762 GAGGAGGAGAAGAGGAAAGAAGG - Intronic
1128095812 15:64954524-64954546 AAGAAGGAGAAGGAGGAAGAAGG - Intronic
1128220540 15:65965253-65965275 CTGGAGGAGGAGAGAGAAAAGGG - Intronic
1128599038 15:68979932-68979954 CTGAAGTAGCAGAGGCCAGATGG - Intronic
1128705555 15:69835276-69835298 CTGAAGGTGAAGTGCAAAGATGG + Intergenic
1128919058 15:71593980-71594002 CTGATGAGAAAGAGGGAAGAGGG + Intronic
1129011357 15:72420771-72420793 CTGAAGCAGAATGAGGAAGAGGG - Intergenic
1129084865 15:73078279-73078301 CTGCAGGAGAAGCAGGGAGAAGG + Intronic
1129333979 15:74841698-74841720 GTGAAGGGGCAGAGGGAAGGAGG - Intronic
1129360067 15:75019072-75019094 GGGAAGGAGAAAAGGGAAGGGGG - Exonic
1129463001 15:75709368-75709390 GTGAAGGAGCAGAGGGACCAGGG + Intronic
1129647271 15:77448182-77448204 ATGAAGGTGGAGAGGGAAAAGGG - Intronic
1129698482 15:77754194-77754216 AGGATGGAAAAGAGGGAAGAAGG + Intronic
1129721878 15:77882033-77882055 ATGAAGGAGCAGAGGGACCAGGG - Intergenic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1129917761 15:79289430-79289452 CTGAAGGGGAAGAGTTAAAATGG + Intergenic
1129930610 15:79407507-79407529 CTGGAGGCAATGAGGGAAGACGG + Intronic
1129944280 15:79525494-79525516 AGGAAGGAGATGAAGGAAGAAGG + Intergenic
1130131105 15:81143362-81143384 CTGAAGGGGAACAGGGGACAGGG + Intronic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130552280 15:84897779-84897801 CTGAAGGGGAGGAGGGAGGCGGG - Intronic
1131351193 15:91701424-91701446 ATGAAGGAGGAGAGGAAGGAAGG + Intergenic
1131472408 15:92708607-92708629 TTGAAGTTGAAGAGGGAAGCAGG - Intronic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1131663164 15:94540557-94540579 CTGAAGGATAAGAGGAACCAGGG + Intergenic
1131728597 15:95254575-95254597 GGGAAGGATAAGAAGGAAGAGGG - Intergenic
1131797175 15:96030991-96031013 GTGAAGGAGAAGATGGAAACAGG + Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1131955463 15:97730533-97730555 CTGAAGGAGAAGCAAGAAGAAGG + Intergenic
1131994237 15:98119095-98119117 CTGAAGGACAAGACAGAAGGTGG + Intergenic
1202975995 15_KI270727v1_random:293868-293890 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1132628837 16:906429-906451 AAAAAGGAGAAGAGGGGAGACGG + Intronic
1133313967 16:4870670-4870692 CGGGAGGGGAAGAGGCAAGACGG - Intronic
1133435417 16:5775306-5775328 CTTGAAGGGAAGAGGGAAGAGGG - Intergenic
1133469253 16:6058325-6058347 AGGAAGGAGAGGAGGGAGGAAGG - Intronic
1133641324 16:7719942-7719964 CTAAAGGAGGAGAGGGAAGGAGG + Intergenic
1133844713 16:9443222-9443244 AGGAAGGAGAGGAGGGAAGCAGG + Intergenic
1134054412 16:11160509-11160531 CTGAAGGGAAAGAGGGAAAGGGG - Intronic
1134209004 16:12260366-12260388 ATGAAGGATGAGAAGGAAGACGG - Intronic
1134212473 16:12289304-12289326 CCAAGGGAGAGGAGGGAAGAAGG - Intronic
1134410342 16:13998684-13998706 AAGAAGAGGAAGAGGGAAGAAGG + Intergenic
1134615868 16:15650612-15650634 CGGAAGGAGAAGAGGGCAACGGG - Intronic
1134857995 16:17536784-17536806 CTGAATGAGAAGAGGGAGCCAGG + Intergenic
1135880519 16:26251259-26251281 CTGAGGGAGCAGAGAAAAGAAGG - Intergenic
1135910890 16:26559611-26559633 CTGAGGGGGGATAGGGAAGAGGG - Intergenic
1136074847 16:27809930-27809952 CTGGAGGAGAAGATGGGGGAAGG + Intronic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136477303 16:30521513-30521535 CTGAAGGAGAAGATGGAGGCTGG + Exonic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136491884 16:30613936-30613958 AGGAAGGAGAAGAAAGAAGAAGG + Intronic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136539106 16:30918740-30918762 AGGAAGGAGAAGAAGGAAGGAGG - Intergenic
1136624500 16:31453734-31453756 CTGGGGGAGAAGAAGGAAAACGG + Intergenic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137362779 16:47834860-47834882 CAGAAGGAGAAGAGAGAAAAAGG + Intergenic
1137406888 16:48196279-48196301 CAGGAGGAGGAGATGGAAGAAGG - Exonic
1137710354 16:50562715-50562737 CTGAAGGAAAGGAGAGAGGAGGG + Intronic
1137975878 16:53031581-53031603 CTGCAGGAGAGGAGAGAGGAAGG + Intergenic
1138053797 16:53811515-53811537 CTGACAGTGAAGAGGAAAGATGG - Intronic
1138094647 16:54202313-54202335 CTGTAGGATGAGAGAGAAGAGGG - Intergenic
1138491722 16:57381029-57381051 ATGAAGGGGAAGAAGGAAGTTGG + Intronic
1138591866 16:58004390-58004412 CTGAAGGAGAAGAACAAAGTTGG - Intronic
1138768416 16:59632040-59632062 CAGAGGGAGAAGTGGGGAGAGGG + Intergenic
1138945956 16:61850192-61850214 CAGAAGGTGAAGAGGGAGCAAGG + Intronic
1139165569 16:64561394-64561416 GAGAAGGAGAAGAAGAAAGAAGG + Intergenic
1139329380 16:66175695-66175717 CTGGGGGAGAAGAGGGAGGCCGG + Intergenic
1139553001 16:67686346-67686368 CTGAAGGATAAGAGGAAAAACGG + Intronic
1139661068 16:68421231-68421253 GTGAAGCAGATGAGGGAGGATGG - Intronic
1139747244 16:69084443-69084465 CTGAAGGAGCAGAGGACAGAAGG - Exonic
1139792488 16:69450829-69450851 AAGAAGGAGAAGAAGGAAAATGG - Intronic
1139970752 16:70773063-70773085 CTGGAGGAGACGGGGGAATAGGG + Intronic
1139984229 16:70884255-70884277 CTCCAGGAGGAGAGGAAAGAGGG - Intronic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140294301 16:73693558-73693580 ATGAAGGATAAGAGGAAAGTTGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140622404 16:76751436-76751458 CAGAAGGAGAAGGGGCAGGAGGG + Intergenic
1140673500 16:77303145-77303167 CTGGTGGAGATGAGGGGAGATGG - Intronic
1140781445 16:78300517-78300539 GGGAAAGAGAAGAGGGGAGAAGG - Intronic
1140943608 16:79747090-79747112 GAGAAGGAGACGAGGGAAGAGGG + Intergenic
1141145726 16:81528899-81528921 CTGAAGGAGAGGAGAAAGGAAGG - Intronic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141439852 16:84023052-84023074 AGGAAGGAGAAAAGGAAAGAGGG - Intronic
1141713913 16:85716281-85716303 GGGAAGGAGGAGAGGGAAGGAGG + Intronic
1142312453 16:89321862-89321884 CTGAAGAGGAAGAGGAGAGATGG - Intronic
1142399895 16:89853026-89853048 CTGAGAGAGAGGACGGAAGATGG - Intronic
1142421022 16:89970182-89970204 GGGGAGGAGGAGAGGGAAGATGG - Exonic
1142694031 17:1623594-1623616 CTGGAGGAGAGGAGAGAAGTGGG - Intronic
1143119131 17:4596470-4596492 CAGAAGGAGGAGTGGGAGGAAGG + Intronic
1143445761 17:7008248-7008270 CTGAAAGAGAACAGGGGGGAGGG - Intronic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1143550885 17:7629883-7629905 CTAGAGGAGGAGAGGGGAGATGG + Intronic
1143766774 17:9143060-9143082 CTGGAGGTGATGAGGGATGAAGG + Intronic
1143936389 17:10489695-10489717 CAGAAGGAGAAGAGAGAAAAAGG - Intergenic
1143968355 17:10773728-10773750 CTGAAGGAGTGAAGGTAAGATGG - Intergenic
1144690438 17:17258966-17258988 CCTAAGGAGAAGAGGAAGGAAGG - Intronic
1144798080 17:17906050-17906072 TTGAAGGAGATGAGGGAGTAGGG - Intronic
1145978302 17:28996900-28996922 CTGAAAGAGACAAGGGAGGAGGG - Intronic
1145979387 17:29002861-29002883 CTGGAGGAGAAAAGAGAGGAAGG - Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146896811 17:36547982-36548004 GAGAAGGGGAAAAGGGAAGAGGG + Intronic
1146916036 17:36679098-36679120 CTGAAGGTCACGTGGGAAGACGG + Intergenic
1147186386 17:38715589-38715611 CTGAAGGAGAGGAGAGAGGAAGG - Intronic
1147356926 17:39905651-39905673 CTGCAGGCCAAGAGGGAAGCAGG - Intronic
1147773679 17:42885421-42885443 CTATAGGAGAGGAGGGAAGGAGG - Intergenic
1148102190 17:45099047-45099069 CAGAAGGGGAGGAGGGAGGAGGG + Intronic
1148182951 17:45620216-45620238 CAGAAGGGGAAGAGGGATGCAGG - Intergenic
1148192608 17:45690134-45690156 CTGAAGGGGAAGGAGGAGGAAGG + Intergenic
1148259981 17:46173211-46173233 TTGAGAGAGAAGAGGGCAGAAGG - Intronic
1148373474 17:47120183-47120205 CTCAAAGAGAAGAGGCAATATGG + Intronic
1148477822 17:47940961-47940983 CTGAATGGGAAGGGGGAAGAAGG - Intergenic
1148533145 17:48414697-48414719 CTGAAGGACAAGGGAAAAGAGGG + Intronic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1148997475 17:51723801-51723823 CAGATGGAAAAGAGGGCAGAGGG - Intronic
1149107116 17:52982691-52982713 AGGAAGAGGAAGAGGGAAGAAGG - Intergenic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1149383840 17:56122593-56122615 CTGAAGCAGAAGAAGGGAGTAGG - Intronic
1149394080 17:56221074-56221096 CAGAAGGTGAAGGGGGAAGCAGG + Intronic
1149432510 17:56605636-56605658 CTGAGGGCGAGGATGGAAGATGG - Intergenic
1149541585 17:57471863-57471885 CTGGAGGAGAGGAGAGGAGAGGG + Intronic
1149633702 17:58148888-58148910 AGGCAGGAGAAGGGGGAAGATGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1149987861 17:61361734-61361756 CTGAAGGTGAAGAACCAAGAAGG + Intronic
1150277601 17:63909976-63909998 CTGAAGGGGAAGGAGGAAAATGG - Intronic
1150373559 17:64662068-64662090 AGGAAGGAGAAGTGGGAGGAGGG - Exonic
1150612472 17:66744965-66744987 TTGTAGGAGAAGAGGGAGGCTGG - Intronic
1150627736 17:66852966-66852988 GAGAAGGAGAAGAGAGAAGGAGG - Intronic
1150639840 17:66942179-66942201 CGAAAGCAGGAGAGGGAAGAGGG - Intergenic
1150712840 17:67546451-67546473 CTACAGGAGCACAGGGAAGAGGG - Intronic
1150772027 17:68050365-68050387 CAGAAAGAGAAGAAGGAAGGAGG - Intergenic
1150829455 17:68506216-68506238 CCTAAGGATAAGATGGAAGATGG - Intergenic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151125388 17:71839226-71839248 CTGAGAGAGATGAAGGAAGATGG - Intergenic
1151284346 17:73099174-73099196 CTGCAGGACAAGAGGGTGGATGG + Intergenic
1151288809 17:73133580-73133602 CTGATGGAGAAGAGGCTGGAGGG - Intergenic
1151376352 17:73691488-73691510 CTGTAGGAGAAGGGGGAAGCTGG - Intergenic
1151396739 17:73827709-73827731 CTGAAGGCGAGGAGGGACGCAGG + Intergenic
