ID: 1045207502

View in Genome Browser
Species Human (GRCh38)
Location 8:100057179-100057201
Sequence CCACTCTAATTGGGAAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1917
Summary {0: 1, 1: 0, 2: 14, 3: 203, 4: 1699}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045207502_1045207508 16 Left 1045207502 8:100057179-100057201 CCAATTTTTCCCAATTAGAGTGG 0: 1
1: 0
2: 14
3: 203
4: 1699
Right 1045207508 8:100057218-100057240 CCTGTACCTCCATTGTATCTAGG 0: 143
1: 1048
2: 1826
3: 1794
4: 1463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045207502 Original CRISPR CCACTCTAATTGGGAAAAAT TGG (reversed) Intronic
900817423 1:4859138-4859160 CCATTCCAAATGGGAGAAATTGG - Intergenic
901767310 1:11511385-11511407 CCATTCCAAATGGGAGAAATTGG + Intronic
902271334 1:15307220-15307242 CCATTCCAAATGGGAGAAATTGG - Intronic
902570678 1:17345219-17345241 CCATTCCAAATGGGAGAAATTGG - Intronic
903652079 1:24928760-24928782 CGACTCTAAATGGGAAAAAAAGG - Intronic
903702895 1:25263883-25263905 CCATTCCAAATGGGATAAATTGG + Intronic
903712161 1:25334208-25334230 CCATTCCAAATGGGATAAATTGG + Intronic
903740477 1:25555870-25555892 CCACTCTAGTTGGGTATAGTCGG + Intronic
904057314 1:27679980-27680002 CCATTCCAAGTGGGAGAAATTGG + Intergenic
904662484 1:32095642-32095664 CCAGTCTAATGGGGAAATACAGG - Intronic
904927981 1:34063427-34063449 CCATTCCAAATGGGAGAAATTGG + Intronic
905812702 1:40924550-40924572 TCTCTATAATTAGGAAAAATGGG + Intergenic
906369483 1:45240671-45240693 CCATTCCAAATGGGAGAAATTGG + Intronic
906835843 1:49082905-49082927 CCATTTTAAATGGGAGAAATTGG + Intronic
906872927 1:49503745-49503767 CCACTCCAAATGAGAGAAATTGG - Intronic
906925251 1:50109171-50109193 CCATTCTTATTGGCAAATATTGG - Intronic
907020943 1:51066479-51066501 CCATTCCAAATGGGAGAAATTGG + Intergenic
907439335 1:54469202-54469224 CCATTCCAAATGGGAGAAATTGG - Intergenic
907508898 1:54943832-54943854 CCATTCCAAATGGGAGAAATTGG - Intergenic
907522389 1:55032632-55032654 CCATTCCAAATGGGAGAAATTGG - Intergenic
907625046 1:56021821-56021843 CCATTCTAAATGGGAGAAATTGG + Intergenic
907687254 1:56623935-56623957 CCATTCCAAATGGGAGAAATTGG - Intronic
907707713 1:56847140-56847162 CCATTCCAAATGGGAGAAATTGG + Intergenic
907727090 1:57029762-57029784 CCATTCCAAATGGGAGAAATTGG - Intronic
907863068 1:58372350-58372372 CCATTCTAAATGGGAGAAATTGG - Intronic
907890634 1:58633146-58633168 CCATTCTAAAAGGGTAAAATAGG - Intergenic
908004271 1:59712105-59712127 CCATTCCAAATGGGAGAAATTGG + Intronic
908007000 1:59737610-59737632 CCATTCCAAATGGGAGAAATTGG - Intronic
908393146 1:63701506-63701528 CCTCTCTAGTTGGGCAAATTTGG + Intergenic
908442559 1:64169803-64169825 CCATTCCAAATGGGAGAAATTGG + Intronic
908729288 1:67209095-67209117 CCATTCCAAATGGGAGAAATTGG - Intronic
908853308 1:68395568-68395590 CCATTCTAAAGGGGAGAAATTGG + Intergenic
908925991 1:69255727-69255749 CCACTCTGACTTTGAAAAATTGG + Intergenic
908936437 1:69382786-69382808 CCATTCCAAATGGGAGAAATTGG + Intergenic
908965846 1:69761911-69761933 CCATTCTAATTTAGGAAAATAGG + Intronic
909058029 1:70845600-70845622 TCATTCTAAATGGGAGAAATTGG - Intergenic
909083783 1:71147418-71147440 CCATTCCAAATGGGAGAAATTGG - Intergenic
909096187 1:71291422-71291444 CCATTCCAAATGGGAGAAATTGG - Intergenic
909228644 1:73058466-73058488 CCATTCCAAATGGGAAAAATTGG + Intergenic
909245036 1:73270294-73270316 CCATTCCAAATGGGAGAAATTGG - Intergenic
909274495 1:73666718-73666740 CCATTCCAAATGGGAGAAATTGG - Intergenic
909357413 1:74725830-74725852 CCATTCCAAATGGGAGAAATTGG + Intronic
909376850 1:74950881-74950903 CCATTCTGAATGGGAGAAATTGG - Intergenic
909405354 1:75282283-75282305 CCATTCCAAATGGGAGAAATTGG - Intronic
909422683 1:75484313-75484335 CCATTCCAAATGGGAGAAATTGG + Intronic
909579866 1:77222034-77222056 CCATTCCAAATGGGAGAAATAGG + Intergenic
909599834 1:77449407-77449429 CCATTCCAAATGGGAGAAATTGG - Intronic
909710779 1:78647020-78647042 CCATTCCAAATGGGAGAAATCGG + Intergenic
909718669 1:78740311-78740333 CCATTCCAAATGGGAGAAATTGG - Intergenic
909810308 1:79924657-79924679 CCATTCCAAATGGGAGAAATTGG - Intergenic
910055911 1:83032707-83032729 CCATTCCAAATGGGAGAAATTGG - Intergenic
910057562 1:83050581-83050603 CCATTCCAAATGGGAGAAATTGG + Intergenic
910083488 1:83371317-83371339 CCATTCCAATAGGGAGAAATTGG + Intergenic
910124006 1:83820220-83820242 CCATTCCAAAAGGGAAAAATTGG - Intergenic
910166798 1:84336891-84336913 CCATTCCAAATGGGAGAAATTGG + Intronic
910233132 1:85007575-85007597 CCATTCCAAATGGGAGAAATTGG + Intronic
910409310 1:86924076-86924098 CCATTCCAAGTGGGAGAAATTGG + Intronic
910417088 1:87012810-87012832 CCATTCCAAATGGGAGAAATAGG + Intronic
910512812 1:88025363-88025385 CCATTCCAAATGGGAGAAATTGG + Intergenic
910623810 1:89284972-89284994 CCATTCCAAATGGGAGAAATTGG - Intergenic
911011080 1:93281529-93281551 CCATTCCAAAAGGGAAAAATTGG + Intergenic
911135040 1:94430157-94430179 CCATTCCAAATGGGAGAAATTGG - Intronic
911242183 1:95478784-95478806 CCATTCCAAGTGGGAGAAATTGG - Intergenic
911267601 1:95761832-95761854 CCATTCCAAATGGGATAAATTGG + Intergenic
911331573 1:96530784-96530806 CCATTCCAAATGGGAGAAATTGG - Intergenic
911474774 1:98361504-98361526 CCATTCCAAATGGGAGAAATTGG + Intergenic
911500489 1:98679625-98679647 CCATTCCAAATGGGAGAAATTGG + Intronic
911511131 1:98808903-98808925 CCATTCCAAATGGGAGAAATTGG + Intergenic
911530294 1:99036293-99036315 CCATTCAAAATGGGATAAATTGG + Intergenic
