ID: 1045205570

View in Genome Browser
Species Human (GRCh38)
Location 8:100036281-100036303
Sequence ATGGTGTTGGCAAGGAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 393}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045205570_1045205577 24 Left 1045205570 8:100036281-100036303 CCCTTTCTCCTTGCCAACACCAT 0: 1
1: 0
2: 2
3: 35
4: 393
Right 1045205577 8:100036328-100036350 TATTCTATCTTGAAGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045205570 Original CRISPR ATGGTGTTGGCAAGGAGAAA GGG (reversed) Intronic
903920885 1:26799853-26799875 CAGCTGTTGGCAAGGAGAAAGGG - Intergenic
904817892 1:33219541-33219563 ATGGTGTTCCCAGGCAGAAAAGG + Intergenic
904870940 1:33617693-33617715 ATGCTGGTGGCAGGGAGAAGGGG + Intronic
904961629 1:34337812-34337834 ATGGCTTTTGCAAGGAGACAGGG + Intergenic
905036927 1:34924742-34924764 ATGGTTTTGGAAGGGAGAGAGGG + Intronic
905094905 1:35461835-35461857 ATGGTGCTGGCAAGAAGAGGAGG - Intronic
905565649 1:38962371-38962393 GTGGTTTTGGCAGGGAGTAATGG - Intergenic
905709179 1:40086367-40086389 ATGGTGAGGGCAACGAGGAATGG - Intronic
906085530 1:43130189-43130211 ATGGTGTTTGCAATGATAATGGG - Intergenic
906481278 1:46200808-46200830 CTGGATTTTGCAAGGAGAAAAGG - Intronic
906652042 1:47519752-47519774 ATGGTGTGGGCAGGGAGGGAGGG + Intergenic
908412225 1:63878317-63878339 ATGGTGTTGTCAAAGCAAAATGG - Intronic
908666725 1:66500517-66500539 AGGATGTGGGCAAGGAGAAAAGG + Intergenic
908878727 1:68707014-68707036 AAGGTGTTGGTAAGGAAAACAGG + Intergenic
909622099 1:77680433-77680455 ATGATGTTGGAAAGAGGAAAAGG - Intronic
909692002 1:78419894-78419916 ATACTGCTGGCAAGAAGAAAAGG + Intronic
909867466 1:80692238-80692260 ATGTTGTGGGCTAGAAGAAAAGG + Intergenic
910837087 1:91525427-91525449 ATGAAGTAGGCAAAGAGAAAAGG + Exonic
911245953 1:95517655-95517677 AAGTTGTTGGCAAGGATATATGG + Intergenic
911445914 1:97991578-97991600 ATGGTGTTAACAAAGAGAAGAGG - Intergenic
912128115 1:106565709-106565731 AGGGTGTAGGCAGGGAGAATTGG + Intergenic
912635909 1:111292665-111292687 ATGGAGATGGAAAGGAGAGATGG - Intronic
912677246 1:111694784-111694806 ATTGTGGTGGAAAAGAGAAAGGG - Intronic
913319302 1:117577287-117577309 TTGCTGTTGGGAAGGAGGAAGGG - Intergenic
914220248 1:145674993-145675015 AGGGTATTGGCAAGCAGCAAAGG - Intronic
914472825 1:147997855-147997877 AGGGTATTGGCAAGCAGCAAAGG - Intergenic
916308525 1:163367707-163367729 ATGTCATTGGCAAGAAGAAAAGG + Intergenic
916650952 1:166834018-166834040 ATGCTTCTGGCAAGGAGAACGGG + Intergenic
916931856 1:169586752-169586774 GTGGTGTTGGCAGGTGGAAATGG - Intergenic
917489440 1:175485436-175485458 AGGACATTGGCAAGGAGAAAGGG + Intronic
917518292 1:175727023-175727045 AAGGAGTAGGCAGGGAGAAAGGG - Intronic
917771212 1:178280877-178280899 ATAGGATTGGCAAGGTGAAATGG + Intronic
918820134 1:189243135-189243157 AGGGTAGTGGCAATGAGAAATGG + Intergenic
920739610 1:208568044-208568066 AAGGTGGGGGCAAGGAGGAAGGG + Intergenic
921136160 1:212261042-212261064 AGTGAATTGGCAAGGAGAAAAGG - Intergenic
921279335 1:213550161-213550183 ACGGTCTTGGCAAGAAGCAATGG + Intergenic
923263751 1:232292684-232292706 AGAGTGTTGGCAAGAGGAAAGGG - Intergenic
923460224 1:234203423-234203445 ATGGTTTTGGCCAGGCGCAAGGG + Intronic
924003733 1:239583638-239583660 TGGGTGTGGGGAAGGAGAAAAGG - Intronic
924540536 1:244976682-244976704 CTGTTGGTGGCAATGAGAAATGG + Intronic
1063780634 10:9318475-9318497 AGGGTGGTGGCAATGAGGAATGG + Intergenic
1064022524 10:11821296-11821318 ATGGGGTTGGCAAGGAAGAAGGG - Intergenic
1064119994 10:12610241-12610263 ATGGTGATGGCCAGGTGACAAGG + Intronic
1064287038 10:14000686-14000708 ATCGTGTTCTCAAGGAGAAAGGG - Intronic
1064853324 10:19735440-19735462 AAGGTGTTGAAGAGGAGAAAAGG + Intronic
1066656792 10:37704422-37704444 ATGGTGTGGGCAAGCAGATGAGG - Intergenic
1067786359 10:49252010-49252032 ATGGAACTGGCAAGGAGAAAGGG + Intergenic