1151418484 17:73982292-73982314 CTCAAGGAGAAGAGGGAGCAAGG + Intergenic
1151722391 17:75864807-75864829 CTGGAGGAGAGGAGGGACCAGGG + Intergenic
1151740945 17:75981615-75981637 CTGAGGGAGAGGAGGACAGAAGG - Intronic
1151825028 17:76519316-76519338 CTGAGGGAGAAGGGGGACTAGGG - Intergenic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152302230 17:79501843-79501865 GAGAAAGAGAAGAGGGAAAACGG + Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152930543 17:83107518-83107540 CAGAAGGAGAAGGGGACAGAGGG - Intergenic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153709722 18:7785165-7785187 GTGAAGGATATGAAGGAAGAGGG + Intronic
1153733786 18:8043662-8043684 AGGAAGCAGGAGAGGGAAGAGGG - Intronic
1153822182 18:8841605-8841627 CTGAAGCAGAAAAAGGAATATGG - Intergenic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1154236785 18:12613459-12613481 CTAAAGGAGCAGAGAGAAGAAGG - Intronic
1154321021 18:13352674-13352696 CAGAAGGAGAAGAGAGAAAGAGG - Intronic
1155724433 18:29062004-29062026 CAGAAAGAGAAGAGTGAAGAAGG - Intergenic
1156731790 18:40203256-40203278 ATGAAAGAGAAGAGGGAGAATGG + Intergenic
1156803123 18:41142881-41142903 CTGATGGAGAATAGAAAAGAAGG - Intergenic
1156862091 18:41849194-41849216 GGGAAGAAGAAGAGGGAGGAGGG + Intergenic
1156906161 18:42354623-42354645 CTGAAGGAAAACAGAGTAGAAGG - Intergenic
1157085196 18:44573400-44573422 AGGAAGGGGAAGAAGGAAGACGG + Intergenic
1157239837 18:45998636-45998658 CTGAAGGGAAAAAGGGAGGAAGG - Intronic
1157241471 18:46014005-46014027 CTGAAGGAGAGGAGTAAAGAAGG + Intronic
1157317473 18:46604232-46604254 GGGAAGGAGAAGAGGGGACAAGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157332579 18:46714444-46714466 AAGAAGGAGAAGAGGGAGAATGG + Intronic
1157406268 18:47424736-47424758 GAGAAGGAGAAGAAGGGAGAAGG - Intergenic
1157788482 18:50508022-50508044 CAGAAGGACAAGAGTGAAGCTGG - Intergenic
1157856608 18:51110407-51110429 AGGAGGGAGGAGAGGGAAGAGGG + Intergenic
1158058733 18:53313027-53313049 AAGAAGGAGGAAAGGGAAGAAGG + Intronic
1158716783 18:59887690-59887712 CTGAAGGACATAATGGAAGAAGG - Intergenic
1158835882 18:61331729-61331751 GTGAAGGAGAAGGAGGAAGAGGG - Intergenic
1159305640 18:66638712-66638734 CAGAAGGTGAAGATGCAAGAGGG - Intergenic
1159504967 18:69324743-69324765 GAGGAGGAGAAGAGGGAACAAGG + Intergenic
1159548675 18:69872109-69872131 CTGAAGGAGAGGAGTGCAGATGG + Intronic
1159681133 18:71354052-71354074 CCAAAGGAGAAAAGGGAAAAAGG + Intergenic
1159977959 18:74739318-74739340 GTGAACGAGAAAAGGGAAAAGGG + Intronic
1160107704 18:75993991-75994013 CAGAAAGAGAGGAGGGAAAAGGG - Intergenic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160561322 18:79758345-79758367 CTGAAGGAGAAGAAAGAAGCTGG - Intergenic
1160576962 18:79861728-79861750 CTGAAAGGAAAGAGGGAACAGGG - Intergenic
1160950837 19:1666518-1666540 AATAAGGAGAAGAAGGAAGAAGG - Intergenic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1162038169 19:7953541-7953563 GGGAAGGAGGAGAGGGAGGAGGG - Intergenic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1163080531 19:14937809-14937831 CTAAAGGAGGCCAGGGAAGATGG + Intergenic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163222131 19:15929333-15929355 CTGAGAGAGAAGCAGGAAGAGGG + Intronic
1163263160 19:16203525-16203547 CTGATGGAGAAGGAGGAGGAGGG + Exonic
1163394709 19:17052967-17052989 CTGGAGGGGAAGAGGGATGGTGG + Intronic
1164004225 19:21134224-21134246 ATGCAGGTTAAGAGGGAAGAAGG + Intergenic
1164322958 19:24167204-24167226 CTGAATGAGAAGATGGAACGAGG - Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164718649 19:30415100-30415122 AAGAAGGAGAAGGAGGAAGAAGG - Intronic
1164718720 19:30415366-30415388 AAGAAGGAGAAGAAGGAAGAAGG - Intronic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165798833 19:38535331-38535353 CTTAAGGACAAGAAGGAAGTTGG + Exonic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1165895037 19:39136368-39136390 TGGCAGGAGAAGAGGGAAGCAGG - Intronic
1165963598 19:39555761-39555783 CAGAAGGAGAAAGGGCAAGAAGG - Intergenic
1166008624 19:39925126-39925148 AAGAAGAAGAAGAGGGAAGGGGG + Intronic
1166064751 19:40350935-40350957 TTGAAGGAGAAGAGAGAGTAGGG + Intronic
1166144087 19:40822400-40822422 CTGGAGGGGAAGGGGGAAGTGGG + Intronic
1166160507 19:40949231-40949253 CTGAAGGGGCTGAGGGAAGGGGG + Intergenic
1166169386 19:41016824-41016846 CTGAAGGGGCTGAGGGAAGGGGG + Exonic
1166273369 19:41732987-41733009 ATGAAGGAGCAGATGGATGAGGG - Intronic
1166299764 19:41907075-41907097 ATGTAGGAGAAGAGGGGAGACGG - Intronic
1166356234 19:42229202-42229224 CTGATGGATAAGGGGGAGGATGG - Intergenic
1166429418 19:42711665-42711687 TTGAAGGAGAAGATGGGTGAGGG + Intronic
1166450832 19:42899406-42899428 TTGAAGGAGAAGATGGGTGAGGG + Intronic
1166462738 19:43003751-43003773 TTGAAGGAGAAGATGGGTGAGGG + Intronic
1166468880 19:43060209-43060231 TTGAAGGAGAAGATGGGTGAGGG + Intronic
1166480026 19:43163730-43163752 TTGAAGGAGAAGATGGGTGAGGG + Intronic
1166489847 19:43249261-43249283 TTGAAGGAGAAGATGGGTGAGGG + Intronic
1166626547 19:44362219-44362241 ATGGAGGAGAAGGGGGAGGAAGG + Intronic
1166807788 19:45497245-45497267 CTTTAGGGGAAGAGGGAAGGAGG + Intronic
1166830802 19:45638679-45638701 CTGGAAGAGGAGAGGGAATAGGG - Intronic
1166901412 19:46066947-46066969 CTGAAGGAGAGGAGCTGAGATGG - Intronic
1167145117 19:47676615-47676637 CTGATGATGAAGAGGGAAGGCGG - Intronic
1167286655 19:48602221-48602243 AAGAAGGAGAGGAGGGAGGAGGG + Intronic
1167295557 19:48646893-48646915 GTGAAGGAGGAGGGGGAGGAGGG + Intergenic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167780601 19:51596365-51596387 CAGAATGAGAAGAGGGGTGATGG + Intergenic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
1168517069 19:57017533-57017555 CAGAGGGAGAAGGGGGATGAGGG - Intergenic
1168519399 19:57036519-57036541 CGTGAGGAGAGGAGGGAAGACGG + Intergenic
925553457 2:5101991-5102013 TAGAAGGAGAAGGGGGAGGAGGG + Intergenic
925632454 2:5908793-5908815 CTCAGGGAGAAGAGGGTGGAGGG + Intergenic
925680256 2:6413071-6413093 ATGAAGGAGAAAAGGAAGGAAGG + Intergenic
925777633 2:7350165-7350187 CTGAGGGAGATGAGGGACAAGGG + Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925882914 2:8368094-8368116 CTGAAAGAGAAGATGGATGAGGG - Intergenic
926119900 2:10236218-10236240 AGGATGGAGAAGAGGGAAGAGGG - Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926394847 2:12430403-12430425 AGGAAGGAGAAGAAGGAGGAAGG + Intergenic
926417660 2:12665651-12665673 CTGAAGTAGAGGAAGGAAGGTGG - Intergenic
926534358 2:14092511-14092533 CGGGAAGAAAAGAGGGAAGATGG + Intergenic
926618449 2:15022965-15022987 ATGTAGGTGAAGGGGGAAGATGG - Intergenic
927181631 2:20450621-20450643 CTCCAGGAGCAGAGGGGAGAGGG + Intergenic
927263306 2:21116742-21116764 CTGGAGGAGAGGAGTGAGGAGGG + Intergenic
927499648 2:23574161-23574183 TTGGAGGAGGAGAGGGAAGAAGG + Intronic
928093269 2:28389553-28389575 GGGAAGGGGAAGAGGGAAGCTGG - Intergenic
928373767 2:30759130-30759152 AGGAAGGGGAAGAGGGAGGAAGG - Intronic
928388002 2:30885790-30885812 CTGATGGTGAAGAGGGAAGTTGG + Intergenic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
928426608 2:31183779-31183801 AGGAAGGAAAGGAGGGAAGAAGG - Intronic
928538250 2:32260696-32260718 TTGAAAAAGAAAAGGGAAGATGG - Intronic
928910629 2:36417227-36417249 CAGTAGGGGAAGAGAGAAGAGGG - Intronic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929176133 2:38978339-38978361 CTGAAGGGAATGAGGCAAGAAGG - Intergenic
929391888 2:41478590-41478612 CTGTAGGATAGAAGGGAAGATGG - Intergenic
929446501 2:42005701-42005723 CTGGAAGAGATGATGGAAGAAGG + Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929667234 2:43842489-43842511 TTGAGGGAGAGGAGGTAAGAAGG - Intronic
929862969 2:45694959-45694981 CTGAAGGAGAAGGGAGAGGCAGG - Intronic
929884072 2:45863015-45863037 CTGGAGGAGAAGAGAGCAGTTGG + Intronic
930253828 2:49066152-49066174 TTGATGGGGAAGAGAGAAGAAGG + Intronic
930511389 2:52349727-52349749 GTGGAGGAGAGGAAGGAAGAAGG - Intergenic
930775355 2:55165350-55165372 ATGAAGAAGACGAGGAAAGAGGG + Intergenic
931000174 2:57770884-57770906 CTGAGGAAGGAAAGGGAAGAAGG - Intergenic
931201395 2:60100668-60100690 CAGAAGGAGGAGAGGGCACATGG + Intergenic
931565999 2:63616237-63616259 CTGAAGAATAAGAAGGGAGAGGG + Intronic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931831334 2:66054604-66054626 CAAAAGGAGAAAAGGGAAGCAGG - Intergenic
932049642 2:68385781-68385803 GTGAAGGAGGTGAGAGAAGAGGG - Intronic
932099264 2:68882017-68882039 CTGAAGGATCAAAGGGATGATGG + Intergenic
932374690 2:71225818-71225840 ATGAAGGTGAAAAGGGAACAGGG + Intronic
932504902 2:72219276-72219298 GGGAAGGAGGAGGGGGAAGAGGG + Intronic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
932735674 2:74252389-74252411 CTGGAAGAGAAGGGGGATGAAGG + Intronic
932759102 2:74427986-74428008 CTGAGGGAGAAGAGGGAGAGAGG + Intronic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933022255 2:77208488-77208510 CTGAGTGAGAAAAGGGAAGAAGG + Intronic
933493008 2:83012339-83012361 TTGAAGGAGAAGAAGAAAGTTGG + Intergenic
933563310 2:83917033-83917055 CTAAAGAAGGAGAGGGAATAGGG - Intergenic
933656712 2:84894531-84894553 TTGAAGCAGAAGAAGGAAGTGGG - Intronic
933837788 2:86259842-86259864 CTAGGGGAGAAGTGGGAAGAGGG + Intronic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934037381 2:88099797-88099819 AGGAAGGAGAAGGGGTAAGAAGG - Intronic