911535056 1:99089904-99089926 CCATTCCAAATGGGAGAAATTGG - Intergenic
911695795 1:100889642-100889664 CCATTCCAAATGGGAGAAATAGG + Intronic
911741006 1:101386801-101386823 CCATTCCAAATGGGAGAAATTGG + Intergenic
911788387 1:101980062-101980084 CCATTCCAAATGGGAAAAATTGG - Intronic
911790996 1:102014999-102015021 CCATTCCAAATGGGAGAAATTGG - Intergenic
911939269 1:104020655-104020677 CCATTCCAAATGGGAGAAATTGG + Intergenic
911969724 1:104416263-104416285 CCATTCCAAATGGGAGAAATTGG + Intergenic
911985398 1:104616340-104616362 CCATTCCAAATGGGAGAAATTGG + Intergenic
912006111 1:104903533-104903555 CCATTCCAATTGGGAGAAATTGG + Intergenic
912070229 1:105800539-105800561 CCATTCCAAATGGGAAAATTTGG + Intergenic
912080705 1:105932520-105932542 CCATTCCAAATGGGAGAAATTGG - Intergenic
912084097 1:105977395-105977417 CCATTCCAAATGGGAGAAATTGG - Intergenic
912099282 1:106185424-106185446 CCATTCTAAATGGGAAAAATTGG - Intergenic
912153059 1:106882748-106882770 CCATTCTAAATGGGAAAAATTGG + Intergenic
912610215 1:111034840-111034862 CCATTCCAAATGGGAGAAATTGG - Intergenic
912890514 1:113524588-113524610 CCATTCCAAATGGGAGAAATTGG - Intronic
912938027 1:114020767-114020789 CCATTCCAAATGGGAGAAATTGG - Intergenic
913307872 1:117451276-117451298 CCATTCCAAATGGGATAAATTGG - Intronic
913316520 1:117558453-117558475 CCATTCCAAATGGGAGAAATTGG + Intergenic
913459082 1:119064238-119064260 CCATTCCAAATGGGAGAAATTGG - Intronic
913526905 1:119702259-119702281 CCATTCTAAATGGGAGAAATTGG - Intronic
913668306 1:121070818-121070840 CCACTGCAAATGGGAGAAATTGG + Intergenic
914020047 1:143858261-143858283 CCACTGCAAATGGGAGAAATTGG + Intergenic
914230610 1:145762051-145762073 CCATTCCAAATGGGAGAAATTGG - Intronic
914954341 1:152147547-152147569 CCACTCCAAAAGGGAGAAATTGG + Intergenic
914988006 1:152476220-152476242 CCATTCCAAATGGGAGAAATTGG + Intergenic
915058362 1:153158305-153158327 CCATTCCAAATGGGAGAAATTGG + Intergenic
915689661 1:157676041-157676063 CCATTTTAAATGGGAGAAATTGG - Intronic
916286268 1:163109115-163109137 CCATTCGAAATGGGAGAAATTGG + Intergenic
916296678 1:163227803-163227825 CCACTCCAAATGGGAGAAATAGG + Intronic
916318970 1:163481240-163481262 CCATTCCAAATGGGAGAAATTGG - Intergenic
916370817 1:164092478-164092500 CCATTCCAAATGGGAGAAATTGG + Intergenic
916411419 1:164550770-164550792 CCATTCCAAATGGGAAACATTGG + Intergenic
916477473 1:165183808-165183830 CCATTCCAAATGGGAGAAATTGG - Intergenic
916618708 1:166472621-166472643 CCATTCCAAATGGGAGAAATTGG + Intergenic
916650624 1:166831278-166831300 CCATTCCAAATGGGAGAAATTGG - Intergenic
916734724 1:167597731-167597753 CCATTCCAAATGGGAGAAATTGG + Intergenic
916790403 1:168120339-168120361 CCATTCCAAATGGGAGAAATTGG - Intronic
916814345 1:168337283-168337305 CCATTCCAAATGGGAGAAATTGG + Intergenic
916910640 1:169341842-169341864 CCATTCGAAATGGGAGAAATTGG - Intronic
916987603 1:170208111-170208133 CCATTCCAAGTGGGAGAAATTGG - Intergenic
917082718 1:171272722-171272744 CCATTCCAAATGGGAGAAATTGG - Intronic
917245632 1:172997429-172997451 CCATTCCAAATGGGAGAAATTGG - Intergenic
917290929 1:173471489-173471511 CCATTCCAAATGGGAGAAATTGG - Intergenic
917578002 1:176344561-176344583 CCATTCTAAGAGGGAGAAATTGG + Intergenic
917638733 1:176961577-176961599 CCTCTGTAAATGGGAAAATTGGG + Intronic
917892568 1:179453880-179453902 GCATTCTAAATGGGAGAAATTGG - Intronic
918119973 1:181529749-181529771 CCATTCCAAATGGGAAAAATTGG - Intronic
918619335 1:186584216-186584238 CCACTCCAAATTGAAAAAATTGG - Intergenic
918668141 1:187178087-187178109 CCATTCCAAATGGGATAAATTGG + Intergenic
918727840 1:187948135-187948157 CCATTCCAAATGGGAGAAATTGG - Intergenic
918844844 1:189595441-189595463 CCATTCTAAATGGGAGAAATTGG - Intergenic
918935060 1:190911625-190911647 CCATTCCAAATGGGAGAAATTGG + Intergenic
918969744 1:191398281-191398303 CCATTCCAAATGGGAGAAATTGG - Intergenic
919129164 1:193432481-193432503 CCATTCCAAATGGGAGAAATTGG + Intergenic
919209012 1:194455423-194455445 CCATTCCAAATGGGAGAAATTGG + Intergenic
919221875 1:194640082-194640104 CCATTCCAAATGGGAGAAATTGG - Intergenic
919277408 1:195439230-195439252 CCATTCCAAATGGGAGAAATTGG + Intergenic
919413390 1:197275359-197275381 CCACTTTTATTGGGTAAAATTGG + Intronic
920783781 1:209020734-209020756 CCATTCCAAATGGGAGAAATTGG - Intergenic
920860231 1:209699826-209699848 CCATTCCAAATGGGAGAAATTGG + Intronic
921282280 1:213578689-213578711 CCAATCCAAATGGGAGAAATTGG - Intergenic
921457438 1:215389281-215389303 CCATTCCAAATGGGAGAAATTGG + Intergenic
921466425 1:215493131-215493153 CCATTCCAAATGGGAGAAATTGG - Intergenic
921594260 1:217037830-217037852 CCATTCCAAATGGGAGAAATTGG + Intronic
921773639 1:219072073-219072095 CCATTCCAAATGGGAGAAATTGG - Intergenic
922114800 1:222602646-222602668 ACAATCCAATTGGGGAAAATTGG - Intergenic
922164174 1:223101122-223101144 CCATTCCAAATGGGAGAAATTGG - Intergenic
922530598 1:226342112-226342134 CCATTCCAAATGGGAGAAATTGG - Intergenic
922709053 1:227813501-227813523 CCATTCCAAATGGGAGAAATGGG + Intergenic
922900859 1:229135418-229135440 CCATTCCAAATGGGAGAAATTGG - Intergenic
923878291 1:238075001-238075023 CCATTCGAAATGGGAAAAATTGG + Intergenic
923887231 1:238172082-238172104 ACAATCTAATTGAGAAAAATTGG + Intergenic
923997065 1:239506965-239506987 CCATTCCAAATGGGAGAAATTGG - Intronic
924036486 1:239943559-239943581 CCAATCTGAGTGGGAGAAATTGG + Intergenic
924050908 1:240078718-240078740 CCATTCCAAATGGGAGAAATTGG - Intronic