1067961547 10:50857736-50857758 TTGTTGTTGGCAAGGAGAAGTGG + Intronic
1068140488 10:53000333-53000355 ATGGTGTTTGCTAGGAGATGAGG + Intergenic
1068656556 10:59581954-59581976 ATGGTGAGGGCAAGGGGAGAAGG + Intergenic
1070668498 10:78362032-78362054 TTGGAGTGGGGAAGGAGAAACGG + Intergenic
1071311303 10:84347235-84347257 ATGGTTTTGTCAAATAGAAAAGG - Intronic
1071467003 10:85950548-85950570 ATGGTCTTGTCAAGGAGCAGAGG + Intronic
1072574215 10:96685499-96685521 AAGGTGGTGGCAAGGAAAGAGGG + Intronic
1072683343 10:97522325-97522347 ATGGTGTGGGCAATGAGACAGGG - Intronic
1072747720 10:97953110-97953132 ATGGTGGGTGCAAGGAGGAAGGG - Intronic
1072866186 10:99064518-99064540 ATGGTGGTGGTAAGGAGAGAGGG - Intronic
1073037691 10:100575726-100575748 ATGCTGATGGCATGGAGAGAGGG - Intergenic
1073739356 10:106388880-106388902 ATGGTGATCTCATGGAGAAAGGG + Intergenic
1074121073 10:110494968-110494990 ATGGTGTTGGCCAGGGGTAGTGG + Intergenic
1074551289 10:114444858-114444880 AGGATGTGGGCCAGGAGAAAAGG - Intronic
1074553099 10:114463403-114463425 ATGGCTTTGGTGAGGAGAAATGG + Intronic
1075958433 10:126545610-126545632 ATGGGTTTGCCAAAGAGAAAAGG - Intronic
1076408425 10:130229361-130229383 AGGGGGTTGGCATGGAGAGATGG + Intergenic
1077133572 11:987242-987264 ATAGTGCTGACAAGTAGAAATGG + Intronic
1077725374 11:4669499-4669521 ATGGTGGTGGCCAGGAGACGGGG - Intergenic
1077727543 11:4690451-4690473 AGGGTGTTGGCAGGGACAGAAGG + Intronic
1077832339 11:5887312-5887334 TTGGTGTTGGTAATGAGAAGAGG + Intronic
1077863223 11:6201033-6201055 ATGATGTTGGCCAAGACAAATGG - Intergenic
1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG + Exonic
1079089097 11:17468245-17468267 ATGGTGTTGTCAGGGAGTACAGG - Intronic
1079289420 11:19173839-19173861 ATGGAGTTGGGAGGGAGGAAGGG + Intronic
1079813128 11:25021269-25021291 ATGGTGTTTTCAAGGATAATTGG + Intronic
1079888003 11:26013446-26013468 ATGGTGGTTGCCAGGAGATAGGG + Intergenic
1080106321 11:28514703-28514725 TTGGTGGTGGCAAGGTGAACAGG - Intergenic
1080110123 11:28557264-28557286 ATGGAGTTGGCTATTAGAAATGG - Intergenic
1081047815 11:38297722-38297744 ATGGTGTTTGTAAGGTTAAAAGG + Intergenic
1081092032 11:38883519-38883541 ATGGTGTTGGGGATGAGAAATGG - Intergenic
1082822900 11:57556667-57556689 ATGGTCTCAGTAAGGAGAAAAGG + Intronic
1083113048 11:60430846-60430868 ATGGTTTTAACAAGGTGAAAAGG - Exonic
1086011802 11:82113533-82113555 ATGGTCTTGTCAAGGAAAGATGG + Intergenic
1086589649 11:88497365-88497387 ATGGTGGTTGCCAGGAGCAAGGG + Intergenic
1087017649 11:93569951-93569973 ATGGTAGTTGCAAAGAGAAAGGG - Intergenic
1088741818 11:112773803-112773825 GTGATGATGGGAAGGAGAAAAGG + Intergenic
1088757963 11:112902502-112902524 CTGGTGTGGGGAAGGAGAGAGGG - Intergenic
1089402822 11:118174413-118174435 ATGGAGGTGGCAAAGAGAAAGGG - Intronic
1090450337 11:126800602-126800624 ATGCTGTTTGCAGGCAGAAAAGG - Intronic
1091805629 12:3353967-3353989 AAGGTGCTGGCAAGTAGAGAAGG - Intergenic
1092164590 12:6335223-6335245 CCGGGGTTGGCAAGGACAAATGG + Intronic
1094292431 12:28866984-28867006 ATGCTTTTTCCAAGGAGAAAGGG + Intergenic
1095537512 12:43269027-43269049 ATGTGGTTGCCAGGGAGAAAAGG - Intergenic
1096724548 12:53550538-53550560 AAGGTGATGGCAGGGAGAATAGG + Intronic
1096865075 12:54557811-54557833 ATGGTGTAGGGAGGGAGAAGAGG + Intronic
1097964493 12:65564463-65564485 ATGGTTTTGGGAAGGAGAGGGGG - Intergenic
1098117509 12:67195640-67195662 AAGGTGTTGGTCAGGAAAAATGG + Intergenic
1098634594 12:72766463-72766485 ACAGTGTTGGGAAGGAGAAGGGG - Intergenic
1099771274 12:87060967-87060989 ATGGTGTCACCAAGGGGAAATGG - Intergenic
1099947781 12:89264589-89264611 GTGGTGTTGGGAGGAAGAAAAGG + Intergenic
1100242553 12:92724345-92724367 ATGGAGTTGGCAAACAAAAAAGG + Intronic
1101408460 12:104449470-104449492 ATGGTGTGGCCAAGGAGATAGGG + Intergenic
1101452554 12:104793188-104793210 ATGGTGTTGGTAAGGTCAGATGG + Intergenic
1102072697 12:110035030-110035052 ATGGTGGTGGCAGGGGGAAGTGG - Intronic