934056828 2:88258333-88258355 GAGAAGGAGAAGAGAGGAGAGGG - Intergenic
934078430 2:88447776-88447798 CTGAAGCAGTAGAGGGTAGTTGG - Exonic
934467972 2:94283487-94283509 AGGAAGAATAAGAGGGAAGAAGG - Intergenic
934908684 2:98229864-98229886 CTGATGCAGAAGAGTGGAGAGGG - Intronic
935073239 2:99714210-99714232 CTGAAGGAGAAGAGGTGAGGAGG - Intronic
935567199 2:104621297-104621319 CTGGGGGAGAACAGGGAAGCCGG - Intergenic
935847897 2:107187085-107187107 CTGAAGGAGGAGGAGGAAGCTGG + Intergenic
935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG + Intergenic
935924106 2:108048479-108048501 CTGAAGGGAAAGAGTGAAGGTGG - Intergenic
936655525 2:114481886-114481908 AAGAAGGAGAAGAGAGGAGAAGG + Intronic
936949299 2:117961755-117961777 CAGAAGGAGAAGAGGAAAAGGGG + Intronic
937246350 2:120496572-120496594 CCTAAGGATAAGAGGGAAGGGGG + Intergenic
937250250 2:120519348-120519370 ATGAAGGAGGAGAGGGAAGGAGG - Intergenic
937325225 2:120986255-120986277 CTGCAGGGGACGAGGCAAGAAGG - Intronic
937345967 2:121125485-121125507 GAGAAGGAGAAGAAGGAAGGAGG + Intergenic
937444079 2:121941914-121941936 GGAAAGGAAAAGAGGGAAGAAGG - Intergenic
937563275 2:123251428-123251450 CCCAAGGAGAAGAAGAAAGATGG + Intergenic
938122874 2:128645958-128645980 ATGAATGAGTAGAGGGAACAAGG - Intergenic
938179813 2:129170304-129170326 GTGAAGGGGAGGTGGGAAGATGG - Intergenic
938399395 2:130976208-130976230 TTGAGGGATAAGAGGGAAAAGGG + Intronic
938692792 2:133807708-133807730 CTGAGGGACAAGAATGAAGAAGG - Intergenic
938784151 2:134610046-134610068 CAGAAGCAGAAAGGGGAAGAGGG + Intronic
938964421 2:136375671-136375693 GGAAAGGAGAAGAGAGAAGAGGG + Intergenic
939121949 2:138127612-138127634 AAGAAGGAGAAGAGGAAGGAAGG - Intergenic
939142634 2:138373865-138373887 CAGAAGTAGAAGAGAGTAGAAGG - Intergenic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
939192104 2:138929193-138929215 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
939304513 2:140393580-140393602 CTGAAATAGAAGATGGAAAATGG - Intronic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
939826771 2:147024734-147024756 GTAAAGGAGAAGGAGGAAGAGGG + Intergenic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
940318241 2:152347161-152347183 CTGAAGAACAAGAGGGAGGGAGG - Intronic
940722954 2:157301610-157301632 ATGAAGGTGAAGAGGAAGGAAGG + Intronic
940963881 2:159816293-159816315 CTAGAGGAAAAGTGGGAAGAAGG + Intronic
941070963 2:160954111-160954133 CTGAAGGAGATAAGGGAATGAGG - Intergenic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941408801 2:165126627-165126649 GGAAAGGAGAAGAGGGAGGAAGG - Intronic
941649199 2:168075134-168075156 ATGGATGAGAAGAGCGAAGAAGG - Exonic
941801254 2:169662403-169662425 ATGAGGAAGAAGAGGAAAGAAGG - Exonic
942244834 2:173998360-173998382 TTGAAGGAGGTGAGAGAAGATGG - Intergenic
942396350 2:175553798-175553820 ATGAATGAAAAGTGGGAAGAAGG - Intergenic
942816686 2:180060711-180060733 CTGAATGCGAAGATGGAACAAGG + Intergenic
943373062 2:187040562-187040584 CAGAAGGTGAACAGGGAACACGG - Intergenic
943662174 2:190570788-190570810 TTGAGAGAGAAGAGGGAAAAGGG + Intergenic
943718509 2:191178527-191178549 CTAAAGAAGAGGAGGAAAGAAGG - Intergenic
944037227 2:195309421-195309443 CGAAAGGAGGAGAGGAAAGAGGG - Intergenic
944355121 2:198778416-198778438 GGGAAAGAGAAGATGGAAGAGGG + Intergenic
944963103 2:204899216-204899238 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
945142384 2:206700420-206700442 GGGAAGGAGAGGAGGGAGGAGGG + Intronic
945395267 2:209307977-209307999 CAGAAGGTGAAGAGGAAACAAGG + Intergenic
945691457 2:213041665-213041687 GGGAAGGAGAAGAGGGAAAGGGG - Intronic
946247664 2:218396703-218396725 CTGAAGGAGGAGATGGATGGGGG + Exonic
946528534 2:220546604-220546626 CTGCTGGAGAAGAAGAAAGAAGG - Intergenic
946641577 2:221789383-221789405 ATGAAGTAAAAGAGGGAAAAAGG - Intergenic
947030044 2:225782988-225783010 AGGAAGGTGAAGAGGGAGGAGGG - Intergenic
947042776 2:225942489-225942511 GAGAAGGGGAAGAGGGAAGAGGG + Intergenic
947071031 2:226288050-226288072 CTTAAGGAAGAGAGTGAAGAAGG - Intergenic
947231533 2:227892623-227892645 CTGTGGGAGAAGATGGTAGAAGG + Intronic
947251776 2:228114782-228114804 CTGAAGGAGAGTAGAGAAGTAGG - Intronic
947347538 2:229208784-229208806 CAGGAGGAGAAAGGGGAAGAGGG + Intronic
947586481 2:231360043-231360065 CTGTAGGAGAAGAGGAGAGGCGG + Intronic
947842628 2:233218087-233218109 CTGACAGAGATAAGGGAAGATGG + Intronic
948013083 2:234665504-234665526 GGGAAGGAAAAGAGGGAAGGAGG - Intergenic
948552245 2:238781220-238781242 CTGAAGGAGAGGAGAGAAAGTGG - Intergenic
948716906 2:239871023-239871045 CTGAAGGAGCGGAGGGGAGAGGG + Intergenic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
948842402 2:240659998-240660020 CTGAAGGAGAAGAACAAAGCCGG - Intergenic
948877872 2:240839816-240839838 CAGAAGGGGACGAGGGGAGAGGG - Intergenic
948939254 2:241187934-241187956 GAGAAGGAGGAGAGGGAAGGTGG + Intergenic
948995467 2:241576129-241576151 CGGGAGGAGGAGAGGGAGGAAGG - Intergenic
949005234 2:241642731-241642753 CACAAGCAGAAGAGGGCAGATGG - Intronic
1168770077 20:408891-408913 CTGATGGGGAGGAGGGTAGAGGG - Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1170140957 20:13124528-13124550 GTGAAGGAGAAGATGGAAAAAGG + Intronic
1170178246 20:13497233-13497255 CTGAAGGAGAAGAGCCAACCTGG + Intronic
1170223565 20:13966284-13966306 AAGAAGAAGAAGAGGCAAGAAGG - Intronic
1170256712 20:14352581-14352603 CTGAAGGGGCAGAGGTTAGAAGG - Intronic
1170264536 20:14450789-14450811 CTGAAGGAAAAGGGGCTAGAAGG + Intronic
1170268721 20:14499623-14499645 ATGAGGAAGAAGAGGGAAGGTGG + Intronic
1170314070 20:15024341-15024363 AGGAAGGACAAGAAGGAAGAGGG + Intronic
1170369451 20:15632822-15632844 AAGAAGGAGAGGAGGGAAGGAGG - Intronic
1170405605 20:16032668-16032690 ATGGATGAGAAGAGGGAAGGAGG + Intronic
1170461355 20:16579606-16579628 ATGGAGGAGAGGAGGGAAGTAGG - Intergenic
1170501800 20:16982390-16982412 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
1170763848 20:19273969-19273991 CCAAAGGCGAAGAGGGGAGAAGG + Intronic
1170857891 20:20074279-20074301 CTGCAGAAGAAGAGAGAACACGG - Intronic
1171077462 20:22143093-22143115 GTGAAGGAGGAGAGGGAGGAAGG - Intergenic
1171331533 20:24343464-24343486 ATAAAGAAGAAGAGGAAAGAAGG - Intergenic
1171464810 20:25320000-25320022 CTGAAGGGGTTGAGGGAAGGCGG - Intronic
1171812560 20:29757023-29757045 CTGGGGGAGAAGAGGGGACAAGG + Intergenic
1171906681 20:30905264-30905286 CTGGGGGAGAAGAGGGGACAAGG - Intergenic
1172172375 20:32946061-32946083 CTCAAGGAGAAGCTGGAAGTTGG + Intronic
1172227040 20:33311966-33311988 ATAAAGGAGCAGAGAGAAGAAGG - Intergenic
1172235467 20:33370009-33370031 CAGAAGGAGATTAGGAAAGAAGG - Intronic
1172358995 20:34299224-34299246 CTTAAGGAGGAGAGGGGATATGG - Intronic
1172964449 20:38824467-38824489 CAGAAGGAGAAGAAGGAACTGGG - Intronic
1172997295 20:39080557-39080579 CTTAGGGAGAAGAGGGAAGGTGG + Intergenic
1173095483 20:40023768-40023790 CTTCAGGAGATGGGGGAAGAAGG + Intergenic
1173764464 20:45595092-45595114 CTGAAGGAGAAGAGGCACTCTGG + Intergenic
1173826396 20:46050531-46050553 CCGAAGGAGCAGAGGTGAGATGG + Intronic
1173854019 20:46238146-46238168 CTGAAGGACTAGAGGAAAGCAGG - Intronic
1173887422 20:46472637-46472659 CTGAAAAAGAAGAGGGATAAAGG + Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174203630 20:48824283-48824305 CTGAAGGAGATGGGGAAAGATGG + Intronic
1174235697 20:49089616-49089638 CTGAAGGAGATGAGGAAATAAGG - Exonic
1174257748 20:49270877-49270899 CTGCAGGAAAAGAGGCGAGAGGG - Exonic
1174401455 20:50278151-50278173 CCGAGGGAGAGAAGGGAAGAGGG - Intergenic
1174430957 20:50468559-50468581 GAGAAGGAGAAGAAGAAAGAAGG - Intergenic
1174641765 20:52050442-52050464 CAGAAGGAGAAGAGGAAGAAGGG - Intergenic
1175782386 20:61690799-61690821 CTGAAGGAGACAAGGGAAAGTGG + Intronic
1175855437 20:62118489-62118511 ATGGATGGGAAGAGGGAAGAGGG + Intergenic
1176019710 20:62956437-62956459 CTCAAAGAGAACAGGGGAGAGGG - Intronic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176034674 20:63030414-63030436 CTGAAGGAAAATCGGGAAGCGGG - Intergenic
1176117609 20:63439888-63439910 CTGTAGGGGAAGAGGAGAGAGGG - Intronic
1176968925 21:15243619-15243641 CTGAATTTGAAGTGGGAAGAAGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177201652 21:17963454-17963476 CTGAAGGTGAAGAGGGGCAAAGG + Intronic
1177383901 21:20383213-20383235 TTGAAGGTGAAGAAGGGAGAAGG + Intergenic
1178116987 21:29427638-29427660 CTGAATGAGGAGAGGTATGAGGG + Intronic
1178183496 21:30191944-30191966 ATGAATGCGAAGATGGAAGAAGG - Intergenic
1178235533 21:30836961-30836983 TTGAAGGAGAAAAAGGAATAAGG + Intergenic
1178364551 21:31978478-31978500 CTGAAGGGGATGAGGGAAAGTGG - Intronic
1178702644 21:34846333-34846355 GGGCAGGAGAAGGGGGAAGAAGG - Intronic
1178810936 21:35880800-35880822 CTGGTGGAGAAGAGGGGGGAAGG - Intronic
1179474314 21:41633495-41633517 CTGCTGGGGAAGAGGAAAGAGGG + Intergenic
1179483242 21:41691893-41691915 CTGAAGAAGAGGATGGATGAGGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180180640 21:46117377-46117399 CTGAAGGAGAAGGGGGCAGGAGG - Intronic
1180626845 22:17199280-17199302 CTGCAGAACAAGGGGGAAGATGG + Intronic
1180798618 22:18620629-18620651 AGGAAGGAAAAGAGAGAAGAAGG + Intergenic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1180927696 22:19567473-19567495 TTGAAGGATAAGACGGGAGATGG + Intergenic
1180938557 22:19641897-19641919 GAGAAGGAGAGGAGGGAGGAGGG + Intergenic