924394839 1:243607481-243607503 CCATTCCAAATGGGAGAAATTGG - Intronic
924504349 1:244667314-244667336 CCATTCCAAATGGGAGAAATTGG + Intronic
1063481418 10:6380012-6380034 CCATTCAAAATGGGAGAAATTGG + Intergenic
1064177805 10:13090545-13090567 CCACACCTATTTGGAAAAATGGG - Intronic
1064349456 10:14563149-14563171 CCACTCAAATTGGAAATACTGGG + Intronic
1065408212 10:25391567-25391589 CCATTCCAAATGGGATAAATTGG - Intronic
1066451944 10:35537677-35537699 CCATTCCAAAGGGGAAAAATTGG - Intronic
1066599955 10:37093815-37093837 CCACTCTAAATGGGAGAAATTGG - Intergenic
1067666019 10:48279987-48280009 CCATTCCAAATGGGAGAAATCGG + Intergenic
1068235364 10:54226799-54226821 CCATTCCAAATGGGAGAAATTGG + Intronic
1068352260 10:55862637-55862659 CCATTCCAAATGGGAGAAATTGG - Intergenic
1068354744 10:55896937-55896959 CCACTCCAAATGGGAGAAATTGG + Intergenic
1068404279 10:56570078-56570100 CCATTCTAAATGGGAGAAATTGG + Intergenic
1068519383 10:58062358-58062380 CCATTCCAAATGGGAGAAATTGG + Intergenic
1068676743 10:59777163-59777185 CCATTCCAAATGGGAGAAATTGG + Intergenic
1068972420 10:62974034-62974056 CCATTCCAAATGGGAGAAATTGG + Intergenic
1069077276 10:64051751-64051773 CCATTCCAAATGGGAGAAATTGG + Intergenic
1069094955 10:64248784-64248806 CCATTCCAAGTGGGAGAAATAGG + Intergenic
1069368084 10:67714454-67714476 CCATTCCAAATGGGAGAAATTGG - Intergenic
1069577517 10:69541411-69541433 CCATTCCAAATGGGAGAAATTGG + Intergenic
1069754709 10:70766619-70766641 CCATTCCAAATGGGAGAAATTGG - Intergenic
1069805268 10:71118465-71118487 CCATTCTGAATGGGAGAAATTGG - Intergenic
1070353621 10:75617385-75617407 TCACTCTTATTGGGAGAATTTGG + Intronic
1071043091 10:81337655-81337677 CCATTCCAAAAGGGAAAAATTGG - Intergenic
1071098834 10:82011659-82011681 CCATTCCAAATGGGAGAAATTGG + Intronic
1071327872 10:84534676-84534698 CCACTCCAAATGGGAGAAATTGG - Intergenic
1071380343 10:85053099-85053121 CCATTCTAAAGGGGAGAAATTGG + Intergenic
1071442755 10:85717845-85717867 CCATTCTAAATGGGAGAAATTGG + Intronic
1071738305 10:88327001-88327023 CCATTCCAAATGGGAGAAATTGG - Intronic
1072035697 10:91561234-91561256 CCATTCCAAATGGGAGAAATTGG + Intergenic
1072526778 10:96278598-96278620 CATATCTAATGGGGAAAAATAGG + Intergenic
1072647324 10:97267161-97267183 CCATTCCAAATGGGAGAAATTGG + Intronic
1072769301 10:98124401-98124423 CCATTCCAAATGGGAGAAATTGG + Intergenic
1072808287 10:98439534-98439556 CCATTCCAAATGGGAGAAATTGG - Intronic
1072963489 10:99951679-99951701 CCATTCCAAATGGGAGAAATTGG - Intronic
1073153519 10:101328325-101328347 CCATTCCAAGTGGGATAAATTGG - Intergenic
1073387126 10:103134959-103134981 CCATTCCAAATGGGAGAAATTGG - Intronic
1073396551 10:103222954-103222976 CCATTCCAAAAGGGAAAAATTGG + Intergenic
1073628071 10:105119748-105119770 CCATTCCAAATGGGAGAAATTGG - Intronic
1073708612 10:106014978-106015000 CCATTCTAAATGGGAGAAACTGG + Intergenic
1073841472 10:107503593-107503615 CCATTCCAAATGGGAGAAATTGG + Intergenic
1073883198 10:108007408-108007430 CCATTCCAAATGGGAGAAATTGG + Intergenic
1073897999 10:108185015-108185037 CCATTCCAAATGGGAGAAATTGG - Intergenic
1073942459 10:108714038-108714060 CCATTCCAAATGGGAGAAATTGG - Intergenic
1074178199 10:111032414-111032436 CCATTCCAAATGGGAGAAATCGG + Intergenic
1074242219 10:111650598-111650620 CCATTCCAAATGGGAGAAATTGG - Intergenic
1074260573 10:111849090-111849112 CCATTCCAAATGGGAGAAATTGG - Intergenic
1074262818 10:111870898-111870920 CCATTCCAAATGGGAGAAATTGG - Intergenic
1074286176 10:112100282-112100304 CCATTCTAAATGGGAAAAATTGG + Intergenic
1074619694 10:115106260-115106282 CCATTCCAAATGGGAGAAATTGG - Intronic
1074622256 10:115137990-115138012 CCATTCCAAATGGGAGAAATTGG + Intronic
1075054944 10:119210417-119210439 CCACACTAATTAGGATATATGGG - Intronic
1075509193 10:123055710-123055732 CCATTCCAAATGGGAGAAATTGG + Exonic
1076082845 10:127599147-127599169 CCAATATAATTGGGAAGGATGGG - Intergenic
1076172717 10:128335885-128335907 TCTCTCTAATGGTGAAAAATGGG + Intergenic
1076532039 10:131151353-131151375 CCATACTAAATGGGAGAAATTGG + Intronic
1076689830 10:132217320-132217342 CCATTCCAAATGGGAGAAATTGG - Intronic
1077256507 11:1586069-1586091 CTACTCAACTTGGGAAAAAATGG + Intergenic
1077735207 11:4783387-4783409 CCATTCCAAATGGGAGAAATTGG - Intronic
1077827551 11:5827021-5827043 CCATTCCAAATGGGAGAAATTGG - Intronic
1078365112 11:10700027-10700049 CCATTCCAAATGGGAGAAATTGG - Intergenic
1078515048 11:12014730-12014752 TCATTCTAAGTGGGAGAAATTGG - Intergenic
1078687510 11:13546967-13546989 CCATTCCAAATGGGAGAAATTGG - Intergenic
1078747371 11:14128323-14128345 CCATTCCAAATGGGAGAAATTGG + Intronic
1078945740 11:16067003-16067025 CCATTCCAAATGGGAGAAATTGG - Intronic
1078959445 11:16248004-16248026 CCATTCCAAATGGGAGAAATTGG + Intronic
1079147519 11:17867285-17867307 CCATTCAAAATGGGAGAAATTGG + Intronic
1079500173 11:21094128-21094150 CCACTCCAAATGGAAGAAATTGG + Intronic
1079556116 11:21760532-21760554 CCATTCTAACTGGGAGAAATTGG + Intergenic
1079716799 11:23757332-23757354 CCATTCCAAATGGGCAAAATTGG - Intergenic
1079719009 11:23787224-23787246 CCATTCCAAATGGGAGAAATTGG + Intergenic
1079750466 11:24190616-24190638 CTACTCCAAATGGGAGAAATTGG + Intergenic
1079856320 11:25610080-25610102 CCATTCCAAATGGGAGAAATTGG + Intergenic
1079880499 11:25921434-25921456 CCATTCCAAATGGGAGAAATTGG + Intergenic
1080129731 11:28780382-28780404 CCATTCCAAATGGGAGAAATCGG + Intergenic
1080153451 11:29079203-29079225 CCATTCCAAATGGGAGAAATTGG - Intergenic
