ID: 1045204698

View in Genome Browser
Species Human (GRCh38)
Location 8:100026015-100026037
Sequence CCTAAGGTATAGTAGGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045204690_1045204698 19 Left 1045204690 8:100025973-100025995 CCTGTGCTTTGTTCACCAAGGTG 0: 1
1: 0
2: 3
3: 9
4: 144
Right 1045204698 8:100026015-100026037 CCTAAGGTATAGTAGGTGTTTGG No data
1045204693_1045204698 -7 Left 1045204693 8:100025999-100026021 CCAGCACCAATCACAGCCTAAGG 0: 1
1: 0
2: 0
3: 12
4: 140
Right 1045204698 8:100026015-100026037 CCTAAGGTATAGTAGGTGTTTGG No data
1045204691_1045204698 4 Left 1045204691 8:100025988-100026010 CCAAGGTGTTCCCAGCACCAATC 0: 1
1: 0
2: 2
3: 8
4: 162
Right 1045204698 8:100026015-100026037 CCTAAGGTATAGTAGGTGTTTGG No data
1045204692_1045204698 -6 Left 1045204692 8:100025998-100026020 CCCAGCACCAATCACAGCCTAAG 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1045204698 8:100026015-100026037 CCTAAGGTATAGTAGGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045204698 Original CRISPR CCTAAGGTATAGTAGGTGTT TGG Intronic
No off target data available for this crispr