1181094598 22:20496525-20496547 GTGGAGGAGAGGAGGAAAGAAGG - Intronic
1181151160 22:20884437-20884459 CTGCAGGTGATGAGGGCAGAAGG - Intronic
1181223098 22:21374635-21374657 AGGAAGGAAAAGAGAGAAGAAGG - Intergenic
1181255640 22:21560999-21561021 AGGAAGGAAAAGAGAGAAGAAGG + Intronic
1181336194 22:22131672-22131694 TTGACAGAGAAAAGGGAAGATGG + Intergenic
1181484712 22:23223535-23223557 TACCAGGAGAAGAGGGAAGAAGG - Intronic
1181536796 22:23550457-23550479 ATGAAGGATAAGTGGGAGGATGG - Intergenic
1181612266 22:24024611-24024633 CTGAGGGAGAAGAGAGAAAGGGG - Intronic
1181746648 22:24959697-24959719 CTGTACGAGAAGAAGGAAGGGGG + Intronic
1181975564 22:26726903-26726925 CTGAGGGAGTAGAGGGACAAAGG + Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182377743 22:29860424-29860446 AGGAAGGAAAAGAGGGAGGAAGG - Intergenic
1182550931 22:31100417-31100439 CAGAAAGAGAAGGGGAAAGAAGG - Intronic
1183134060 22:35869561-35869583 CAGAAGCTGAAGTGGGAAGATGG - Intronic
1183170557 22:36184668-36184690 CAGGAGGAGAATAGAGAAGAGGG - Intergenic
1183613990 22:38930966-38930988 CTGAAGGAGAAGAACAAAGTTGG - Intergenic
1183746258 22:39693810-39693832 CAGAAAGAGAGGAGGGGAGATGG - Intergenic
1183879833 22:40818297-40818319 TTTAAGGAAAAGAGGGGAGAGGG + Intronic
1183981848 22:41545246-41545268 CGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184610987 22:45602964-45602986 CTGGAGCAGAAGAGGGCAGGAGG + Intergenic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
949110772 3:257937-257959 TTGAAGGAGAAGATGGAATCTGG + Intronic
949132112 3:515990-516012 GGGAAGGAGAAGAGAGAGGAAGG + Intergenic
949146923 3:712248-712270 CTGAAGGAGAAGAACAAAGTTGG - Intergenic
949188233 3:1219379-1219401 GTGAAGGAGGAGAGGATAGAGGG + Intronic
949196703 3:1318563-1318585 CCAAAGGAAAAGAGGGAAGTGGG + Intronic
949284375 3:2383730-2383752 GAGAGGGAGAAGAGAGAAGAGGG - Intronic
949323005 3:2832534-2832556 CTGAAGGACAAGAGAGTAGAAGG + Intronic
949930833 3:9077230-9077252 CTGAAGCAAAGGAGGGAGGAGGG - Intronic
950043388 3:9934059-9934081 CTGAAGGAGAGGAGGCCAGAGGG - Intronic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
950205455 3:11076804-11076826 CTGAAGCAGATCAGGGAGGAAGG - Intergenic
950436530 3:12983627-12983649 CTGAAGGAGCTGAGCCAAGAAGG - Intronic
950628255 3:14264355-14264377 CGGAAGGCGAAGGGGGAACAAGG - Intergenic
950802108 3:15561176-15561198 CAGAAGGAGAAGGGAGATGAAGG + Intronic
951304204 3:21038381-21038403 TTGAAGGAGAATAGAGAATATGG - Intergenic
951607275 3:24449980-24450002 AGGAAGGAAAGGAGGGAAGAAGG + Intronic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
952042571 3:29278548-29278570 CTGAGGGAGATGAATGAAGAAGG + Intergenic
952656302 3:35790030-35790052 GGGAAGGAAAAGAGGGAAGTGGG - Intronic
952766346 3:36957294-36957316 ATGAAGGGGAAGAAGGAAGGGGG - Intergenic
952964946 3:38615303-38615325 CTGAAGGGGAATTGGGAAGCTGG - Intronic
953108265 3:39907152-39907174 CAGATGGAGAGGAGGGAACATGG - Intronic
953256050 3:41291468-41291490 GGGAAGGAGAGGAGGAAAGAAGG + Intronic
953521179 3:43644783-43644805 CTGAAGGGCAAGTGGGAGGAAGG - Intronic
953659985 3:44884867-44884889 CTGAAGGGAAAGAGGGGAGCGGG - Intronic
953903656 3:46857550-46857572 AAGAAGGAGGAAAGGGAAGAGGG + Intergenic
954100576 3:48369588-48369610 CTCAAAGAGAAGAGGGAATTGGG - Intergenic
954681554 3:52348818-52348840 GTGAATGAGCAGAGGGGAGATGG - Intronic
955166196 3:56516301-56516323 CAGAAGGAGAAGGGGAAACAAGG - Intergenic
955225500 3:57056970-57056992 CTAAAGGAAAAGATGGAAGGGGG - Intronic
955467724 3:59253926-59253948 GGGAAGGAGAAGAGGAAGGAAGG - Intergenic
955821964 3:62906029-62906051 CTGAAGGAGAAGAGATCATATGG + Intergenic
955885709 3:63596293-63596315 GGGAAGGAGAAGGGGGAGGAGGG - Intronic
956179373 3:66502762-66502784 CAGAAGGGGAAGAAGGAAAAAGG - Intergenic
956368723 3:68534846-68534868 CTGAAGGAGGAGGAGGAACAGGG + Intronic
956378929 3:68645268-68645290 TTCAGGGAGAAGAGGCAAGATGG - Intergenic
956720138 3:72110319-72110341 GTGAAGGAAAATTGGGAAGAGGG - Intergenic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
956975659 3:74575724-74575746 ATGAAAGAGATGAGGGAAAAGGG - Intergenic
956994752 3:74812398-74812420 CTGAGGGATAAGAAGGAAGCTGG - Intergenic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
957350363 3:79016996-79017018 CAGAAGGAGAAGCTGGAAGTGGG + Intronic
957443912 3:80290956-80290978 CAGAAGGAGAAGGGGGAGCAAGG + Intergenic
957955312 3:87178680-87178702 CAGAGGGAGAAGAAGGTAGAAGG - Intergenic
958061269 3:88484605-88484627 CTAAAGGGGATGAGGGAAAAGGG + Intergenic
958164489 3:89862268-89862290 GTGAAGGGGAAGAGGAAAGCAGG - Intergenic
958475640 3:94577514-94577536 TTGAAGGAGAAGAACAAAGATGG + Intergenic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959481516 3:106878448-106878470 AGGAAGAAGAAGAGGGAGGAAGG - Intergenic
960015157 3:112878899-112878921 ATGGAGGAGAAGTGGGAAAATGG - Intergenic
960038863 3:113129035-113129057 CTGATGGAGAAAAGGGCACAGGG + Intergenic
960330030 3:116347848-116347870 TCGAATGAGAAAAGGGAAGAGGG + Intronic
960474789 3:118110579-118110601 CTAAAGTAGAAGAGAGTAGATGG + Intergenic
960496552 3:118382643-118382665 AGGAAGGAAAAGAGAGAAGAAGG + Intergenic
960674354 3:120180316-120180338 TTGAAGGAGGAGTGGGATGAGGG + Intronic
960822902 3:121753029-121753051 GGGAAGAAGAAGAGGGAAGGTGG + Intergenic
960885052 3:122384691-122384713 AGGAAGGAGCAGGGGGAAGAGGG - Intronic
961345405 3:126260528-126260550 GGGGAGGAGGAGAGGGAAGAGGG - Intergenic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
962101877 3:132351186-132351208 TAGAAGGAGGAAAGGGAAGAAGG + Intronic
962542001 3:136391729-136391751 CAGAAGGAGCTGAAGGAAGAAGG + Intronic
962878514 3:139554266-139554288 TGGAAGGAGAACAGTGAAGAGGG + Intergenic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
963703261 3:148653629-148653651 CACAAGGACAAGAGGGAGGAGGG - Intergenic
964298935 3:155266193-155266215 GTGAAGGTGCAGAGGGAAAAAGG + Intergenic
964471340 3:157059908-157059930 TGGAAGGAGAAGTGGGGAGAGGG + Intergenic
964649804 3:158997755-158997777 CGAAAAGAGAAGAGGGAAGGGGG + Intronic
964835135 3:160929863-160929885 CTGAAGGAGAGGTGGGAAGGTGG - Intronic
965199746 3:165642469-165642491 AAGAAGGAGCAGAGGCAAGAAGG - Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965687831 3:171324140-171324162 GTGAAAGAGAGGAGGGAGGAAGG + Intronic
965917815 3:173872405-173872427 CTGAAGAAAAACAGGGAACATGG - Intronic
966007747 3:175037188-175037210 CTGGAGGACAAGTGGGAAGCTGG - Intronic
966019742 3:175193555-175193577 GTGAAAGAGAAGAGAGAAAAAGG - Intronic
966025963 3:175282471-175282493 CTTAAGGAGAAAGAGGAAGAGGG + Intronic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
966238175 3:177726043-177726065 ATGAAGGAGAGGAGGGAAATGGG - Intergenic
966412174 3:179655072-179655094 CTAAAGGTGGAGAGGGATGATGG + Intronic
966521895 3:180882295-180882317 CGGAGGAAGAAGAAGGAAGAAGG - Intronic
966770045 3:183495765-183495787 TTGAAAAAGAAAAGGGAAGAAGG + Intronic
967117726 3:186356889-186356911 CTGGAAGAGAAGGGGGAAAAGGG - Intronic
967118034 3:186359969-186359991 CTGGAAGAGAAGGGGGAAAAGGG - Intronic
967192446 3:186996614-186996636 CTGAAGTAGCAAAGGCAAGAAGG + Intronic
967433733 3:189419882-189419904 CTGAAGATGAAGGGGGAAAAGGG + Intergenic
967527185 3:190508531-190508553 CTGAAAGACAAGAGGGGAAAGGG - Intergenic
967758933 3:193202289-193202311 GGGAAGGAGAAGATGGAAGGAGG + Intergenic
967828255 3:193896248-193896270 TTGAAAGAGAGAAGGGAAGAGGG + Intergenic
968268679 3:197382668-197382690 ATCAAGGAGAAGATGGAAGGAGG - Intergenic
968449857 4:670023-670045 CTGCAAGAGAAGACAGAAGATGG - Intronic
968488929 4:879759-879781 CAGAAAGGGAAGAGGGAAGCGGG - Intronic
968643203 4:1725374-1725396 CTGGAGGGGTAGAGGGGAGACGG - Intronic
968824519 4:2884735-2884757 ATTTAGGAGAAGAGGGAAGCAGG + Intronic
968889196 4:3358969-3358991 GTGTAGGAGGAGAGGGAGGAGGG - Intronic
968937149 4:3617367-3617389 TGGAAGGACAGGAGGGAAGAAGG - Intergenic
968982367 4:3857166-3857188 CTCAAGTGGAAGAGGGATGAAGG + Intergenic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969448636 4:7260095-7260117 CTGAAAGGGAAAAGGGGAGAAGG - Intronic
969481587 4:7449339-7449361 AGGAAGGAAAGGAGGGAAGAAGG - Intronic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
969649695 4:8458159-8458181 CTAAAGGAAATGATGGAAGAAGG + Intronic
969970054 4:11037609-11037631 TTGAATCAGAAGAGGGAAGCAGG + Intergenic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
970999307 4:22304165-22304187 CTGAGGGAGCTGTGGGAAGAGGG + Intergenic
971090621 4:23340532-23340554 TTGAAGGAGAAGAAGAAAGTTGG + Intergenic
971248759 4:24954068-24954090 CAGAAGGAGAAGAGAGAGAAAGG + Intronic
971425977 4:26515902-26515924 CCACAGGAGAAGAGTGAAGATGG + Intergenic
971426104 4:26517262-26517284 CCACAGGAGAAGAGTGAAGATGG - Intergenic
971720796 4:30243519-30243541 CAGAAGGAAAAGAGCAAAGAAGG + Intergenic
971734383 4:30427450-30427472 CAGAAGGCAAAGAGGGAACAAGG + Intergenic
971825738 4:31620190-31620212 CAGAAGGAAAAAAGGAAAGAAGG - Intergenic
971862830 4:32130295-32130317 CTGAAGGACATGGTGGAAGAAGG - Intergenic
971898580 4:32628198-32628220 CTGAAGGAGCAGAGGAAAAGTGG + Intergenic
972693200 4:41419762-41419784 AGGAAGGAGAGGAGGGAAAAGGG - Intronic
972970369 4:44567271-44567293 CAGAAGGAGAAGAGGAAGCAAGG - Intergenic
973338098 4:48976559-48976581 CACAAGCAGAAGAGGAAAGAGGG + Intergenic