1080188483 11:29519824-29519846 GCACTGTAACTGGGAGAAATGGG + Intergenic
1080245682 11:30177143-30177165 CCATTCCAAGTGGGATAAATTGG + Intergenic
1080715747 11:34798113-34798135 CCATTCCAAATGGGAGAAATTGG - Intergenic
1080739402 11:35049598-35049620 CCATTCCAAGTGGGAGAAATTGG - Intergenic
1080982318 11:37423509-37423531 CCATTCTAAATGGGAGAAATTGG + Intergenic
1080986145 11:37468602-37468624 CCCCTCTAATTGGGATAACTTGG - Intergenic
1080997332 11:37619594-37619616 CCATTCCAAATGGGAAAAATTGG - Intergenic
1081043589 11:38242604-38242626 CCATTCTAAATGGAATAAATTGG + Intergenic
1081077604 11:38696054-38696076 CCATTCCAAATGGGATAAATTGG + Intergenic
1081101324 11:39006486-39006508 CCATTCCAAATGGGAGAAATTGG + Intergenic
1081122537 11:39285003-39285025 CCATTCCAAATGGGATAAATTGG + Intergenic
1081224223 11:40500996-40501018 CCATTCCAAATGGGACAAATTGG + Intronic
1081236627 11:40654518-40654540 CCATTCAAAATGGGAGAAATTGG - Intronic
1081278771 11:41183400-41183422 CCACTCCAAATGGGAGAAACTGG + Intronic
1081309617 11:41554085-41554107 CCATTCCAAATGGGAGAAATTGG - Intergenic
1081316469 11:41637108-41637130 CCATTCTAAATGGGAGAAATTGG + Intergenic
1081349039 11:42026491-42026513 CCATTCCAAATGGGAGAAATTGG + Intergenic
1081354494 11:42095746-42095768 CCATTCTAAATGGGAGAAATTGG - Intergenic
1081769115 11:45636390-45636412 CCATTCCAAATGGGAGAAATTGG - Intergenic
1081939514 11:46928797-46928819 CCATTCCAAATGGGAGAAATTGG - Intergenic
1082692681 11:56325060-56325082 TCATTCCAAATGGGAAAAATTGG - Intergenic
1082947917 11:58780088-58780110 CCATTCAAAATGGGAGAAATTGG + Intergenic
1083136010 11:60677723-60677745 CCATTCCAAATGGGACAAATTGG + Intergenic
1085651616 11:78273489-78273511 CCATTCTAAATGGGAGAAATTGG - Intronic
1085755114 11:79195613-79195635 CCATTCCAAGTGGGAGAAATTGG - Intronic
1085906919 11:80774855-80774877 CCATTCCAAATGGGAGAAATTGG - Intergenic
1086084814 11:82943717-82943739 CCATTCCAAATGGGAGAAATTGG + Intronic
1086173310 11:83860493-83860515 CCATTCTCAATGGGAGAAATTGG - Intronic
1086231806 11:84578568-84578590 CCATTCCAAATGGGATAAATTGG - Intronic
1086333994 11:85781667-85781689 CCATTCTAAATGGGAAAAGTTGG + Intronic
1086503749 11:87480029-87480051 CCATTCCAAATGGGAGAAATTGG - Intergenic
1086509620 11:87542784-87542806 CCATTCCAAATGGGAGAAATTGG + Intergenic
1086769618 11:90745483-90745505 CCATTCCAAGTGGGAGAAATTGG - Intergenic
1086836942 11:91637000-91637022 CCATTCCAAATGGGAGAAATTGG - Intergenic
1086848595 11:91782608-91782630 CCATTCCAAATGGGAGAAATTGG + Intergenic
1086933740 11:92722233-92722255 CCATTCCAAATGGGAGAAATTGG + Intronic
1086936019 11:92746744-92746766 CCATTCCAAATGGGAGAAATTGG + Intronic
1087393548 11:97569351-97569373 CCATTCTAAATAGGAGAAATTGG + Intergenic
1087496203 11:98893760-98893782 CTATTCTAAATGGGAGAAATTGG + Intergenic
1087571000 11:99928003-99928025 CCATTCCAAATGGGAGAAATTGG + Intronic
1087576878 11:100000301-100000323 CCATTCCAAATGGGAGAAATTGG + Intronic
1087831647 11:102825723-102825745 CTGCTCCAAATGGGAAAAATTGG + Intergenic
1087877553 11:103375686-103375708 CCATTGTAAATGGGAGAAATTGG - Intronic
1088014111 11:105038110-105038132 CCATTCCAAATGGGAGAAATTGG - Intergenic
1088038704 11:105350496-105350518 CCATTCCAAATGGGAGAAATTGG + Intergenic
1088040444 11:105375232-105375254 CCATTTTAAATGGGAGAAATTGG + Intergenic
1088143607 11:106648846-106648868 CCATTCCAAATGGGAGAAATTGG + Intergenic
1088175886 11:107052053-107052075 CCATTCCAAGTGGGAAAAATTGG - Intergenic
1088318698 11:108533113-108533135 CCACTCTGACTGGGGAAACTAGG - Intronic
1088953777 11:114598101-114598123 ACATTCTAAAAGGGAAAAATTGG + Intergenic
1089284709 11:117398099-117398121 CCATTCCAAATGGGAGAAATTGG + Intronic
1089405238 11:118192195-118192217 CCATTCCAAATGGGAGAAATTGG - Intergenic
1090506410 11:127320250-127320272 CCATTCCAAATGGGATAAATTGG + Intergenic
1090556798 11:127885103-127885125 CCATTCCAAATGGGAGAAATTGG + Intergenic
1090572914 11:128067764-128067786 CCACGCCAAATGGGAGAAATTGG + Intergenic
1091244716 11:134082148-134082170 CCATTCCAAATGGGAGAAATTGG - Intronic
1091539771 12:1449111-1449133 CTACTCCAAATGGGAGAAATTGG - Intronic
1091982652 12:4879006-4879028 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1092015928 12:5158087-5158109 GCACTGTACTTGGGAAATATAGG + Intergenic
1092485731 12:8900770-8900792 CCATTCCAAATGGGAGAAATTGG + Intergenic
1092618105 12:10234069-10234091 CCATTCCAAATGGGATAAATTGG + Intergenic
1092662580 12:10755064-10755086 CCATTCCAAATGGGAGAAATTGG + Intergenic
1093014716 12:14144472-14144494 CCATTCCAAATGGGAGAAATTGG + Intergenic
1093192501 12:16091503-16091525 CCATTCCAAATGGGAGAAATTGG + Intergenic
1093211283 12:16312454-16312476 CTACTCCAAGTGGGAAAAATTGG - Intergenic
1093238482 12:16640560-16640582 CCATTCCAAATGGGAGAAATTGG + Intergenic
1093604888 12:21077809-21077831 CCATTCCAAATGGGAGAAATTGG + Intronic
1093629244 12:21388053-21388075 CCATTCCAAATGGGAGAAATTGG - Intronic
1093770711 12:23014344-23014366 CGAATCTAATTGGTAAAAATGGG - Intergenic
1093978484 12:25450107-25450129 CCATTCCAAATGGGAGAAATTGG - Intronic
1094420339 12:30264204-30264226 CCATTCAAAATGGGAGAAATTGG - Intergenic
1094489169 12:30947984-30948006 CCATTCCAAATGGGAGAAATTGG + Intronic
1094716268 12:33017895-33017917 CCATTCCAAATGGGAGAAATTGG - Intergenic
1095184411 12:39185048-39185070 CTCTTCTAATTGGGAAAATTTGG - Intergenic
1095213896 12:39526477-39526499 CCATTCCAAATGGGAGAAATTGG + Intergenic
1095413104 12:41945901-41945923 CCATTCCAAATGGGAGAAATTGG + Intergenic