1105745135 13:23370610-23370632 AGGGTGGGGGCAGGGAGAAATGG - Intronic
1105994832 13:25660522-25660544 ATGATGTTGGCAGAGAGAGATGG + Intronic
1106779014 13:33037803-33037825 ATGGTGTTGGCTGGGACAAATGG - Intronic
1107733498 13:43371941-43371963 ACTGTGTGGGCAAGGAGAACGGG + Intronic
1107764945 13:43724467-43724489 ATAGTGTTGCCAAGGAGTGAGGG - Intronic
1108492382 13:50994250-50994272 AGGGTGGTGGGAAGGAGAAAGGG - Intergenic
1108873109 13:55011066-55011088 ATTGTGTTGGTAAGAAGATATGG - Intergenic
1109031094 13:57189261-57189283 ATTGAGTTGGTCAGGAGAAATGG + Intergenic
1110016876 13:70416576-70416598 ATTGTGTTGGAAAGGAGATTTGG + Intergenic
1110044026 13:70806359-70806381 CTGGTGTCTCCAAGGAGAAAAGG - Intergenic
1110523777 13:76511908-76511930 CTGGTGTTGACAAAGAGAAAAGG - Intergenic
1111410360 13:87868147-87868169 CTGGTGTTGGCCAGAACAAATGG + Intergenic
1111827395 13:93284895-93284917 ATGGTCTGGGAAATGAGAAAAGG + Intronic
1111840399 13:93442363-93442385 ATGCTGGTAGAAAGGAGAAAAGG + Intronic
1111913594 13:94338360-94338382 ATGGTGCTGGCAAGCAGGATTGG - Intronic
1113148697 13:107238340-107238362 ATGCTGTTTGCAAGGTGAGAAGG + Intronic
1113347180 13:109490517-109490539 TTGGTGTTGGCCAAGAGGAAGGG + Intergenic
1113995293 14:16059280-16059302 ATGGGGTTGCCAAGGGGAAGGGG + Intergenic
1114304774 14:21412594-21412616 GGGGTGTTGGGAAGGGGAAAGGG - Intronic
1114940375 14:27603086-27603108 ATGATTTTGGCAAAAAGAAAAGG + Intergenic
1115972659 14:38963176-38963198 ATGTTGTGGGAAAGGAAAAAGGG - Intergenic
1116014437 14:39389350-39389372 ACAGTGGTGGCAAGGAGAGATGG + Intergenic
1116699855 14:48226706-48226728 ATGGTGGCAGCAAAGAGAAATGG + Intergenic
1116967159 14:51026557-51026579 ATTGTGTTGGCAAGGAGAATAGG - Intronic
1117324215 14:54653945-54653967 ATGGTATTTGCAAGGGCAAATGG - Intronic
1120693944 14:87622919-87622941 ATGGGCTTGGCAGGGAGAGAGGG - Intergenic
1120892467 14:89503577-89503599 CCGGTGTTGGTAAGGAGAATTGG - Intronic
1121343148 14:93116526-93116548 CTGGGTTTGGGAAGGAGAAATGG + Intergenic
1121894654 14:97635600-97635622 TTGGTGTTGGCAAGATGACAAGG - Intergenic
1122158227 14:99763981-99764003 GCGGTGTTAGCAAGAAGAAAAGG - Intronic
1122211827 14:100178533-100178555 CTGGTGGTGGGAAGGAGCAAGGG + Intergenic
1122491120 14:102116807-102116829 ATGGGGTGGGCAGGCAGAAAGGG + Intronic
1122705260 14:103616938-103616960 ATGGGGGTGGCAAGCAGGAAGGG - Intronic
1123426462 15:20174866-20174888 ATGGGGTTGGCCAGGCGTAATGG - Intergenic
1123535693 15:21181392-21181414 ATGGGGTTGGCCAGGCGTAATGG - Intergenic
1124473992 15:30015356-30015378 ATATTGTTTGCAAGGAGAGATGG + Intergenic
1126873083 15:53010466-53010488 TTGGTGTTGGCAAGAGAAAAGGG + Intergenic
1127390519 15:58501527-58501549 ATGGGGTGGGGAGGGAGAAAAGG + Intronic
1128993584 15:72280397-72280419 ATGGTGTTTGAAAGGAGAAATGG - Intronic
1129482463 15:75838732-75838754 AGGGTGTTGAGAAAGAGAAATGG - Intergenic
1129952618 15:79605505-79605527 ATGTTGTTTGGAAGGGGAAATGG - Intergenic
1130126562 15:81098923-81098945 GGGGTGTTGACAAGGAGGAAAGG + Intronic
1130154011 15:81334082-81334104 GGGGTCTTGACAAGGAGAAAGGG - Intronic
1130625021 15:85505411-85505433 TTTGTGTTGGCATTGAGAAAGGG + Intronic
1131520557 15:93111007-93111029 TTGCTGTTGGGAATGAGAAAAGG + Intergenic
1131750080 15:95496582-95496604 AGAGTGTTGGAAAGGAGAAATGG - Intergenic
1133151365 16:3834513-3834535 AGGGTTTTGGGAAGGAGAGAGGG + Intronic
1133881726 16:9788640-9788662 ATAGTGTGGGGAAGGAAAAAGGG - Intronic
1134802699 16:17100071-17100093 CTGGTGTTGGCAAGTTGTAAGGG - Intergenic
1135196884 16:20402221-20402243 ATGGTAATGCAAAGGAGAAAAGG + Intronic
1137990173 16:53146040-53146062 ATGGTGATTGCCAGGAGTAAGGG + Intronic
1138444446 16:57054782-57054804 AAGGTGTTGGCCAGCAGGAAGGG - Exonic
1138713980 16:59000714-59000736 ATGGGGTTGATAAAGAGAAAGGG - Intergenic
1138905562 16:61327006-61327028 ATGGTGTGGGAAAGGAGACAAGG - Intergenic