974074294 4:57154827-57154849 AGGAAAGAGAAGAGGGGAGAAGG - Intergenic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
974881083 4:67757875-67757897 CTGAAGGGAAAGAGTGATGATGG + Intergenic
975174416 4:71270965-71270987 CTGGAAGAGAAGAGGCAGGATGG - Intronic
975259551 4:72280712-72280734 ATGAAGAAGATGAGGAAAGATGG - Intergenic
975592507 4:76014596-76014618 CGGAAGGAGAAGAGAGAGAAAGG + Intronic
975616318 4:76251408-76251430 CTGAAGGAAAGAAAGGAAGAAGG - Intronic
976099989 4:81551097-81551119 AGGAAGGAGCAGAGGGAAAATGG + Intronic
976894044 4:90085708-90085730 CTGAGAGAGAAGAGGGAATAGGG - Intergenic
977265104 4:94844593-94844615 CTGAAGCAGAAGACCGGAGAGGG + Intronic
977348817 4:95853441-95853463 CTGAGAGACAAGAGGGAAGGAGG + Intergenic
977590506 4:98821055-98821077 CCAAAGGAGAAGATGGAAGATGG + Intergenic
977645528 4:99407419-99407441 AGGAAGGAGAAGAGCAAAGAAGG + Intergenic
979269332 4:118741739-118741761 ATGAAGGAGGAAAGGAAAGAGGG + Intronic
979353942 4:119680422-119680444 CTTAAAGAGAAGAGGGATTAAGG + Intergenic
979453077 4:120895556-120895578 ATGAAGAAGATGAGGGCAGAGGG - Intronic
979647524 4:123088753-123088775 CTGAAGGAGAAGAGGAAGCAAGG - Intronic
979844453 4:125490449-125490471 CCGAAGGAGAAGAAGAAAAAGGG + Exonic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
979977226 4:127211916-127211938 CTGAAGGAGAGCAGAGAAAATGG - Intergenic
980084594 4:128378233-128378255 AGGAGAGAGAAGAGGGAAGAAGG + Intergenic
980512608 4:133813165-133813187 CTGAAGGAGAAGAGGCACTCTGG - Intergenic
980867860 4:138574627-138574649 CTTCATGAGAAGAGGGAATAGGG - Intergenic
980943249 4:139295141-139295163 CTGAAGCTGAAAGGGGAAGAGGG + Exonic
980971558 4:139572187-139572209 AAGAAGAAGAAGATGGAAGATGG - Intronic
981221011 4:142234913-142234935 CATAAAGAGAAGAGAGAAGAGGG + Intronic
981288958 4:143051883-143051905 TTAAAGTAGAAAAGGGAAGAAGG + Intergenic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
981957626 4:150498405-150498427 ATGAAGGAGAAGAACAAAGAAGG + Intronic
982063391 4:151627061-151627083 TAGAAGGAAAAGATGGAAGAAGG + Intronic
982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG + Intergenic
982146457 4:152400001-152400023 CTGAAGGAGAGGAATGAAGCTGG + Intronic
982741437 4:159061299-159061321 CTGAAGGTGATGAGGGGACAGGG - Intergenic
982932737 4:161429109-161429131 CACAAGGAGAAGAGTGAAAATGG + Intronic
983028886 4:162773252-162773274 CAGAAGGAGAAAAGGGACTACGG - Intergenic
983379837 4:166978700-166978722 GAGAAGGAGAAGAAGGAAGACGG + Intronic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
983879852 4:172921014-172921036 TTGAAGGAGATGAGGGAACTAGG + Intronic
983896564 4:173087189-173087211 AGGAAGCAGAAGAGGGTAGATGG - Intergenic
983932612 4:173469729-173469751 CTGAAGGATGAGTGGGAGGATGG - Intergenic
983966396 4:173817776-173817798 TAAAAGGAGAAAAGGGAAGAAGG - Intergenic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984513352 4:180707196-180707218 CTGAAGGAGAGGAGGTAATGGGG - Intergenic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
985364947 4:189219386-189219408 CTGAAGGAAGAAAGGAAAGAAGG + Intergenic
985375988 4:189339061-189339083 CTTAAGAAGAAGAGGTAAGCTGG - Intergenic
985376237 4:189342120-189342142 GTAAAGGAGAAGGGTGAAGATGG - Intergenic
985599768 5:821180-821202 GGGCAGGAGAAGAAGGAAGAGGG + Intronic
985629911 5:1008927-1008949 CGGTAGGAGGTGAGGGAAGATGG - Exonic
985721139 5:1489859-1489881 CTGGAAGAGAGGAGGGGAGACGG + Intronic
985924415 5:3004696-3004718 CTGCAGGAAAAGCGGGAAGAGGG + Intergenic
986044325 5:4022827-4022849 CAGAAAGAAAATAGGGAAGATGG - Intergenic
986269357 5:6217757-6217779 CCGCAGCATAAGAGGGAAGAAGG - Intergenic
986313350 5:6571064-6571086 AGGAAGGGAAAGAGGGAAGAGGG + Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986643376 5:9893156-9893178 TTGTAGGGGAAGAAGGAAGAAGG - Intergenic
986727275 5:10608389-10608411 CTGAAGGGGAAGAGCAAGGAAGG + Intronic
986770461 5:10968215-10968237 GTGAAGGAGAAGATGGAGGAAGG - Intergenic
986976746 5:13403390-13403412 GTGAATGAGAAGAGGGCACAGGG + Intergenic
986986536 5:13506708-13506730 CTGAAGGAGTTCAGGCAAGAGGG + Intergenic
987048645 5:14130720-14130742 CTGAAAGAGAAAAGGGACAATGG + Intergenic
987071251 5:14338805-14338827 AGGAAGGGGCAGAGGGAAGAGGG + Intronic
987296312 5:16555026-16555048 CTAAAGCAGAAGAGGGAGTAGGG - Intronic
987588291 5:19888146-19888168 TTGAAGAAGAAAAGGGTAGAGGG - Intronic
987767583 5:22253696-22253718 GTGGAGGAGAAGAGGGAAAAGGG - Intronic
988490391 5:31700712-31700734 CTGAGGAGGAAAAGGGAAGAAGG + Intronic
988680628 5:33480999-33481021 ATGAAGGAGAAGAGGGATGAAGG - Intergenic
988861988 5:35291207-35291229 CTGAAGGAGATGAGGAAATGGGG - Intergenic
988952890 5:36282801-36282823 CACAAGGAGAAGAGGAATGATGG - Intronic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
989336498 5:40323346-40323368 CTGAAGGAGAAGGGGAAGCAAGG + Intergenic
989465310 5:41747977-41747999 CTAAAGGACAACATGGAAGAAGG - Intronic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
989531966 5:42518085-42518107 CTTAAGAAAAAAAGGGAAGAGGG - Intronic
989756214 5:44958755-44958777 AGGAAGGAGGAGAAGGAAGAAGG - Intergenic
990328045 5:54697453-54697475 TTAAAGGAAAAGAGGGAACAAGG - Intergenic
990766198 5:59186056-59186078 GAGAAAGAGAGGAGGGAAGAAGG - Intronic
990986154 5:61642668-61642690 CTTCAGGATAAGAGAGAAGAAGG - Intronic
991328980 5:65471020-65471042 CTCAAGGAGAAGACGGAGTATGG - Exonic
991625183 5:68593888-68593910 CTGAAGGAGAATAAGAGAGATGG - Intergenic
992071690 5:73154670-73154692 AGGAAGGGGAACAGGGAAGAAGG - Intergenic
992112704 5:73511234-73511256 AAGAAGCAGAAGAGGGAAGAGGG - Intergenic
992366936 5:76101882-76101904 TAGAAGGGGAAGAGGAAAGAAGG + Intronic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
992605087 5:78447894-78447916 AGGAGGGAGAAGAGGGAGGAGGG - Intronic
993187496 5:84637915-84637937 AGGAAGGAAAAGAAGGAAGAAGG - Intergenic
993707320 5:91185899-91185921 CTTCAGGAGAAAAGGGAAAAGGG - Intergenic
994377664 5:99033466-99033488 CTGAAGTAAAACAGGAAAGAGGG - Intergenic
995050356 5:107696488-107696510 TGGAGAGAGAAGAGGGAAGAAGG + Intergenic
995101354 5:108311048-108311070 CTGAAGGAGAAAAGGGAATGAGG + Intronic
995125355 5:108573258-108573280 CTAAGGGAGAAGAGGGAGGAAGG + Intergenic
995259356 5:110083809-110083831 ATGAGGAAGAAGAGGGAAGGTGG - Intergenic
995608473 5:113883986-113884008 CAGAAGGAGAAGAGAGAAATGGG - Intergenic
995735851 5:115298373-115298395 GAGAAGGAGAAGAGAGAAGAAGG + Intergenic
995862568 5:116657145-116657167 GTGAAGGGGAAGAGAGATGATGG + Intergenic
995933241 5:117477280-117477302 TTCAAGGAGAAGGGGCAAGATGG - Intergenic
996167418 5:120242311-120242333 AGGAAGGAAAGGAGGGAAGATGG - Intergenic
996386571 5:122915279-122915301 CTCAGGGTGAATAGGGAAGATGG - Intronic
996837472 5:127809750-127809772 GTAATGTAGAAGAGGGAAGATGG + Intergenic
996930030 5:128875141-128875163 CAGAAGGCAAAGAGGGAAGCCGG - Intronic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997164617 5:131646597-131646619 CTGAAGGAGGAATGGGAAGTTGG - Intronic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
997189190 5:131914538-131914560 GGGAAGGGGAAGGGGGAAGAGGG + Intronic
997211072 5:132077091-132077113 CTGAAGTAGAGGAAGCAAGAGGG - Intergenic
997251945 5:132395912-132395934 CAGGAGGAGAACAGGGAAGGAGG + Intergenic
997255247 5:132423452-132423474 GTGAAGTAGAAGAGGAAAGCAGG + Intronic
997618587 5:135270420-135270442 AGAAAGGGGAAGAGGGAAGAGGG - Intronic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
997871068 5:137505500-137505522 CTCCAGGAGAAGAGGGGACAGGG - Intronic
998080935 5:139274342-139274364 CCTAGGGAGAAGAGGGAAGAGGG - Intronic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
998343841 5:141442885-141442907 CTGAAGGAGAAGTGATAAGCAGG - Intronic
999090439 5:148931623-148931645 AAGAAGGGGAAGAGAGAAGAAGG - Intronic
999230795 5:150060771-150060793 GAGAAGGAGAAGACGGAACAAGG + Intronic
999649813 5:153754493-153754515 TTAAAAGAGAACAGGGAAGAAGG + Intronic
999721515 5:154402232-154402254 CAGAGGGAGAAAGGGGAAGAGGG - Intronic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1000800007 5:165714097-165714119 AGGAAGGAGAAGAGGGAAAGGGG - Intergenic
1001135251 5:169097433-169097455 GTGGAAGAGAAAAGGGAAGAAGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1002288354 5:178180608-178180630 TTGACGAAGAAAAGGGAAGATGG - Intergenic
1002456908 5:179350505-179350527 CTGGAGGAGAAGTGGGAAGTGGG - Intergenic
1002886993 6:1306273-1306295 CACAAGGAGGGGAGGGAAGAAGG - Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1002984447 6:2175047-2175069 CTGAAGGGGAAGGGGGGTGAGGG + Intronic
1003261532 6:4521133-4521155 CTGAGGGAGCCGAGGGAAGTGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003666769 6:8118723-8118745 CTGAAGGAAAAAAAGTAAGATGG - Intergenic
1003940122 6:11016151-11016173 GAGAAGGGGAAGAAGGAAGAAGG - Intronic
1004140039 6:13009891-13009913 CTGAAGCAGTAGGGGGCAGAGGG - Intronic
1004162139 6:13223850-13223872 TTGAAGGAGAGAAGGAAAGAAGG - Intronic
1004266283 6:14150978-14151000 CTGAAGGATAAGAAAGGAGAAGG + Intergenic
1004423254 6:15489871-15489893 AAGGAGGAGGAGAGGGAAGAGGG - Intronic
1005105847 6:22223465-22223487 CAGGAGGAGAGGTGGGAAGAAGG - Intergenic
1005348009 6:24909452-24909474 CTGGAGGAGCAAGGGGAAGAGGG + Intronic
1005816315 6:29555304-29555326 TTAAAGGAGAAGAGGGGGGAAGG + Intergenic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1006236614 6:32638889-32638911 CTGAAAGGGAAGAGGGAGAAAGG - Intronic