1095511236 12:42953411-42953433 CCATTCCAAATGGGAGAAATTGG - Intergenic
1095689201 12:45068641-45068663 CCATTCCAAATGGGAGAAATTGG + Intergenic
1095765093 12:45886174-45886196 CCATTCCAAATGGGAGAAATTGG + Intronic
1095803372 12:46292618-46292640 CCATTCCAAATGGGAGAAATTGG + Intergenic
1095847279 12:46759455-46759477 CCATTCCAACTGGGAGAAATTGG - Intergenic
1095883466 12:47164339-47164361 CCACTCCAAAAGGGAAAAATAGG + Intronic
1096960160 12:55569552-55569574 TCATTCCAAATGGGAAAAATTGG + Intergenic
1096969245 12:55652158-55652180 CCATTCCAAATGGGAGAAATTGG - Intergenic
1097302677 12:58035332-58035354 CCATTCTGAATGGGAGAAATTGG + Intergenic
1097326096 12:58278065-58278087 CCACTCCAAATGGGAGAAATAGG - Intergenic
1097343791 12:58468677-58468699 TCACTCTAATTAGAATAAATGGG + Intergenic
1097400634 12:59124301-59124323 CCATTACAAATGGGAAAAATCGG + Intergenic
1097406315 12:59194817-59194839 GCACTCCAAATGGGAGAAATTGG + Intergenic
1097441262 12:59611733-59611755 CCATTCCAAATGGGAGAAATTGG + Intronic
1097474175 12:60033622-60033644 CCATTCCAAATGGGAGAAATTGG + Intergenic
1097522707 12:60688998-60689020 CCATTCCAAATGGGAGAAATTGG + Intergenic
1097571189 12:61334680-61334702 CCATTCTAAAAGGGAGAAATTGG + Intergenic
1097654604 12:62344264-62344286 CCATTCCAAATGGGAGAAATTGG + Intronic
1097735887 12:63180100-63180122 CCATTCCAAATGGGAGAAATTGG - Intergenic
1097757830 12:63426753-63426775 CCATTCCAAATGGGAGAAATTGG + Intergenic
1097999191 12:65922462-65922484 CCATTCCAAATGGGAGAAATTGG - Intronic
1098078453 12:66758699-66758721 CCATTCCAAATGGGAGAAATTGG + Intronic
1098163810 12:67673028-67673050 CCATTCCAAATGGGAGAAATTGG + Intergenic
1098203624 12:68083391-68083413 CCATTTTAAATGGGAGAAATTGG + Intergenic
1098295199 12:68997286-68997308 CCATTCCAAATGGGAGAAATTGG - Intergenic
1098559024 12:71851615-71851637 CCATTCCAAAAGGGAAAAATCGG + Intronic
1098672343 12:73247572-73247594 CCATTCCAAATGGGATAAATTGG + Intergenic
1098778450 12:74653550-74653572 CCATTCCAAATGGGAGAAATTGG + Intergenic
1098836459 12:75429365-75429387 CCATTCCAAATGGGAGAAATTGG - Intronic
1099004175 12:77217059-77217081 CCATTCCAAATGGGAGAAATTGG - Intergenic
1099096243 12:78378555-78378577 CCATTCCAAATGGGAAAAATTGG + Intergenic
1099104987 12:78486216-78486238 CCATTCCAAATGGGAGAAATTGG + Intergenic
1099503767 12:83447002-83447024 CCATTCCAACTGGGAGAAATTGG - Intergenic
1099669634 12:85673847-85673869 CCATTCTAAATGGGAGAAATTGG + Intergenic
1099672822 12:85717193-85717215 CCATTCCAAATGGGAGAAATTGG + Intergenic
1099700328 12:86075197-86075219 CCATTCCAAATGGGAGAAATTGG + Intronic
1099730767 12:86497752-86497774 CCATGCTAATTGGAAATAATGGG - Intronic
1099766850 12:86998248-86998270 CCATTCCAAATGGGAGAAATTGG + Intergenic
1099772747 12:87083692-87083714 CCATTCCAAATGGGAGAAATTGG - Intergenic
1099800650 12:87452246-87452268 CCATTCCAAATGGGAGAAATTGG - Intergenic
1099802556 12:87474891-87474913 CCATTCCAAATGGGAGAAATTGG - Intergenic
1099859019 12:88205545-88205567 CCATTCCAAATGGGAGAAATTGG - Intergenic
1099864829 12:88266713-88266735 TTACTCGTATTGGGAAAAATAGG - Intergenic
1099929017 12:89052503-89052525 CCATTCCAAATGGGAAAAATTGG + Intergenic
1100060191 12:90565944-90565966 CCATTCCAAATGGGACAAATTGG + Intergenic
1100427612 12:94501801-94501823 CCATTCCAAATGGGAGAAATTGG + Intergenic
1100674794 12:96855508-96855530 CCATTCCAAATGGGAGAAATTGG + Intronic
1100747405 12:97661279-97661301 CCATTCCAAATGGGAGAAATTGG + Intergenic
1100929036 12:99585204-99585226 CCATTCCAAATGGGAGAAATTGG + Intronic
1101113343 12:101507278-101507300 CCATTCTAAATGGGAGAAATTGG - Intergenic
1101117744 12:101548789-101548811 CCATTCCAAATGGGAGAAATTGG + Intergenic
1101132824 12:101706725-101706747 CAACTCTTATTTGAAAAAATGGG + Intronic
1101194565 12:102369425-102369447 CCATTCCAAATGGGAGAAATTGG + Intergenic
1101257879 12:102997722-102997744 CCATTCCAAATGGGAGAAATTGG + Intergenic
1101340190 12:103836398-103836420 CCATTCCAAATGGGAGAAATTGG + Intronic
1101359113 12:104009389-104009411 CCATTCCAAATGGGAGAAATTGG - Intronic
1101526314 12:105534572-105534594 CCATTCCAAATGGGAGAAATTGG + Intergenic
1101692841 12:107097343-107097365 CCATTCCAAATGGGAGAAATTGG - Intergenic
1102794803 12:115679418-115679440 CCATTCCAAATGGGAGAAATTGG - Intergenic
1104079766 12:125419854-125419876 CCATTCCAAATGGGAGAAATTGG + Intronic
1104210418 12:126683521-126683543 CCATTCCAAATGGGAGAAATTGG + Intergenic
1104240450 12:126984349-126984371 CCATTCTGAATGGGAAAGATTGG + Intergenic
1105236012 13:18554311-18554333 CCATTCCAGATGGGAAAAATTGG - Intergenic
1105529845 13:21209275-21209297 CCACTCCAAAAGGGAGAAATAGG - Intergenic
1105608123 13:21944167-21944189 CCATTCCAAATGGGAGAAATTGG + Intergenic
1105609359 13:21954668-21954690 CCATTCCAAATGGGAGAAATTGG + Intergenic
1105650454 13:22371784-22371806 CCATTCCAAATGGGAGAAATTGG + Intergenic
1106048255 13:26165745-26165767 CCATTCCAAATGGGAGAAATAGG - Intronic
1106106693 13:26739131-26739153 CCATTCCAAATGGGAGAAATTGG - Intergenic
1106917427 13:34530205-34530227 CCATTCCAAATGGGAGAAATTGG - Intergenic
1107119690 13:36782605-36782627 CCTCTCTAAATGGGAAGAGTAGG + Intergenic
1107240269 13:38224389-38224411 CCACTCTCACTGGAAAACATAGG - Intergenic
1107330796 13:39297073-39297095 CCATTCTAAATGGGAGAAATTGG - Intergenic
1108270675 13:48756428-48756450 CCATTCCAAATGGGAAAAATTGG - Intergenic
1108419564 13:50234398-50234420 CCATTCCAAATGGGAGAAATTGG - Intronic