1139137641 16:64224006-64224028 AGGGTGCTGGGAAGGGGAAAAGG + Intergenic
1139228545 16:65257499-65257521 CAGATGCTGGCAAGGAGAAATGG - Intergenic
1139517624 16:67461083-67461105 ATGGTGTCTGCCAGGAGAAATGG - Intronic
1140834679 16:78782153-78782175 AAGGTGATGGCAAGGCGAGAAGG - Intronic
1141186366 16:81790368-81790390 ATGGTGTTGGTAAAGTGACAGGG + Intronic
1141203311 16:81913837-81913859 GTGGTGCAGGCAAGGAGGAAGGG - Intronic
1141258144 16:82422981-82423003 ATGCTGTGAGGAAGGAGAAATGG + Intergenic
1141279450 16:82617863-82617885 TTGGTCTTGGCAAAGAGAATAGG + Intergenic
1141623655 16:85250180-85250202 CTGGTGTGGGCAAGGGGAAGAGG - Intergenic
1142688786 17:1592569-1592591 ATGCTGTTGGCGAGGAGAGGGGG - Intronic
1143433948 17:6908869-6908891 GTGGTGTTAGCATGGAGACAGGG + Intronic
1145866051 17:28242287-28242309 ATGGTGTTGGGCAGGGGAAGAGG + Intergenic
1146256456 17:31393700-31393722 ATGGAGCTGGGAAGGAGAGAAGG - Intronic
1146455355 17:33005279-33005301 ATGGAGTTGGCATGTAGAATGGG + Intergenic
1147781223 17:42943749-42943771 ATTATGCTGGCAAGCAGAAATGG + Intergenic
1148042577 17:44720511-44720533 ATGTTGGTGGCAAGGTGAAAAGG - Intronic
1149141268 17:53435939-53435961 AGGGTGGTGGCAAGCAGAATGGG - Intergenic
1149468676 17:56899078-56899100 ATGCTGTTGCCATGGAGACAGGG + Intronic
1150439697 17:65181279-65181301 CAGATGCTGGCAAGGAGAAAAGG - Intronic
1150448419 17:65245470-65245492 GTGGAGGTGGGAAGGAGAAATGG + Intergenic
1151129478 17:71881637-71881659 AGGGTCTTGGCAACCAGAAAGGG + Intergenic
1151436406 17:74100316-74100338 ATGGTGTCTGAAAGGAGAAGTGG - Intergenic
1151443131 17:74146550-74146572 ATGGTGGGGGCAGGGAGAAAGGG - Intergenic
1151877175 17:76873405-76873427 ATCGTGTGGGCAAGGAGTGATGG - Intronic
1152766410 17:82142633-82142655 ATGATGGTGAGAAGGAGAAATGG + Intronic
1153288541 18:3478517-3478539 ACACTGTTGGAAAGGAGAAAGGG - Intergenic
1153712886 18:7818079-7818101 AGGGTGTTGGCTAAGATAAAAGG - Intronic
1153776337 18:8457411-8457433 CTGGTGAGGGCAAGGAGAGATGG + Intergenic
1154982581 18:21515756-21515778 TTTATGTGGGCAAGGAGAAAGGG + Intronic
1156811621 18:41259924-41259946 ATGGAGTTGGCATGGAGTTATGG - Intergenic
1157313860 18:46572414-46572436 ATGGTCTTGGGAAGGAGACCAGG + Intronic
1157520902 18:48344494-48344516 ATGGTGAGGGGAAGGGGAAAGGG + Intronic
1157636904 18:49166862-49166884 TTGGTGTTAGGAAGAAGAAATGG + Intronic
1158440633 18:57471350-57471372 ATGGGGAAGGCATGGAGAAAGGG + Intronic
1159179844 18:64888541-64888563 TTGGTGTTGGCAAGAACATATGG - Intergenic
1159955024 18:74513034-74513056 CTGGCGTTGGCAGGGAGGAATGG - Intronic
1162190784 19:8944903-8944925 AGGGTTTTAGGAAGGAGAAATGG - Intronic
1162803417 19:13123493-13123515 ATGGTGGTTGCAGGGAGAAGGGG + Intronic
1163240631 19:16061246-16061268 GTGGGGCGGGCAAGGAGAAAAGG - Intergenic
1163697198 19:18769909-18769931 CTGGAGTTGGAAAGGACAAAGGG - Intronic
1165374979 19:35435438-35435460 ACCCTGTTGGCAAGGAAAAAGGG - Intergenic
1165498564 19:36169300-36169322 AAGGTGCTGGGGAGGAGAAATGG - Intergenic
1167304693 19:48700951-48700973 GTGGTGTTACCAAGGAGAAAAGG + Intronic
1167305303 19:48704904-48704926 GTGGTGTTACCAAGGTGAAAAGG + Exonic
1168495355 19:56843311-56843333 ATGTTGGTGGTAAGGAAAAAAGG - Intergenic
925944341 2:8846842-8846864 ATGGTGGCAGCAAGGAGGAATGG + Intergenic
926242981 2:11102206-11102228 ATGCTGGTGGCAAGGTGAAAAGG + Intergenic
926287695 2:11502996-11503018 CTCATGTTGGAAAGGAGAAAGGG + Intergenic
928234783 2:29530104-29530126 GTGGAGTTGGGAAAGAGAAAGGG - Intronic
928861605 2:35863947-35863969 ATGGAGCTGGCAAGGAAAAAAGG + Intergenic
929214571 2:39398105-39398127 AGGGTGTTTGCTAGGTGAAAGGG - Intronic
929531089 2:42753309-42753331 ATGGTGGAGGCAAGATGAAAGGG - Intronic
931349177 2:61472405-61472427 GTTGTGTTGGCAGGGAAAAAAGG - Intergenic
931787043 2:65629488-65629510 ATGCTGGTGGCAGGGAGAATGGG + Intergenic
932392626 2:71410533-71410555 ATAGTGTTAGCATAGAGAAAAGG - Intronic