1006245092 6:32726494-32726516 CTGAAAGAGAAGAGAGAAAAAGG + Intergenic
1006246581 6:32742464-32742486 CTGAAAGGGAAGAGGGAGAAAGG - Intronic
1006266533 6:32930028-32930050 ATGAAGGAGGAAAGGAAAGAAGG + Intergenic
1006285836 6:33093142-33093164 ATGAAGGAGAAGATGGAGAATGG + Intergenic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006517313 6:34552191-34552213 CTGGAGGAGGGTAGGGAAGAGGG - Intronic
1007018198 6:38490723-38490745 GTCAGTGAGAAGAGGGAAGAAGG + Intronic
1007078754 6:39084363-39084385 CTGAAGGAGATGGGGGCAGAAGG + Intronic
1007207903 6:40167490-40167512 CTGAGGAAGAAGAGTGGAGAAGG - Intergenic
1007309548 6:40934633-40934655 CTGGAGGAGGAGAGGGAATGGGG + Intergenic
1007361102 6:41356475-41356497 AGGAAGCAGAAGAGGAAAGAAGG - Intergenic
1007377438 6:41466531-41466553 AGGAAGGAAGAGAGGGAAGAAGG + Intergenic
1007478337 6:42133990-42134012 CTGAGGGAGAAGGGGCAGGAGGG - Intronic
1007764924 6:44154669-44154691 CTGAAGGAGGAGAGGAAATGGGG - Intronic
1007786755 6:44284669-44284691 CTGAAGGAGAAGGAAGGAGAAGG - Intronic
1007819156 6:44547804-44547826 CTGAAGGAGAAAAGTCAAGGAGG - Intergenic
1007835620 6:44671642-44671664 CTGAAGGAGATGAGGGGGTAAGG - Intergenic
1008085673 6:47241848-47241870 GTGCAGGAGAAGAAGAAAGAAGG - Intronic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1008419718 6:51284033-51284055 ATGAAGGAGGTGGGGGAAGAGGG + Intergenic
1008435085 6:51466615-51466637 CGGAGGGATAAGAGGGAGGAGGG - Intergenic
1008441436 6:51536205-51536227 CTGAAGGAGACAAGATAAGAGGG - Intergenic
1008484565 6:52021754-52021776 GGGAAGGAGGAGGGGGAAGAGGG - Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008762918 6:54875720-54875742 GTGGAGGGGAAGAGGGAAGGTGG + Intronic
1008927541 6:56902778-56902800 ATTAAGGAGAAGAGGGAACTGGG + Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009027359 6:58016039-58016061 CTTCAGGAGAGAAGGGAAGAAGG - Intergenic
1009480104 6:64146521-64146543 CAGCAGGGGAAAAGGGAAGAAGG + Intronic
1009863326 6:69364221-69364243 CTGAAGGAAAAAACAGAAGAAGG + Intronic
1009994833 6:70886558-70886580 CTGAAGGGGAAGTGGGGAGACGG - Intronic
1010464132 6:76146927-76146949 CTAATGGAGAAGAAAGAAGAAGG - Intergenic
1010472405 6:76244297-76244319 CGGAAGGCGAAGAGGAAACAAGG - Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010631522 6:78204569-78204591 CTTAAGTAGGAGAGGGAAAAAGG - Intergenic
1010824222 6:80453240-80453262 CTGAAGCAGCAAAGAGAAGATGG + Intergenic
1010835579 6:80584013-80584035 CTGAAGGAAGTGAGGGAACACGG + Intergenic
1011371313 6:86639827-86639849 AAGAAGGAGGAGAGAGAAGATGG + Intergenic
1011484747 6:87829967-87829989 GGGAAGGAGAAGGAGGAAGAAGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011936145 6:92780561-92780583 GAGAAGGAGAAGGAGGAAGAAGG - Intergenic
1011936148 6:92780577-92780599 GAGAAGGAGAAGAAGGGAGAAGG - Intergenic
1012321021 6:97845892-97845914 CTGAAGGAGAAGAACAAAGTTGG - Intergenic
1012378941 6:98596805-98596827 TTGAAGGAGAAGAAGAAAGTTGG + Intergenic
1012961340 6:105625313-105625335 CTGAAAGAGAAAAGGGAAGGGGG + Intergenic
1012966309 6:105677651-105677673 GAGAAGCAGAAGATGGAAGAAGG - Intergenic
1012995274 6:105966685-105966707 CTGATGATGAAGTGGGAAGATGG - Intergenic
1013002444 6:106037445-106037467 TATAAGGAGAAGAGGGAAAAGGG - Intergenic
1013348238 6:109282961-109282983 GTGAAAGAGAAAAGAGAAGAGGG - Intergenic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1014047686 6:116912179-116912201 CTGCTGGGGAAGGGGGAAGAGGG + Intronic
1014228582 6:118876220-118876242 TTGAAGGGAAAGAGGGATGAGGG + Intronic
1014286719 6:119507332-119507354 CTGGAGGAGAGAAGGGAAGGAGG - Intergenic
1014384248 6:120781050-120781072 GGGAAGGAGAAGAGGGCAAATGG + Intergenic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1014644390 6:123954991-123955013 CAGAAGGGGAGGAGGGGAGAAGG + Intronic
1014684398 6:124477781-124477803 GGGAAGGGGAAGAGGGAGGAGGG - Intronic
1014826763 6:126055906-126055928 GAGAAGGAGAAGAAGAAAGAGGG - Intergenic
1015018487 6:128443310-128443332 AAGAAGGAGATGAGGGAAGAGGG + Intronic
1015104728 6:129522412-129522434 GTGAAGGTGAAGAGAGATGACGG + Intergenic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015547866 6:134379991-134380013 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1015975077 6:138782075-138782097 CTCAAGGGTAGGAGGGAAGAAGG - Intronic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1016263680 6:142206645-142206667 CTGAAGGAGAAGAACAAAGTTGG + Intronic
1016463700 6:144305581-144305603 ATGAAAGAAATGAGGGAAGAAGG + Intronic
1016692234 6:146951108-146951130 CTGCAGGAGAAGGGGGATGCGGG - Intergenic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1016926399 6:149353410-149353432 CTGAGGAAGAAGAGGGAATCTGG - Intronic
1016994043 6:149948308-149948330 CTCAAGAAGAAGGGGAAAGAAGG + Intronic
1017004296 6:150019249-150019271 CTCAAGAAGAAGGGGAAAGAAGG - Intronic
1017418892 6:154251842-154251864 GTGCAAGAGAAGACGGAAGAAGG + Intronic
1017741298 6:157409176-157409198 CTGAGGGAGAAGAGGCCAGCCGG + Intronic
1017795470 6:157840268-157840290 CTGAGGGAGCTCAGGGAAGAGGG + Intronic
1018002003 6:159587658-159587680 CTGAAGGAGTCGTGGGGAGAAGG - Intergenic
1018036898 6:159889454-159889476 CCGAAGGAAATGAGGGATGAAGG - Intergenic
1018038110 6:159898777-159898799 GAGAAGGAGAAGAAGGGAGAAGG - Intergenic
1018138986 6:160807745-160807767 CTGAATTACAAAAGGGAAGATGG - Intergenic
1018407126 6:163498539-163498561 CTGAAAGTGAAGGGGGATGAGGG - Intronic
1018589937 6:165408742-165408764 GCCAGGGAGAAGAGGGAAGAAGG + Intronic
1018594742 6:165466700-165466722 TTCAAGGAGAGGAGGGGAGATGG - Intronic
1018675144 6:166214323-166214345 AGGAAGAAGAAGAGGAAAGAAGG + Intergenic
1018879889 6:167867088-167867110 CTGAAGGTAAAGAGGGAACTGGG - Intronic
1018990724 6:168671543-168671565 ATGACGGAGAAGAGGGACCAGGG - Intronic
1019018982 6:168901784-168901806 GGGAAGAACAAGAGGGAAGACGG + Intergenic
1019094558 6:169568187-169568209 CTGAAGGAGAAAGAGGCAGAAGG + Intronic
1019315556 7:382895-382917 TTAAATGAGAAGTGGGAAGAAGG + Intergenic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019699936 7:2469844-2469866 ACGAAGGAAAAAAGGGAAGAGGG + Intergenic
1019940755 7:4287770-4287792 CTGAAAAAGAAGAGTGAAGTGGG - Intergenic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020518737 7:9159402-9159424 ATGAAGGAGAAAAGAGAAGTTGG + Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1021537396 7:21721345-21721367 GGGATGGAGAAGAGGGAATAGGG - Intronic
1021809839 7:24392544-24392566 TTGAAGGAAAAAAGGGGAGAGGG + Intergenic
1022112683 7:27241010-27241032 CTGAAAGAGAAGTGGAAAGCCGG + Intergenic
1022340728 7:29465052-29465074 CAGAAGGAAAAAAGGCAAGAAGG - Intronic
1022454335 7:30545395-30545417 CTGAATGAGAAGATGGAACGAGG + Intronic
1022491480 7:30823457-30823479 ATGAAGGGAAAGAAGGAAGAAGG - Intronic
1022503835 7:30898477-30898499 CTGACGGAGAAGCAGGCAGACGG - Intergenic
1022636600 7:32142181-32142203 CAGAAGGAGAAGGGGGAAGGAGG + Intronic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023149128 7:37183193-37183215 CAGAAGGAGAAGGAGGAAGGAGG + Intronic
1023627153 7:42127409-42127431 CTCATTGAGAAGAGGGAAGTGGG - Intronic
1023693448 7:42818728-42818750 GAGAAGGAGAAGAAGGAAGAAGG + Intergenic
1024171337 7:46791067-46791089 GTGAAGGATAAGGGGGAAGAAGG + Intergenic
1024191603 7:47017175-47017197 CTGAATAACAAAAGGGAAGATGG + Intergenic
1024604144 7:51011041-51011063 CTGATGGAGCAGAGGGCAGACGG - Intergenic
1024701837 7:51911966-51911988 CAGAAGGAGAAGATGTGAGAGGG + Intergenic
1024845481 7:53636880-53636902 CTAATGGAGCAGAGAGAAGAAGG + Intergenic
1025115665 7:56255910-56255932 CTGAATGACAAGAGTGAAAAGGG + Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026509169 7:71013750-71013772 AAGAAAGAGAAAAGGGAAGAAGG + Intergenic
1026845549 7:73697137-73697159 CTGAGGGGTATGAGGGAAGAAGG - Intronic
1026852606 7:73734658-73734680 GGTAAGGAGAGGAGGGAAGAAGG - Intergenic
1026905095 7:74058340-74058362 GAGAAGGAGAAGAAAGAAGAAGG - Intronic
1026927423 7:74204121-74204143 GGGAAGGAGAGGAGGGAAGGAGG + Intronic
1027226219 7:76245258-76245280 TTGAAGGAGCAGAGGGAAGCAGG + Intronic
1027474734 7:78615220-78615242 TTGAAGGGGAATAGGGGAGAAGG + Intronic
1027545225 7:79519189-79519211 GGGAAGAAGGAGAGGGAAGAGGG + Intergenic
1027594657 7:80158168-80158190 CTGAAGGAGAAGAACAAAGTTGG - Intronic
1027683113 7:81245213-81245235 AGGAAGGAGGAGAAGGAAGAAGG + Intergenic
1028224821 7:88237919-88237941 ATGAAGGAGAAGAGAGCAAAAGG + Intergenic
1028296663 7:89141059-89141081 CCAAAGGAGAGGAGGGGAGATGG + Intronic
1028311128 7:89337249-89337271 ATGAAAGCGTAGAGGGAAGAGGG + Intergenic
1028409970 7:90519835-90519857 ATGAAGGAGGTGAAGGAAGAAGG - Intronic
1028513770 7:91653848-91653870 CTCAGGGAGGAGAGAGAAGATGG - Intergenic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1028799158 7:94942132-94942154 CTGACTGAGAAGAGAGAAGTGGG - Intronic
1028808004 7:95051420-95051442 CTGAAGGAGAAGAACAAAGTTGG - Intronic
1028827995 7:95296424-95296446 TTGAAGGTGAAAATGGAAGAGGG - Intergenic
1028847370 7:95497047-95497069 GGGAAGGACAAGAGGGTAGAGGG + Intronic
1029008354 7:97232956-97232978 AAGAATGAGAAAAGGGAAGAGGG + Intergenic
1029048363 7:97656076-97656098 CTGAGGGATATGAGAGAAGATGG - Intergenic
1029094883 7:98077242-98077264 AAGAAGGAGAAGAAGAAAGAAGG + Intergenic