1108927481 13:55770431-55770453 CCATTCCAAATGGGAGAAATTGG - Intergenic
1108934055 13:55864972-55864994 CCATTCCAAATGGGAGAAATTGG - Intergenic
1108971328 13:56380742-56380764 CCATTCCAAATGGGATAAATTGG + Intergenic
1108981591 13:56522022-56522044 CCATTCCAAATGGGAGAAATTGG - Intergenic
1109076693 13:57845413-57845435 CCATTCCAAATGGGAGAAATTGG + Intergenic
1109107864 13:58277734-58277756 CCATTCCAAATGGGAGAAATTGG + Intergenic
1109221800 13:59647408-59647430 CCATTCCAAATGGGAGAAATCGG - Intergenic
1109244788 13:59940635-59940657 CCATTTTAATTGGGAAAAAAAGG - Intronic
1109246202 13:59956962-59956984 CCATTCCAAATGGGAGAAATTGG - Intronic
1109294373 13:60512600-60512622 CCATTCCAAATGGGAGAAATTGG + Intronic
1109315516 13:60744666-60744688 CCACTCCAAATGGAAGAAATTGG - Intergenic
1109324578 13:60852382-60852404 CCATTCCAAATGGGAGAAATTGG + Intergenic
1109344739 13:61100624-61100646 CCACTCCAAATGGGGGAAATTGG - Intergenic
1109346856 13:61125397-61125419 CCATTCCAAATGGGAGAAATTGG + Intergenic
1109390250 13:61683092-61683114 CCATTCCAAATGGGAGAAATTGG - Intergenic
1109475587 13:62876772-62876794 CCATTCCAAATGGGAGAAATTGG + Intergenic
1109524486 13:63557543-63557565 CCATTCCAAATGGGAGAAATTGG - Intergenic
1109625728 13:64971433-64971455 CCACTTTAATAGAGTAAAATAGG + Intergenic
1109697424 13:65978362-65978384 CCATTCCAAATGGGAGAAATTGG - Intergenic
1109717467 13:66234896-66234918 CTATTCTAAATGGGAGAAATTGG - Intergenic
1109721156 13:66277789-66277811 CCATTCCAAATGGGAGAAATTGG - Intergenic
1109810810 13:67509898-67509920 CCATTCCAAATGGGAGAAATTGG - Intergenic
1109832625 13:67812139-67812161 CCATTCCAAATGGGAGAAATTGG + Intergenic
1109853666 13:68101669-68101691 CCATTCAAAATGGGAGAAATTGG + Intergenic
1109859629 13:68180013-68180035 CCATTCCAAATGGGAGAAATTGG - Intergenic
1109879395 13:68451245-68451267 CCATTCCAAATGGGATAAATTGG - Intergenic
1110079504 13:71292597-71292619 CCTCTCTAAATGTGATAAATTGG - Intergenic
1110250597 13:73376864-73376886 CCATTCCAAATGGGAGAAATTGG + Intergenic
1110487980 13:76068717-76068739 CCATTCCAAATGGGAAAAATTGG - Intergenic
1110496425 13:76173710-76173732 CCATTCCAAATGGGAGAAATTGG + Intergenic
1110511521 13:76356345-76356367 CCATTCCAAATGGGAGAAATTGG - Intergenic
1110559690 13:76897909-76897931 CCATTCCAAATGGGAGAAATTGG + Intergenic
1110566146 13:76959449-76959471 CCATTCCAAATGGGAGAAATTGG + Intergenic
1110693628 13:78461138-78461160 CCACTCCAATTGGGTAGAGTTGG + Intergenic
1110929140 13:81193923-81193945 CCATTCCAAATGGGAGAAATTGG + Intergenic
1110970445 13:81754473-81754495 CCATTCCAAATGGGAGAAATTGG - Intergenic
1111083570 13:83343477-83343499 CCATTCCAAATGGGAGAAATTGG - Intergenic
1111218739 13:85178236-85178258 CCATTCCAAATGGGAGAAATTGG + Intergenic
1111239748 13:85458202-85458224 CCATTCCAAATGGGAGAAATTGG - Intergenic
1111307597 13:86435066-86435088 TCATTCTAAATGGGAGAAATTGG - Intergenic
1111313175 13:86516847-86516869 CCATTCTAAATGGGAGAAATTGG + Intergenic
1111403269 13:87769064-87769086 CCATTCCAAATGGGAGAAATTGG + Intergenic
1111527530 13:89492009-89492031 CCATTCCAAATGGGAGAAATTGG + Intergenic
1111539824 13:89655813-89655835 CCACTCCAAATGGGAGAAATTGG - Intergenic
1111551524 13:89818862-89818884 CCATTCCAAATGGGAGAAATTGG - Intergenic
1111629024 13:90826258-90826280 CCATTCCAAATGGGAGAAATTGG + Intergenic
1111715824 13:91877540-91877562 CCATTCCAAATGGGAGAAATTGG - Intronic
1111718919 13:91917185-91917207 CCATTCCAAATGGGATAAATTGG + Intronic
1111751262 13:92334708-92334730 CCATTCTAAATGGGAGAAATTGG + Intronic
1112568132 13:100568852-100568874 CCATTCCAAATGGGATAAATTGG + Intronic
1112623709 13:101078566-101078588 CCATTCCAAATGGGAGAAATTGG - Intronic
1112781813 13:102909079-102909101 CCACTCTGGTTGGGAACCATAGG + Intergenic
1112826504 13:103398270-103398292 CCATTCCAAATGGGAGAAATTGG + Intergenic
1112954491 13:105041652-105041674 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1113112057 13:106834012-106834034 CCACTACATTTTGGAAAAATTGG - Intergenic
1113212741 13:108002002-108002024 CCATTCCAAATGGAAAAAATTGG - Intergenic
1113280603 13:108783340-108783362 CCATTCGAAATGGGAGAAATTGG - Intronic
1113645373 13:111991224-111991246 CCATTCTAAATGGGAGAAATTGG - Intergenic
1114147365 14:19993412-19993434 CCATTCAAAATGGGAGAAATTGG + Intergenic
1114160665 14:20162866-20162888 CCATTCCAAATGGGAGAAATGGG + Intergenic
1114380585 14:22199149-22199171 CCATTCCAAATGGGAGAAATTGG - Intergenic
1114433068 14:22678981-22679003 CCATTCTAAATGGAAAAAATTGG - Intergenic
1114706938 14:24737194-24737216 CTACTCCAAATGGGAGAAATTGG + Intergenic
1114778598 14:25514296-25514318 CCATTCCAAATGGGAGAAATTGG + Intergenic
1114798057 14:25739556-25739578 CCATTCCAAATGGGAGAAATTGG + Intergenic
1114987612 14:28250489-28250511 CCATTCAAAATGGGAGAAATTGG + Intergenic
1115021356 14:28684673-28684695 CCATTCCAAATGGGATAAATTGG - Intergenic
1115065610 14:29256591-29256613 CCATTCCAAATGGGAGAAATTGG + Intergenic
1115068745 14:29296430-29296452 CCATTCCAAATGGGATAAATTGG + Intergenic
1115085706 14:29512796-29512818 TCATTCTAAATGGGAGAAATTGG + Intergenic
1115130293 14:30046352-30046374 CCATTCCAAATGGGAGAAATTGG + Intronic
1115132778 14:30073328-30073350 CCATTCCAAATGGGAGAAATTGG - Intronic
1115199025 14:30833879-30833901 CCATTCCACATGGGAAAAATTGG + Intergenic
1115277382 14:31623198-31623220 CCATTCTAAATGGGAGAAATTGG - Intronic
1115785241 14:36818156-36818178 CCACTCTTATTGGGGATGATCGG + Intronic
1115820396 14:37206849-37206871 CCATTCCAAATGGGAGAAATTGG - Intronic