932816234 2:74864414-74864436 ATGGCCTTGACAGGGAGAAAGGG + Intronic
935257694 2:101327068-101327090 ATGGGGTAGGCAGGGTGAAAAGG + Intergenic
935307670 2:101753318-101753340 ATGGGGTAGGCAAGGGAAAAGGG - Intronic
935315644 2:101831051-101831073 ATAGTGTTGGCAGGGAGTGATGG + Intronic
936975535 2:118217870-118217892 ATGGTGTTGGCAAGGGAATGAGG - Intergenic
938536183 2:132251478-132251500 ATGGGGTTGCCAAGGGGAAGGGG - Intronic
940924414 2:159348029-159348051 ATGGTGTTGGCCAGGAGTGGTGG + Intronic
942252861 2:174062516-174062538 ATTTTGTTGGCAAGGAAAAGGGG + Intergenic
942667928 2:178341810-178341832 TTGGTTTGGGCAAGCAGAAAAGG - Intronic
943002731 2:182349303-182349325 TTGATTTTGGCAAAGAGAAATGG - Intronic
944646260 2:201783619-201783641 ATGAGGTTGGAAAGGAAAAAAGG - Intergenic
945839964 2:214875823-214875845 ATGGGGTTGGCAAGGGGAGGGGG - Intergenic
947036686 2:225866743-225866765 GTGGTGTTTGCAGGCAGAAAGGG - Intergenic
948662581 2:239516273-239516295 ATGGGGCTGCCAAGGTGAAAAGG + Intergenic
1169611019 20:7380216-7380238 ACGTTGTTTGGAAGGAGAAATGG - Intergenic
1169676538 20:8160530-8160552 ATGGTGTCAGCCAAGAGAAAAGG + Intronic
1170328548 20:15183033-15183055 ATGGTGGTGGAAATGAGAATGGG - Intronic
1170690509 20:18611145-18611167 ATGCTGTATGAAAGGAGAAAAGG - Intronic
1171865081 20:30483299-30483321 ATGGGGTTGCCAAGGGGAAGGGG - Intergenic
1171908985 20:30923339-30923361 ATGGGGTTGCCAAGGGGAAGGGG + Intergenic
1172748628 20:37233309-37233331 ATGGTACTGAAAAGGAGAAAAGG - Intronic
1173092741 20:39989497-39989519 ATGCTGCTTGTAAGGAGAAATGG - Intergenic
1175057900 20:56214785-56214807 CTGGTGATGGGAAGGAGAATGGG - Intergenic
1176661698 21:9642074-9642096 ATGGGGTTGCCAAGGGGAACGGG - Intergenic
1178368722 21:32009428-32009450 AGGGATTTGGCAAGGAGATAAGG + Intronic
1178663080 21:34522913-34522935 ATGGTAGTGGGCAGGAGAAAAGG + Intronic
1179222008 21:39416688-39416710 ATGGTGTTGTCATTGAGAACTGG - Intronic
1179340732 21:40506571-40506593 GTGGTGTTGGAAATGTGAAAGGG - Intronic
1180311799 22:11248129-11248151 ATGGGGTTGCCAAGGGGAAGGGG - Intergenic
1180597576 22:16988640-16988662 GTGGTGTTGGCAAGGAAGAGAGG + Intronic
1182187524 22:28422254-28422276 ATGGCTTTGACAAGGAGTAAGGG + Intronic
1182275608 22:29186657-29186679 ATGGTGATGGCTGGGAAAAAGGG + Intergenic
1182642391 22:31778796-31778818 ATGGAGATGGGAACGAGAAAAGG - Intronic
1183720871 22:39560599-39560621 AAGGGGTTGGAAAGGAGAAGTGG - Intergenic
1184505844 22:44901643-44901665 ATGCTGGTGGCAAGGTGAAAAGG + Intronic
1184507791 22:44914593-44914615 GTGGTGTGGGGAGGGAGAAACGG - Intronic
1184955285 22:47881873-47881895 AGGGAGTTGGCAAGGAGTGAGGG + Intergenic
949956955 3:9276862-9276884 ATGGAATTGGAATGGAGAAAGGG + Intronic
950555435 3:13692985-13693007 AGGGAGAGGGCAAGGAGAAAGGG - Intergenic
951227104 3:20133101-20133123 ATGGTAGTGGGAAGGGGAAATGG - Intronic
951586012 3:24215430-24215452 TTGGAGTTGGCATGGAGTAATGG - Intronic
951750942 3:26035778-26035800 ATGGTTATGGCAACTAGAAATGG + Intergenic
952175349 3:30856762-30856784 TGGGGGTTGGCAAGGAGAAGAGG + Intronic
952351617 3:32544363-32544385 AGCTTTTTGGCAAGGAGAAAAGG + Intronic
953439017 3:42902184-42902206 TTGATGTTGCCTAGGAGAAATGG + Intronic
954008425 3:47612643-47612665 ATGTTGTAGGCAAGGAAAATTGG - Intronic
954111754 3:48437457-48437479 ATGTTCCTGGCAAAGAGAAAAGG + Intronic
954720756 3:52560570-52560592 ATGCTGTATGAAAGGAGAAAAGG + Intronic
954773149 3:52991979-52992001 ATGGTGTTGGAACACAGAAATGG - Intronic
955994954 3:64670363-64670385 ATGGTCTAGGCCAAGAGAAAAGG - Intronic
955996233 3:64683804-64683826 ACCCTGTTGCCAAGGAGAAAAGG + Intronic
956258018 3:67305045-67305067 ATGTTGTTAGTAAGGACAAAGGG - Intergenic
956307586 3:67843111-67843133 ATTGTGTGGGGAAGGAGAGACGG - Intergenic
959945670 3:112123247-112123269 ATGGTGTTGTTCAGGATAAATGG + Exonic
962291006 3:134136374-134136396 GTGGAGTTGGCCAGGAGAAAGGG - Intronic
962616373 3:137130760-137130782 ATTTTGCTGGCCAGGAGAAATGG + Intergenic