1029245585 7:99197876-99197898 AGGAAGGAGAAGAGGGAAAGAGG + Intronic
1029531363 7:101127399-101127421 CTGCAGGAGAGCAGGGAGGATGG + Intronic
1030209792 7:106984857-106984879 CTGAAGGAGACGAGGGAGACAGG - Intergenic
1030432215 7:109464622-109464644 ATAAAGGAGAAGGGAGAAGAGGG + Intergenic
1030769192 7:113452668-113452690 GTGAAAAAGAAGAGGGAAAATGG + Intergenic
1030891143 7:115001045-115001067 CTGAAGGGAAAAATGGAAGATGG + Intronic
1031325125 7:120386375-120386397 TTGAGGGGGAAGAGGCAAGAAGG - Intronic
1031492509 7:122406462-122406484 CTGCAGGAAGACAGGGAAGAAGG + Intronic
1031529209 7:122855873-122855895 CTGGAGGAAAAGAGAGGAGAAGG - Intronic
1031575638 7:123412737-123412759 TTGAGGGAGATGAGGGATGATGG - Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031715309 7:125101924-125101946 CAGAAGGTGAAGGGGGAAGCAGG - Intergenic
1032284271 7:130528947-130528969 ATGAAGGACAGGAGGGAGGATGG + Intronic
1032310684 7:130783947-130783969 CTGAAATAGAAGATAGAAGATGG - Intergenic
1032508675 7:132454946-132454968 CTGAAGGAGCTGTGGGAAGGTGG - Intronic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1032714324 7:134492008-134492030 CTGAAACTGAAGAGGAAAGAGGG - Intergenic
1032715211 7:134503323-134503345 CTCAAGGAGCAGAGTGAAGCTGG + Intergenic
1032715236 7:134503520-134503542 CTGAGGGTGAAGAGGGAGGCAGG + Intergenic
1032807347 7:135369542-135369564 ATAAAGGACAAGAGTGAAGATGG - Intronic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1033173748 7:139107180-139107202 GAGAAGGAGAAGAGAGCAGAGGG - Intronic
1033250893 7:139758198-139758220 CTGAAGGGGAAGAGCAACGAGGG + Intronic
1033332767 7:140429868-140429890 GTGAAGGAGGAGGGGAAAGAGGG - Intergenic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1033901754 7:146150992-146151014 CTGAAGGCGAAGAGGAAGCAAGG + Intronic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034492515 7:151401400-151401422 GGGAAGGAGAGGAGGGAGGAAGG - Intronic
1034584623 7:152078176-152078198 TAGAAGGAGAAGAGGGAGGGGGG + Intronic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035122509 7:156580000-156580022 CATAAAGAGAAAAGGGAAGAAGG + Intergenic
1035237683 7:157509242-157509264 GAGAAGGAGAAGGGGGGAGAGGG + Intergenic
1035419667 7:158717150-158717172 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419693 7:158717283-158717305 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035419753 7:158717611-158717633 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419768 7:158717685-158717707 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035883193 8:3265612-3265634 GTGAAGGAGAGGAGTGAAGGTGG + Intronic
1036478660 8:9118180-9118202 CAGCAGGAGAAGTGGAAAGAGGG - Intergenic
1037090792 8:14915533-14915555 CTGACAAAGAGGAGGGAAGATGG - Intronic
1037098358 8:15013523-15013545 CTGAAGGAATAAAGGGAAGGAGG - Intronic
1037126880 8:15362250-15362272 TTGAAGGAAAAGAGGTATGATGG - Intergenic
1037138349 8:15490537-15490559 CTGAAGGAGAACAGCAGAGAGGG + Intronic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037411541 8:18603832-18603854 CTGAAAGTGAAGGGGGAACAGGG - Intronic
1037951016 8:23018857-23018879 GGGAAGGAGAAGAGGGAGAATGG + Intronic
1038147608 8:24913348-24913370 CTTGAGGATAAGAGGGTAGAAGG + Exonic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1038365527 8:26928479-26928501 CTGAAAGAGAAGAGAGATAAGGG + Intergenic
1038930581 8:32189227-32189249 CTGAGGGGGAAGACGGAAGGGGG - Intronic
1039062892 8:33585776-33585798 CTGGAGGTGATAAGGGAAGAAGG + Intergenic
1039317330 8:36387888-36387910 AGGAAGAAGAAGAGGAAAGAAGG - Intergenic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1039741848 8:40390014-40390036 CTAAATAAGAAGAGGGAAGCAGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1040042616 8:42931739-42931761 CGGGATGGGAAGAGGGAAGAGGG - Intronic
1040441876 8:47451778-47451800 CAGAAGGAGAAGAGAAGAGAGGG + Intronic
1040580930 8:48697980-48698002 GTGCAGGTGAAGATGGAAGACGG - Intergenic
1040770551 8:50970132-50970154 CAGAATGAGAAGGGGGAAGGGGG + Intergenic
1041013995 8:53572442-53572464 CTAAAGGAGAAGAGGTGACAAGG - Intergenic
1041097114 8:54361355-54361377 AGGAAGGAAAAGAGGGAAGGAGG - Intergenic
1041330480 8:56719109-56719131 GGGCAGGAGGAGAGGGAAGAGGG - Intergenic
1041497964 8:58507818-58507840 ATGAAGCAGAAGAGGGCAGTGGG - Intergenic
1041527521 8:58823798-58823820 CTAGGGGCGAAGAGGGAAGAAGG + Intronic
1041605487 8:59778309-59778331 GAGAAGGAGGAGAGGGAAAATGG - Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042673818 8:71294788-71294810 CTGAAGGAGAAGAAAAAAGTTGG + Intronic
1042689462 8:71481811-71481833 CTGATGGAGAAAAAGGAAGGAGG + Intronic
1042928709 8:73992784-73992806 CCAAAGGAGGAGAGGGAAGTGGG - Intronic
1043039716 8:75247308-75247330 CTGAAGGAGAAAAATGAATAGGG - Intergenic
1043673980 8:82925850-82925872 CTGAAGGAGCAGAAGTAAAAGGG + Intergenic
1043751968 8:83948913-83948935 AGGAAGGGGAAGAGGGAAGGAGG + Intergenic
1043973927 8:86564093-86564115 CTGAAGGAGGTGAGGGAGCAAGG - Intronic
1044044866 8:87419827-87419849 CTAAAGGACAAGAGAGAAAATGG + Intronic
1044138478 8:88617764-88617786 CTGAAGTAGATGGGAGAAGAGGG + Intergenic
1044751092 8:95416033-95416055 CTGAAAGAGAAGAAAGAAGGGGG - Intergenic
1044793171 8:95868739-95868761 CTGCAGGAGAAGGCAGAAGAAGG - Intergenic
1045015062 8:97994221-97994243 AGGAAGGAGAAGGGGGAGGAAGG + Intronic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045619971 8:103965098-103965120 TTGAAGGAGAAGAATGAAGTTGG - Intronic
1045644580 8:104286950-104286972 GTGAAGGAGAAGGGGGTTGAGGG - Intergenic
1046806200 8:118481446-118481468 AAGAAGGAAAAGAGGGAGGAAGG + Intronic
1046909301 8:119608445-119608467 ATGAATGAGAAGGGGGAAAAAGG + Intronic
1047284252 8:123472908-123472930 ATGAAAGGAAAGAGGGAAGAGGG - Intergenic
1047318640 8:123757502-123757524 CTGAGGCTGAAGAGGGGAGAGGG + Intergenic
1047469096 8:125150138-125150160 ATGAAGCAGAACAGGGAAAAGGG - Intronic
1047618724 8:126585093-126585115 TGGAAGGAGAGGAGGGAAGACGG - Intergenic
1047981526 8:130188184-130188206 CTGAAAAAGCAAAGGGAAGATGG + Intronic
1048117924 8:131545854-131545876 CTGGAGGAGAAGGAGGAAGTGGG + Intergenic
1048177709 8:132168130-132168152 CTGAAAGAGAACAGGCAAAAGGG - Intronic
1048192724 8:132304944-132304966 CTGAAGGAAAGGAGGAAGGAAGG + Intronic
1048518950 8:135136414-135136436 CTGAATGATGTGAGGGAAGAGGG + Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048546689 8:135394193-135394215 CTGAAGGAAAAAGGGGAGGAGGG + Intergenic
1048680602 8:136837366-136837388 AAGAAAGAAAAGAGGGAAGAGGG - Intergenic
1048718123 8:137291194-137291216 CTGAAGGAGCAGATTGAAGTAGG - Intergenic
1048749430 8:137654670-137654692 CAGAAGGAGAAGACAAAAGAAGG + Intergenic
1048761937 8:137804902-137804924 CTGAAGGAAAGGAGGAAGGAAGG + Intergenic
1048815812 8:138332674-138332696 GGGAAGGAGAAGAGTGAACACGG + Intronic
1048876642 8:138841678-138841700 TTGACGAAGAGGAGGGAAGAGGG + Intronic
1048994041 8:139778817-139778839 CTGAAGGAGAAGAGAGTGGAGGG + Intronic
1049035869 8:140075448-140075470 CTGGAGGAGGAGAGGGATGTGGG - Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049331698 8:142058008-142058030 AGGAAGGGGAAGAAGGAAGAGGG + Intergenic
1049640592 8:143713411-143713433 CTGAAGCAGGAGAGAGGAGAGGG + Intronic
1049763193 8:144340061-144340083 CTCAAGGAGAGGAGGGAATTGGG + Intergenic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050038534 9:1463111-1463133 GGGAAGGAGAAGAGGCATGAAGG - Intergenic
1050266467 9:3895692-3895714 ATGAAGATGAACAGGGAAGATGG - Intronic
1050297651 9:4222120-4222142 CTGGTGGAGAAGAGGGAGGGAGG - Intronic
1050690427 9:8221405-8221427 AGGAAGTAGAAGAGGGAAGGTGG - Intergenic
1050838741 9:10118904-10118926 ATAAAGGAGATGAAGGAAGAGGG + Intronic
1050910619 9:11065000-11065022 CTGACGAAGAAAAGGGAAGATGG - Intergenic
1051044002 9:12851664-12851686 AAGAAGGAAAAGAGGGAAGTGGG + Intergenic
1051300312 9:15643733-15643755 TTGCAGGAGGATAGGGAAGAAGG - Intronic
1051700908 9:19822935-19822957 GAGAAGGAGAAGAGGAAGGAAGG - Intergenic
1052183621 9:25562816-25562838 CGGAAGGGGAAGAGGGAAATGGG + Intergenic
1052284005 9:26763786-26763808 CAGAAGGAAAAGAGAGAGGAAGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1052848032 9:33354591-33354613 CTGAAGGACAGGTGGGATGATGG - Intronic
1052993306 9:34535402-34535424 ATGAAGGAAAAGAGGGAAGGAGG - Intergenic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1053307917 9:36996792-36996814 CTGAAAGAGACAGGGGAAGAGGG + Intronic
1053461134 9:38272360-38272382 TTGAAGGAATAGAGGGAACAAGG + Intergenic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054710071 9:68502431-68502453 CTGAAAGGGACAAGGGAAGAAGG - Intronic
1054723856 9:68630629-68630651 GTGAAGGAGAAAAAGGAGGAGGG + Intergenic
1054730788 9:68701057-68701079 ATGAAAGAGAAGAGGGTACAGGG + Intergenic
1055018543 9:71645053-71645075 AGGAAAGAGAGGAGGGAAGAGGG - Intergenic
1055046643 9:71933167-71933189 CAGAAGGAGAAGAGAGAAAGTGG + Intronic
1055378040 9:75671798-75671820 TTGAAGAAGAAGAGGGAAGGGGG + Intergenic
1055397309 9:75889750-75889772 GTAAAGGAGAAGCGAGAAGAGGG + Intergenic
1055424532 9:76180615-76180637 CTGAAGGAGGAGGGAGAAGGTGG - Intronic
1055429479 9:76229026-76229048 GAGAAGGAAAAGAGGAAAGAAGG + Intronic
1055673161 9:78627410-78627432 CTGCAAGAGCAGAGGGGAGAGGG - Intergenic
1056339808 9:85616256-85616278 CCAAAGGAGAAGGGGGAAGAAGG + Intronic