1115878863 14:37892373-37892395 CCCTTCCAAATGGGAAAAATTGG - Intronic
1115893733 14:38061092-38061114 CCATTCCAAATGGGAGAAATTGG + Intergenic
1116071200 14:40047638-40047660 CCATTCCAAATGGGAAAAATTGG + Intergenic
1116095376 14:40360174-40360196 CCATTCCAAATGGGAGAAATTGG - Intergenic
1116148023 14:41100121-41100143 CCATTCCAAATGGGAGAAATTGG - Intergenic
1116272258 14:42786756-42786778 CTATTCTAAATGGGAAAAACTGG - Intergenic
1116356321 14:43936222-43936244 CCATTCCAACTGGGAAAAATTGG + Intergenic
1116364418 14:44041451-44041473 CCATTCTAAAAGGGAGAAATAGG - Intergenic
1116368634 14:44102289-44102311 CCATTCCAAATGGGAGAAATTGG + Intergenic
1116378330 14:44232032-44232054 TCATTCTAAATGGGAGAAATTGG + Intergenic
1116387465 14:44348788-44348810 CCATTCCAAATGGGACAAATTGG - Intergenic
1116528406 14:45935351-45935373 CCATTCCAAATGGGAGAAATTGG - Intergenic
1116533955 14:46007533-46007555 CCATTCCAAATGGGAGAAATTGG - Intergenic
1116694193 14:48150845-48150867 CCATTCCAAATGGGAGAAATTGG - Intergenic
1116696476 14:48183832-48183854 CCATTCTAAATGGGAGAAATTGG - Intergenic
1116917331 14:50537782-50537804 CCATTCAAAATGGGAGAAATGGG - Intronic
1116931278 14:50693807-50693829 CCATTCTAAATGGGAGAAATTGG + Intergenic
1117084026 14:52180860-52180882 CCATTCCAAATGGGAGAAATTGG + Intergenic
1117085569 14:52196882-52196904 CCATTCCAAATGGGAGAAATTGG - Intergenic
1117182041 14:53200956-53200978 CCATTCCAAATGGGAGAAATTGG - Intergenic
1117186364 14:53244386-53244408 CCATTCTAAATGGGAGAAATTGG - Intergenic
1117198418 14:53363784-53363806 CCATTCTAAATGGGAGAAATTGG + Intergenic
1117427830 14:55620045-55620067 CCACTCCAAATGGGAGAAATTGG + Intronic
1117841057 14:59860874-59860896 CCATTCTAAATGGGAGAAATTGG - Intronic
1117854103 14:60009795-60009817 CCATTCCAAATGGGAGAAATGGG + Intronic
1117908133 14:60611518-60611540 CCATTCTAAATGGGAGAAATTGG + Intergenic
1117958865 14:61143907-61143929 CCATTCCAAATGGGAGAAATTGG + Intergenic
1117977190 14:61310363-61310385 CCATTCCAAATAGGAAAAATTGG + Intronic
1117990222 14:61425499-61425521 CCATTCCAAATGGGATAAATTGG - Intronic
1118046422 14:61976029-61976051 CCATTCCAAATGGGAGAAATTGG + Intergenic
1118069687 14:62232327-62232349 CCATTCCAAATGGGAGAAATTGG - Intergenic
1118092423 14:62497303-62497325 CCATTCCAAATGGGAAAAATTGG + Intergenic
1118140608 14:63076992-63077014 CCACTAAATTTTGGAAAAATTGG - Intronic
1118151513 14:63195386-63195408 CCATTCCAAATGGGAGAAATTGG - Intergenic
1118365055 14:65087593-65087615 CCATTCCAAATGGGAGAAATCGG - Intronic
1118402737 14:65394669-65394691 CCATTCCAAATGGGAAAAATTGG + Intergenic
1118460169 14:65980084-65980106 CCATTCCAAATGGGAGAAATTGG - Intronic
1118485105 14:66207144-66207166 CCATTCCAAATGGGAGAAATTGG - Intergenic
1118524074 14:66620890-66620912 CCATTCCAAATGGGAGAAATTGG + Intronic
1118598092 14:67451618-67451640 CCATTCCAAATGGGAGAAATTGG - Intronic
1118653707 14:67924989-67925011 CCATTCCAAATGGGAGAAATTGG + Intronic
1118673267 14:68154373-68154395 CCATTCTTATTCGTAAAAATAGG + Intronic
1118835884 14:69477616-69477638 CCATTCCAAATGGGAGAAATTGG + Intergenic
1118903736 14:70008082-70008104 GCTCACTAATTTGGAAAAATGGG - Intronic
1118963995 14:70562294-70562316 CCATTCAAAATGGGAGAAATTGG - Intergenic
1119345726 14:73922222-73922244 CTCCTTTATTTGGGAAAAATGGG + Intronic
1119963180 14:78882586-78882608 CCATTCCAAATGGGAGAAATTGG - Intronic
1120152780 14:81055727-81055749 CCATTCCAAATGGGAGAAATTGG - Intronic
1120257804 14:82141927-82141949 CCATTCCAAATGGGAGAAATTGG + Intergenic
1120392891 14:83930310-83930332 CCATTCTAAATGGGAGGAATTGG - Intergenic
1120393876 14:83943838-83943860 CCATTCAAAATGGGAGAAATTGG + Intergenic
1120417882 14:84243107-84243129 CCATTCCAAATGGGAGAAATTGG + Intergenic
1120480829 14:85047282-85047304 CCATTCCAAATGGGAGAAATTGG - Intergenic
1120485810 14:85112322-85112344 CCATTCCAAATGGGAGAAATTGG + Intergenic
1120515552 14:85465480-85465502 CCATTCTAAAGGGGAGAAATCGG - Intergenic
1120571044 14:86116768-86116790 CCATTCGAAATGGGAGAAATTGG - Intergenic
1120622010 14:86775801-86775823 CCATTCCAAATGGGAAACATTGG - Intergenic
1120661732 14:87258306-87258328 CCACTCCAAATGGAAGAAATTGG - Intergenic
1120693709 14:87621147-87621169 CCATTCTGAATGGGAGAAATTGG + Intergenic
1120696434 14:87650286-87650308 CCATTCCAAATGGGAGAAATTGG - Intergenic
1120707723 14:87761731-87761753 CCACTCCAAATGGGAGAAATTGG - Intergenic
1120801080 14:88689521-88689543 TGAGTCCAATTGGGAAAAATGGG - Intronic
1120947650 14:90013020-90013042 CCATTCTAAATGGGAGAAATTGG - Intronic
1120956835 14:90090384-90090406 CCACTCCAAATGGGAGAAACTGG - Intronic
1120971830 14:90214281-90214303 CCACTCCAAATGGGAAAAATTGG + Intergenic
1121063366 14:90938116-90938138 CCACTCCAAATGGGAGAAACTGG + Intronic
1121066731 14:90974158-90974180 AATCACTAATTGGGAAAAATCGG + Intronic
1121166601 14:91807583-91807605 CCATTCCAAATGGGATAAATTGG - Intronic
1121471251 14:94156076-94156098 CCATTCCAAATGGGAGAAATCGG - Intronic
1121499142 14:94419652-94419674 CCATTCCAAATGGGAAAAATTGG - Intergenic
1121611613 14:95284687-95284709 CCATTCAAAATGGGAGAAATTGG - Intronic
1122436281 14:101702533-101702555 CCATTCCAAATGGGAGAAATTGG - Intergenic
1122801838 14:104234812-104234834 CCATTCCAAATGGGAGAAATTGG - Intergenic
1123140613 14:106073709-106073731 CCATTCTAAATGGGAGAAATTGG - Intergenic
1124226343 15:27898012-27898034 CCATTCCAAATGGGAGAAATGGG - Intronic
1124695743 15:31862978-31863000 CCATTCCAAATGGGAGAAATTGG + Intronic