962682174 3:137811808-137811830 ATGGAGGTGGCTAGGATAAAGGG - Intergenic
962824855 3:139091458-139091480 AGGGTGTTGGGAAGAAGCAAGGG - Intronic
963447117 3:145426867-145426889 ATGGTGCTTGCCAGGAGCAATGG - Intergenic
965340967 3:167490830-167490852 GTGGTGTTTCCAAGGAGAAGAGG - Intronic
966227653 3:177615265-177615287 AGGATGTTGGCCAGGGGAAAGGG + Intergenic
966245208 3:177800790-177800812 ATGGTGAGGCCATGGAGAAAAGG + Intergenic
967988476 3:195113779-195113801 AGGGTTGTGGCCAGGAGAAAAGG + Intronic
968528732 4:1078671-1078693 CTGTTGGTGTCAAGGAGAAAGGG - Intronic
968715374 4:2154506-2154528 CTTGTGTTGGCAAGGATTAAGGG + Intronic
971709698 4:30094465-30094487 AGGGAGTTAGAAAGGAGAAAAGG + Intergenic
972128924 4:35805264-35805286 ATGATGGTAACAAGGAGAAAAGG + Intergenic
972979397 4:44677880-44677902 AAGGTTTTGGCAAGAAGTAAAGG - Intronic
974113385 4:57551170-57551192 ATGGGTTAGGGAAGGAGAAATGG - Intergenic
974696224 4:65376609-65376631 ATGGTTTTGGGAAACAGAAAAGG + Intronic
975871248 4:78781106-78781128 ATGATGTTGGCAAGGTGACCAGG + Intronic
976145275 4:82036626-82036648 ATGGAGTTAGAAAGGAGAAGTGG + Intronic
976151030 4:82092002-82092024 CTGGGGTTGGGAAGGAAAAATGG + Intergenic
976514331 4:85946965-85946987 TTGGTGAGGCCAAGGAGAAAAGG - Intronic
976593237 4:86870255-86870277 ATGCTGGTGGCAAGGTAAAAAGG + Intergenic
976822474 4:89222067-89222089 ATGGTGTTTGCCAGGGGTAAGGG - Intergenic
977125083 4:93155340-93155362 AAGATGTTGGGGAGGAGAAAAGG - Intronic
978430347 4:108626724-108626746 ATGGTGTTGGCCGGGTGCAAGGG - Intronic
978959407 4:114658248-114658270 TTGGTGTTGGGAATAAGAAAAGG + Intronic
978986162 4:115015428-115015450 ATTTTGTTTGGAAGGAGAAATGG + Intronic
979532443 4:121783440-121783462 AAGGAGGTGGTAAGGAGAAAGGG - Intergenic
979545770 4:121938442-121938464 CTGGTGCTGGCAATGAGAATTGG - Intronic
981236353 4:142420311-142420333 ATAGTCCTGGCAAGGAGAAGTGG + Intronic
981582260 4:146261482-146261504 ATAGTGTTGGAAAGCTGAAAAGG - Intronic
981861645 4:149362565-149362587 ATGGTGGTGGCAAGAGAAAATGG - Intergenic
983003895 4:162458193-162458215 GTGGAGGAGGCAAGGAGAAAAGG - Intergenic
983024513 4:162716338-162716360 ATGGTGGGGGTAAGGAGACAGGG + Intergenic
983383198 4:167023493-167023515 AAGTTGTTGGCAAAGAGTAAGGG + Intronic
983962535 4:173772112-173772134 ATGGGGTTGGAAGGGAGTAAGGG - Intergenic
986022434 5:3817090-3817112 ATGTTCTTGACAAGGAGAGAGGG - Intergenic
987188314 5:15447346-15447368 ATGGTACTGGCAAGTAAAAATGG + Intergenic
987803014 5:22722063-22722085 AGGGTGTAGCCAAAGAGAAAAGG - Intronic
987984392 5:25127399-25127421 TTGGTGTTGGCAATTGGAAAGGG + Intergenic
988517446 5:31917078-31917100 ATGGAGCTGGCAAGGAAAACAGG + Intronic
988639069 5:33021000-33021022 ATGGTTTTGGCAATGATAAATGG + Intergenic
988932691 5:36052508-36052530 ATGGGGTTGGGAAGGGGAAATGG - Intronic
989009975 5:36859034-36859056 ATGGTGGTGGCAAGAAGGAGTGG + Intergenic
990288153 5:54321336-54321358 AAGGTCATGGCAAGGAGACAGGG - Intergenic
990398006 5:55404409-55404431 ATGGTTTTAGCAAAGAGAATAGG - Intronic
991076779 5:62548664-62548686 ATACTTTTGGGAAGGAGAAAGGG - Intronic
991180305 5:63743607-63743629 ATGATGTTTGCAAGAGGAAAAGG + Intergenic
991253959 5:64594676-64594698 AGGGTGTTGGTAAAGAGAAGAGG - Intronic
991557977 5:67917062-67917084 ATGGTCATGGCTGGGAGAAAGGG + Intergenic
991639283 5:68737288-68737310 ATGTTGCTGGCAAGGAAAAGAGG + Intergenic
992617039 5:78554856-78554878 ATGGTGCTGGGAAGAATAAAAGG - Intronic
993122433 5:83792854-83792876 TTGCTGTAGGCAAGCAGAAAAGG + Intergenic
993321935 5:86481323-86481345 ACAGTGTTGGAAAGGAGACAAGG - Intergenic
993849744 5:92991969-92991991 ATGCTGGTGGCCAGGAGAAGGGG + Intergenic
994683952 5:102925617-102925639 ATGATGCTGGCAATGAGTAAGGG - Intronic
994832873 5:104809192-104809214 ATGATGGTGGGAAGGAGAAGTGG + Intergenic
995685635 5:114769022-114769044 AGGGGGTTGGTAGGGAGAAAAGG - Intergenic
