ID: 1045203423

View in Genome Browser
Species Human (GRCh38)
Location 8:100011051-100011073
Sequence GTCAATGCATGGAGGCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045203419_1045203423 -2 Left 1045203419 8:100011030-100011052 CCAAGCAGAAGCAAAACACAGGT 0: 1
1: 0
2: 3
3: 26
4: 277
Right 1045203423 8:100011051-100011073 GTCAATGCATGGAGGCCTATGGG No data
1045203417_1045203423 -1 Left 1045203417 8:100011029-100011051 CCCAAGCAGAAGCAAAACACAGG 0: 1
1: 0
2: 4
3: 44
4: 336
Right 1045203423 8:100011051-100011073 GTCAATGCATGGAGGCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045203423 Original CRISPR GTCAATGCATGGAGGCCTAT GGG Intronic
No off target data available for this crispr