1056490904 9:87105984-87106006 ATGAAAGAAAAGAGGGAGGAAGG + Intergenic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1056683971 9:88744362-88744384 CTGAAGGGGCAGAGGGGATATGG + Intergenic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1056707076 9:88960280-88960302 TTGAAGGGGAAGGGGGAACAAGG + Intergenic
1057079528 9:92162217-92162239 CTGGAAGAGAAGAAGGGAGAGGG + Intergenic
1057289621 9:93796011-93796033 CAGAAGGATAAGAGAGAAAAGGG - Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057641959 9:96833062-96833084 CAGCAGCAGAAGAGAGAAGACGG - Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057901796 9:98954917-98954939 ATGAAGGAGAAGAGTGGAGAGGG - Intronic
1057998104 9:99838762-99838784 CTGAATCAGAACTGGGAAGAAGG + Intronic
1058319923 9:103616036-103616058 ATGAAGGAGAAAAGGAAGGAAGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058425408 9:104871368-104871390 CTTACTGAGAAGAGGGAAGGTGG + Intronic
1058778771 9:108312130-108312152 CTAAAGGACAAGAGGGGAAAGGG + Intergenic
1059055051 9:110970663-110970685 GAGAAGGAGGAGAGGGAAAAAGG - Intronic
1059142078 9:111862938-111862960 CAGAAGGAGAAGAGAGAACAAGG - Intergenic
1059226121 9:112674771-112674793 AGGAAGGAGGAGAGGAAAGAGGG - Intergenic
1059303397 9:113333957-113333979 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059670481 9:116486416-116486438 ATGGAGGGAAAGAGGGAAGAAGG + Intronic
1059675827 9:116538201-116538223 AGGAAGGGAAAGAGGGAAGAAGG + Intronic
1059764664 9:117372292-117372314 CAGAGGGTGAAGAAGGAAGAAGG + Intronic
1059833118 9:118120666-118120688 GTGAAGGAGAAGAGAGAAAAGGG - Intergenic
1060169885 9:121452873-121452895 ATAAAGTAGAAGAGGTAAGAAGG - Intergenic
1060296371 9:122346395-122346417 TTTAGGGAGAAAAGGGAAGAAGG - Intergenic
1060730156 9:126031779-126031801 CAGAAAGAGGAGGGGGAAGAGGG + Intergenic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1060935024 9:127509766-127509788 GGGAAGGAGAGGAGGGGAGAGGG - Intronic
1060935032 9:127509787-127509809 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
1060935039 9:127509808-127509830 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
1060935048 9:127509836-127509858 GGGAAGGAGAGGAGGGGAGAGGG - Intronic
1061004351 9:127920157-127920179 CTGAGGGGGAAGGGGGAGGAAGG - Intergenic
1061077008 9:128347917-128347939 CTGAAAGGGGAGAGGGAAGAAGG + Intronic
1061117795 9:128625603-128625625 CTGAAGGAGAGCAGGAAAGGGGG + Intronic
1061245023 9:129397205-129397227 ATGAAGGATAAGTGGGAGGATGG + Intergenic
1061298209 9:129688588-129688610 CTGAAGGAGAACAGCCAGGAGGG + Intronic
1061466039 9:130780589-130780611 GAGAGGGAGATGAGGGAAGAGGG - Intronic
1061551424 9:131336962-131336984 CCGGAGGAGATGAGGGGAGAGGG + Intergenic
1061750466 9:132773406-132773428 ATAAAGGGGAATAGGGAAGACGG - Intronic
1061910387 9:133719268-133719290 CAAAAGGGGAAGAAGGAAGAAGG + Intronic
1062025072 9:134336453-134336475 ATCAAGACGAAGAGGGAAGAAGG - Intronic
1062093103 9:134688909-134688931 CTGAAGGAGACCAGGGTGGAGGG - Intronic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062456245 9:136640616-136640638 CGGAAGGATGAGAGGGAACAGGG - Intergenic
1062477521 9:136736121-136736143 GGGGAGGAGAAGAAGGAAGAAGG - Intergenic
1062638410 9:137503591-137503613 GAGAAGGAGAAGGAGGAAGAAGG + Intronic
1062721200 9:138045094-138045116 GTTAAGGTGAAGAGGGGAGAGGG + Intronic
1185499350 X:585156-585178 AGGAGGGAGAAAAGGGAAGAGGG + Intergenic
1185540446 X:899193-899215 CGGGAGGAGAAGAAGAAAGAGGG - Intergenic
1185546312 X:948329-948351 TTGAAGGAGAAAAGGGTAGATGG - Intergenic
1185623385 X:1466735-1466757 AGGAAGGAGGAGAGGGAAGGAGG - Intronic
1185647976 X:1628601-1628623 CAGAAGGAGAAGAGAGGGGAGGG - Intronic
1185713819 X:2325470-2325492 CTGACAAAGAGGAGGGAAGATGG - Intronic
1185752911 X:2628320-2628342 GTGAAGGATGAGAGGGGAGAGGG + Intergenic
1186058716 X:5680404-5680426 CAGAAAGAGAAGAAGGATGACGG - Intergenic
1186244395 X:7605470-7605492 TGGAGGGAGAAGAGAGAAGAAGG - Intergenic
1186303421 X:8227137-8227159 ATGAAGGAGAGGAGGGAGGAAGG - Intergenic
1186413231 X:9361793-9361815 CAGAAGGTGAAGGGGGAGGAGGG - Intergenic
1186573173 X:10737662-10737684 AGGAAAGAGAAGAGAGAAGAAGG + Intronic
1186598052 X:11006147-11006169 GTGGATGAGAGGAGGGAAGAAGG - Intergenic
1186992708 X:15086685-15086707 CAAAAGGAGAAGGGGGAAAAAGG - Intergenic
1187172938 X:16869793-16869815 CTGGAGGAGGGAAGGGAAGAGGG + Exonic
1187207863 X:17199895-17199917 AAGATGGAGAAGAGGGCAGAAGG + Intergenic
1187426480 X:19181830-19181852 CTGAAAGAGCAGAAGGGAGATGG + Intergenic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1188004939 X:25010780-25010802 TGGAAAGAGAAGAAGGAAGAAGG - Intronic
1188312147 X:28630516-28630538 CTGAAGGGGAAGAAGGCAGACGG - Intronic
1188711047 X:33398321-33398343 TGTAAGGAGAAGAGGGAGGAGGG + Intergenic
1188802222 X:34546605-34546627 CAGAAGGAAAAGAGAGAAGGGGG + Intergenic
1189047739 X:37611299-37611321 TTGGAGGAGAAGAGGAGAGAAGG - Intronic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1189330838 X:40144072-40144094 CTGGAGGGGAAGAGGGAAGGTGG + Intronic
1189357359 X:40321043-40321065 CAGAAGGAGAAGAGCAAACAAGG - Intergenic
1189378734 X:40486281-40486303 CTGAAGAAAAAGAGGAAAGAAGG - Intergenic
1190128385 X:47725124-47725146 GTGAAGGAGAGGAGGGTGGAGGG - Intergenic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190639969 X:52474902-52474924 CAGAAGGACATGGGGGAAGAAGG + Intergenic
1190647703 X:52537963-52537985 CAGAAGGACATGGGGGAAGAAGG - Intergenic
1190691938 X:52919729-52919751 CTGAAGGACATGTGGGGAGAGGG + Intergenic
1190694045 X:52936063-52936085 CTGAAGGACATGTGGGGAGAGGG - Intronic
1191702385 X:64056955-64056977 CAGAAGGAGAAGAACGAAGTTGG - Intergenic
1191768728 X:64732388-64732410 CTGAAGGAGAAGAGGCACTCTGG + Intergenic
1191842830 X:65525153-65525175 CTGAAGCAGCATAGGGAGGAGGG + Intronic
1192136013 X:68601207-68601229 CAGAAGGAGAAGAGAGAGAAAGG + Intergenic
1192243045 X:69349855-69349877 GTGCAGGAGAAGGGGGAAGGAGG - Intergenic
1192302641 X:69921692-69921714 CTGAAGGACAAGGGGGAAAAAGG - Intronic
1192337516 X:70234554-70234576 GGGAAGGACAAGAGGGAAGAGGG + Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192936861 X:75869565-75869587 CTGAAGGAAAAGAAGGAACGAGG - Intergenic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193572542 X:83161727-83161749 CAGAAGGAGAAATGGAAAGACGG + Intergenic
1193622280 X:83770298-83770320 CTGTAGGAGAAGAAGAAAGAAGG - Intergenic
1193667575 X:84341154-84341176 CTGAAGGAGAGTGGGGAAGTAGG - Intronic
1193799071 X:85913790-85913812 TGGAAGGAGAAGAGCCAAGATGG + Intronic
1194407040 X:93509377-93509399 AGGAAGGAGAAGGGAGAAGAAGG + Intergenic
1194466568 X:94240995-94241017 CTGGAGGAGTTGAGGCAAGATGG - Intergenic
1194919904 X:99751950-99751972 CTGACAGAGAACAGGGAAGGAGG - Intergenic
1195235814 X:102897224-102897246 ATGAAGGAGAAGAAGGATAAGGG + Intergenic
1195387472 X:104326559-104326581 GTGAAGGGGAAGAGGGAAATGGG - Intergenic
1195705422 X:107734686-107734708 CTGAAGCAAGTGAGGGAAGAGGG + Intronic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1196149348 X:112355336-112355358 CAAAAGGAAAGGAGGGAAGAAGG + Intergenic
1196703897 X:118699869-118699891 CTGAAGGAGAAGCAGTAAGTCGG + Intergenic
1196830091 X:119768971-119768993 ATGAAGGGAAGGAGGGAAGATGG - Intergenic
1196927998 X:120653114-120653136 CTGACGAAGAGAAGGGAAGATGG - Intergenic
1197098394 X:122622427-122622449 CTGAAGGTGAGGAGGGAGGCGGG + Intergenic
1197355137 X:125430316-125430338 GAGAAGGAGAAGGGGGAAAAGGG - Intergenic
1197383028 X:125768877-125768899 CTTAAGGACAAGTGGGAAGAGGG - Intergenic
1197673427 X:129303652-129303674 CAGAAGGTGAAGGGGGAAGCAGG - Intergenic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1197835847 X:130692888-130692910 ATGAATCAGAAGAGGGAATACGG - Intronic
1197953226 X:131919612-131919634 CTGAAGGAAAAGACACAAGATGG + Intergenic
1198275660 X:135095709-135095731 CTGGAGGAGAAGAGGAGTGAGGG - Intergenic
1199431405 X:147764491-147764513 CTGTAGCAGAAAAGGGAAAAAGG - Intergenic
1199579498 X:149347189-149347211 CTCAAGAAGAAAAGGGAGGAAGG - Intergenic
1199613246 X:149635176-149635198 CTGAGAGAGAAGAGGGAGGGAGG + Intergenic
1199671987 X:150155344-150155366 CAGGTGGAGAAGGGGGAAGATGG - Intergenic
1199845598 X:151690728-151690750 GTGAAGGAGAACAGAGAAGCTGG - Intergenic
1199911102 X:152287793-152287815 ATGAAGGAGGAGAGGAAAGAAGG - Intronic
1200414210 Y:2890861-2890883 AAGAAGGAGGAGAAGGAAGAGGG + Intronic
1200773022 Y:7144739-7144761 GTGAAAAAGAAAAGGGAAGATGG - Intergenic
1200875728 Y:8152720-8152742 CTGAAGGAAGCCAGGGAAGAAGG - Intergenic
1201146591 Y:11068046-11068068 GGGAGGGAGAAGAAGGAAGAGGG + Intergenic
1201146605 Y:11068095-11068117 GAGAGGGAGAAGAAGGAAGAGGG + Intergenic
1201349663 Y:13025825-13025847 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1201452430 Y:14130573-14130595 GAGAAGGTGAAGAGGGAAGGAGG - Intergenic
1201458958 Y:14201452-14201474 CTGGAGGAGAGGAGGGAAATGGG + Intergenic
1201463614 Y:14255757-14255779 AGGAGGGAGAAGAGAGAAGAAGG - Intergenic
1202102691 Y:21327191-21327213 CTGAAGGAAGCCAGGGAAGAAGG - Intergenic
1202134520 Y:21647812-21647834 TTGAAGGAGAAAAGGCAGGATGG + Intergenic
1202188979 Y:22221403-22221425 CTGAAGGAAGCCAGGGAAGAAGG - Intergenic
1202239764 Y:22754458-22754480 CTGAAGGAAGCCAGGGAAGAAGG + Intergenic
1202392750 Y:24388220-24388242 CTGAAGGAAGCCAGGGAAGAAGG + Intergenic
1202478033 Y:25281897-25281919 CTGAAGGAAGCCAGGGAAGAAGG - Intergenic