996952821 5:129148399-129148421 ATGGTGTTGGGAAAGAAAACTGG - Intergenic
997108375 5:131046922-131046944 ATGGTGGTGGCAAGAGAAAAAGG + Intergenic
997675034 5:135706618-135706640 GTGGTGTGCGCATGGAGAAAGGG + Intergenic
998497496 5:142603377-142603399 GTGGTATTGGCAGGGAGAATGGG - Intronic
999118928 5:149192754-149192776 GTGGTGTTGGTGAGTAGAAATGG - Intronic
999131292 5:149285413-149285435 AGGGTTGTGGCAAGAAGAAAGGG - Intronic
1000432142 5:161164773-161164795 ATGGGGGTTGCCAGGAGAAAGGG - Intergenic
1004173437 6:13317362-13317384 ATGGTGTTTGAAAGCAGAAGAGG - Intronic
1006180622 6:32151591-32151613 ATGTTGTTGGCAAGGGGCAGAGG + Intronic
1007314811 6:40978896-40978918 GTGGTGTTAGCATGGAGACAGGG + Intergenic
1008876173 6:56330936-56330958 CAGATGTTGGCATGGAGAAAAGG - Intronic
1009653357 6:66506075-66506097 ATGGTGGCGGGAAGGAGAAATGG + Intergenic
1009766322 6:68080195-68080217 ATGGCTTTGGGAATGAGAAAAGG - Intergenic
1010136345 6:72558311-72558333 ATGGTGTTGACAAGCTGCAATGG + Intergenic
1010496570 6:76539686-76539708 ATGCTGTTAGGAAGGAGAATGGG + Intergenic
1010656542 6:78518284-78518306 GTGGTGTGGGCATGCAGAAAGGG + Intergenic
1011098356 6:83692899-83692921 ATTGTTTTGGGAAGGAAAAATGG - Intronic
1011524639 6:88251253-88251275 GTGAGGTTGGCTAGGAGAAAGGG - Intergenic
1013127940 6:107203394-107203416 AGAGTGTTGGCAATGAGAATGGG - Intronic
1014189225 6:118473736-118473758 ATGGAGGAGGCAAGGAGAAGAGG + Intronic
1014713594 6:124838429-124838451 ATGGTGGCAGCAAGGAGAAGTGG - Intergenic
1015227125 6:130870299-130870321 ATGGTGTTAACATGGAAAAAGGG + Intronic
1015614841 6:135063939-135063961 ATGCCGTTGGCCAAGAGAAAGGG - Intronic
1016237648 6:141887574-141887596 GTGGTGTTGGCATGGGGGAAGGG - Intergenic
1016472057 6:144384944-144384966 AGGGTTATGTCAAGGAGAAACGG - Intronic
1018903778 6:168063801-168063823 AGGGGGCTGGCAAGGAGGAAGGG - Intronic
1019521701 7:1463611-1463633 ATGATGGAGGCAGGGAGAAAGGG + Intergenic
1019526604 7:1483235-1483257 ATGGTGTCAGCCAGGAGTAAAGG + Intronic
1021521745 7:21545421-21545443 ATTGTGTTGGAAGGAAGAAAGGG - Intronic
1022973064 7:35535036-35535058 ATGGTATTTGCAAGCAGAGATGG + Intergenic
1023551147 7:41371031-41371053 ATGTTGTTGGAAAGGAAAAAAGG + Intergenic
1024664161 7:51529160-51529182 ATGGGGTTGTGAAGGATAAAGGG - Intergenic
1026121682 7:67543235-67543257 ATGGTGTGGATAAGGAGAACAGG + Intergenic
1026258925 7:68737269-68737291 ATGGTGTTGGCATAAGGAAAAGG - Intergenic
1026259060 7:68738368-68738390 ATGGTGTTGGCATAAGGAAAAGG - Intergenic
1026259080 7:68738510-68738532 ATGGTGTTGGCATAAGGAAAAGG - Intergenic
1026538717 7:71261856-71261878 ATGGAGGTGGCAATGTGAAAAGG - Intronic
1027602935 7:80261879-80261901 ATGAGGTTGGAAAGGAGACAGGG - Intergenic
1028527694 7:91803555-91803577 AGTGTGGTGGCAATGAGAAAAGG + Intronic
1028726978 7:94099030-94099052 GTAGGGTTGGCAAAGAGAAAGGG + Intergenic
1030168213 7:106575531-106575553 ATGGTATTCTCAAGTAGAAAGGG - Intergenic
1030547461 7:110914947-110914969 TTGGTGATGGTGAGGAGAAAAGG + Intronic
1031652968 7:124314460-124314482 GTGGTGGAGACAAGGAGAAAAGG + Intergenic
1031683206 7:124700104-124700126 ATGGTGGTGGCAAGAAAGAATGG - Intergenic
1031719244 7:125149664-125149686 ATTGTGTTGGCAGGGAGGAAGGG + Intergenic
1032493077 7:132339507-132339529 AATATCTTGGCAAGGAGAAATGG - Intronic
1033183777 7:139206503-139206525 TTGCTGTTGGCATGTAGAAATGG - Intergenic
1034244268 7:149632755-149632777 ATGGTGGAGGCAATGAGAAGTGG - Intergenic
1034406515 7:150906946-150906968 TTGGTGTTGGTGTGGAGAAAAGG + Intergenic
1035447481 7:158952670-158952692 ATTGTGTGGACAGGGAGAAAAGG + Intronic
1035447494 7:158952739-158952761 ATTGTGTGGACAGGGAGAAAAGG + Intronic
1037067070 8:14594933-14594955 AGAGACTTGGCAAGGAGAAAAGG + Intronic
1038262865 8:26012763-26012785 ATGCTGTGAGCAAGGAGACAGGG - Intronic
1039012046 8:33104411-33104433 ACGTGGCTGGCAAGGAGAAAGGG + Intergenic
1039816693 8:41100720-41100742 AGGGTGGTGGCACAGAGAAAGGG - Intergenic
1039968842 8:42304714-42304736 ATAGGGTGGGCAAGGAGGAAGGG - Intronic
1041326175 8:56667697-56667719 ATGGCTTTGGGAAGGAGGAAGGG - Intergenic
1041645086 8:60243380-60243402 ATGGTGTTGAGAAGGAGCTAAGG - Intronic
1043012033 8:74893143-74893165 ATGGTGTAGGAAAGGAAAAGGGG - Intergenic
1043064314 8:75547601-75547623 GTGTTGTTGACAAGGACAAAAGG + Exonic
1044653422 8:94523152-94523174 TTGGTTTTGGGCAGGAGAAAGGG - Intronic
1045205570 8:100036281-100036303 ATGGTGTTGGCAAGGAGAAAGGG - Intronic
1045414950 8:101956801-101956823 ATGGTGTGGGCTAGGTAAAAGGG - Intronic
1045449517 8:102307938-102307960 ATGGAGGTGGTGAGGAGAAAAGG - Intronic
1045586948 8:103548727-103548749 ATATTGTTGGCAAAGAGAAATGG - Intronic
1045690418 8:104754347-104754369 ATGAAGCTGGCAGGGAGAAATGG + Intronic
1046058099 8:109102672-109102694 AGGGTAATGGCAAGGAGAAAAGG + Intronic
1046916739 8:119685546-119685568 ATGGGGCTGGCAAGGTGAACTGG + Intergenic
1048350858 8:133614868-133614890 TTTGTGTTGGCTAAGAGAAAGGG + Intergenic
1048406584 8:134128733-134128755 ATGGTGTAGTCTAGAAGAAAGGG + Intergenic
1048779352 8:137984680-137984702 GTGGTGTGGGCAGAGAGAAAAGG - Intergenic
1048861692 8:138728571-138728593 AGGGTGTTCGCAAGGGGCAAAGG - Intronic
1049464852 8:142746376-142746398 AGAGTGTAGCCAAGGAGAAAGGG - Intergenic
1050073544 9:1841023-1841045 ATGGGGGTGGCAAGGAGCATAGG - Intergenic
1050533656 9:6612044-6612066 ATGGTGTAGGCAAATAGAAAGGG - Intronic
1051141077 9:13979444-13979466 ATTGTCCTGGCAAAGAGAAAAGG + Intergenic
1052255517 9:26451595-26451617 CAGATGCTGGCAAGGAGAAAAGG - Intergenic
1053304993 9:36978084-36978106 ATGGTGTTGGTATGAAGAGATGG + Intronic
1054793393 9:69276572-69276594 ACGGTGTTGGAAAGGAACAATGG + Intergenic
1055362850 9:75512876-75512898 GTGGTGATGGTAGGGAGAAAAGG - Intergenic
1056784652 9:89581796-89581818 ATGATGTTGGACAGGAGACAGGG + Intergenic
1059282150 9:113144191-113144213 ATGGGGAGGGGAAGGAGAAATGG - Intergenic
1060367488 9:123033350-123033372 AGGGTGCTAGCAAGGAGAAGGGG - Intronic
1061620698 9:131809636-131809658 AAGGGGTTGGGAAGGAGATAAGG + Intergenic
1203360288 Un_KI270442v1:215574-215596 ATGGGGTTGCCAAGGGGAAGAGG - Intergenic
1203639260 Un_KI270750v1:143917-143939 ATGGGGTTGCCAAGGGGAACGGG - Intergenic
1186543931 X:10429085-10429107 ATGGTGTTGGCAACAATAACTGG + Intergenic
1187101675 X:16199205-16199227 ATGCTGGTGGCAAGGTGAAAGGG - Intergenic
1187800085 X:23052305-23052327 ATGGTGTTGGCTAAGATACAGGG + Intergenic
1187805397 X:23114340-23114362 ATGCTATTGGCAAGAAGAGATGG + Intergenic
1189398463 X:40644406-40644428 TTGGTGTTGGCAAAAAGAAGAGG + Intronic
1189608964 X:42711058-42711080 CTGGTGTCTGCAGGGAGAAATGG - Intergenic
1192356239 X:70406880-70406902 AAGGTTTTGGCTAGGAAAAAAGG - Exonic
1192756832 X:74055490-74055512 ATGGTGTTAGCCAGGTGAGAGGG - Intergenic
1194929288 X:99866895-99866917 ATGGTGGCAGCAAGGAAAAATGG - Intergenic
1194929548 X:99868873-99868895 ATGGTGGCTGCAAGGAGAAATGG - Intergenic
1194934473 X:99931663-99931685 ATGGGTTGGGCAAGGAGAGAAGG + Intergenic
1195274529 X:103268574-103268596 ATGGTGCTGGGGAGCAGAAAGGG + Intergenic
1195396856 X:104420175-104420197 ATGGTGTTCAGAAGGAGGAAAGG - Intergenic
1195814400 X:108869311-108869333 TTGGAGTTGGCAGGGAGAGATGG + Intergenic
1196129536 X:112139916-112139938 ATGGTGGTGGCAAGAGAAAAAGG - Intergenic
1197309916 X:124892046-124892068 ATGTTGTTAGTAAGGTGAAATGG + Intronic
1198270835 X:135054747-135054769 AAGTTGTTGTCAAGAAGAAATGG - Intergenic
1198999471 X:142617231-142617253 ATGGTGATGGAAAGGTGAGATGG - Intergenic
1199334782 X:146605982-146606004 ATGGTGAGGGTGAGGAGAAAAGG - Intergenic
1199933844 X:152552225-152552247 AAGGTGCAGGAAAGGAGAAAGGG - Intergenic
1201378908 Y:13351102-13351124 AAGGAATTTGCAAGGAGAAAGGG - Intronic
1201382049 Y:13391597-13391619 ATGGTGACAGGAAGGAGAAATGG - Intronic
1201722337 Y:17113274-17113296 ATTTTGTTAGGAAGGAGAAAGGG + Intergenic