1124705570 15:31960962-31960984 CCACTCCAAAAGGGAGAAATTGG - Intergenic
1125153675 15:36562424-36562446 CCATTCCAAATGGGAGAAATTGG - Intergenic
1125279370 15:38027400-38027422 CCATTCCAAATGGGAGAAATTGG - Intergenic
1125472014 15:40014014-40014036 CCATTCCAAATGGGAGAAATTGG + Intronic
1125806507 15:42497866-42497888 CCATTCCAAATGGGAGAAATTGG + Intronic
1126126519 15:45298969-45298991 CCATTCCAAATGGGATAAATTGG - Intergenic
1126266089 15:46755794-46755816 CCATTCAAAATGGGAGAAATTGG + Intergenic
1126297841 15:47161111-47161133 CCATTCCAAATGGGAGAAATTGG + Intergenic
1126411567 15:48377460-48377482 CCATTCCAAATGGGAGAAATTGG - Intergenic
1126474439 15:49051325-49051347 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1126515091 15:49524884-49524906 CCATTCCAAATGGGAGAAATTGG - Intronic
1126824987 15:52539960-52539982 CCATTCCAAATGGGAGAAATTGG + Intergenic
1126873148 15:53010897-53010919 CCATTCTAACTAGGAGAAATTGG + Intergenic
1126942366 15:53780740-53780762 CCATTCCAAATGGGAGAAATTGG + Intergenic
1127720590 15:61695053-61695075 CCAATCCAAATGGGAGAAATTGG - Intergenic
1128642897 15:69352881-69352903 CCTCTCTGATTGGGCAAAAGAGG + Intronic
1128814073 15:70592832-70592854 CCATTCCAAATGGGAGAAATCGG - Intergenic
1129005803 15:72372393-72372415 CCACTTTACTTGGAAAAATTTGG + Intronic
1129273173 15:74429937-74429959 CCTCCCTGATTGGGAAAATTGGG + Intronic
1129396050 15:75247413-75247435 CCATTATAATGGTGAAAAATTGG + Intergenic
1129416166 15:75382514-75382536 CCATTATAATGGTGAAAAATTGG + Intronic
1129620274 15:77137592-77137614 CCATTCCAAATGGGAGAAATTGG - Intronic
1130416996 15:83703148-83703170 CCATTCCAAATGGGAGAAATTGG - Intronic
1130439236 15:83934360-83934382 CCATTCCAAATGGGAGAAATTGG - Intronic
1130739044 15:86578316-86578338 CCATTCTAAATGGGAGAAATTGG - Intronic
1131556592 15:93404795-93404817 CCATTCCAAATGGGAGAAATTGG - Intergenic
1131723899 15:95201981-95202003 CCACTTCAAATGGGAGAAATTGG - Intergenic
1131980269 15:97987640-97987662 CCATTCCAAATGGGAGAAATTGG - Intergenic
1132122879 15:99193037-99193059 CCATTCCAAATGGGAGAAATTGG - Intronic
1133426390 16:5693948-5693970 CTACTCTAACTGGGGAAAATGGG - Intergenic
1133947806 16:10363825-10363847 CCATTCCAAATGGGAGAAATTGG + Intronic
1134331894 16:13259132-13259154 CCATTCCAAATGGGAGAAATTGG + Intergenic
1134416506 16:14048071-14048093 CCATTCCAAATGGGAGAAATTGG + Intergenic
1134660507 16:15980949-15980971 CCATTCCAAATGGGAAAATTTGG + Intronic
1135275958 16:21112904-21112926 CCATTCCAAATGGGAGAAATTGG - Intronic
1136872414 16:33819738-33819760 CCATTCCAAATGGGAGAAATTGG + Intergenic
1137981681 16:53075187-53075209 CCATTCCAAATGGGAGAAATTGG - Intronic
1138800039 16:60016219-60016241 CCATTCCAAATGGGAGAAATTGG + Intergenic
1138895515 16:61199229-61199251 CCATTCCAAATGGGAGAAATTGG - Intergenic
1139007643 16:62593109-62593131 CCACTGAAATTGAGAAATATTGG - Intergenic
1139113327 16:63919257-63919279 CCATTCCAAATGGGAAAAACTGG + Intergenic
1139166170 16:64567187-64567209 CCATTCCAAATGGGAAAAACTGG - Intergenic
1140229542 16:73106161-73106183 GCGCTCTAATTGAGCAAAATGGG - Intergenic
1141306013 16:82864938-82864960 TCACTCCAAATGGGAAAAATTGG + Intronic
1203099758 16_KI270728v1_random:1296330-1296352 CCATTCCAAATGGGAGAAATTGG - Intergenic
1142840139 17:2622399-2622421 CCATTCCAAATGGGAGAAATTGG + Intronic
1144324710 17:14168115-14168137 CCATTCCAAGTGGGAGAAATTGG + Intronic
1144500012 17:15778337-15778359 CCATTCCAAATGGGAGAAATTGG + Intergenic
1145022663 17:19443745-19443767 CCATTCCAAATGGGAGAAATTGG - Intergenic
1146098439 17:29954995-29955017 CCATTCCAAATGGGAGAAATTGG - Intronic
1146149278 17:30453312-30453334 CCATTCCAAATGGGAGAAATTGG + Intronic
1146452666 17:32987118-32987140 CCATTCCAAATGGGAGAAATTGG + Intronic
1146553423 17:33801984-33802006 TCAGGCTAATTGGTAAAAATTGG + Intronic
1148390446 17:47268474-47268496 CCATTCCAAATGGGAGAAATTGG + Intronic
1149052625 17:52325163-52325185 CCATTCCAAATGGGAAAAATTGG + Intergenic
1149112294 17:53048292-53048314 CCATTCTAAATGGGAGAAATTGG + Intergenic
1149189976 17:54049936-54049958 CCATTCCAAATGGGAGAAATTGG + Intergenic
1149235142 17:54580916-54580938 CCACTCTCATAGAGAGAAATAGG + Intergenic
1149308733 17:55373759-55373781 CCATTCCAAATGGGAGAAATTGG - Intergenic
1149366875 17:55953606-55953628 CCATTCCAAATGGGAGAAATTGG - Intergenic
1149386255 17:56146031-56146053 CCATTCTAAATGTGAGAAATTGG + Intronic
1150839590 17:68595521-68595543 AGGCTCTAATTGGGAGAAATGGG + Intronic
1150941372 17:69697867-69697889 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1151041123 17:70861781-70861803 CCATTCCAAATGGGAGAAATTGG - Intergenic
1153388848 18:4532407-4532429 CCATTCCAATTGGGAGAAATTGG + Intergenic
1154042213 18:10867001-10867023 CCACTCTTAGTGGGTAAAGTGGG - Intronic
1154049271 18:10938100-10938122 CCACTCTAATTCATCAAAATGGG + Intronic
1155132715 18:22954345-22954367 CCATTCCAAATGGGAGAAATTGG + Intronic
1155187085 18:23396532-23396554 CCACTCTAATTGGGTGTATTTGG + Intronic
1155360813 18:24999577-24999599 ACACTCACATTGGGACAAATTGG + Intergenic
1155517276 18:26636523-26636545 GCACTCTCAATGGGAGAAATGGG - Intronic
1155716612 18:28952116-28952138 CCATTCCAAATGGGAAAAATTGG + Intergenic
1155818562 18:30347210-30347232 CGATTCTAAATGGGAGAAATTGG + Intergenic
1155963394 18:32014635-32014657 CCTATCTAATTGGTCAAAATTGG - Intergenic
1156052275 18:32951862-32951884 CCATTCCAAATGGGACAAATTGG + Intronic
1156151515 18:34249440-34249462 CCATTCCAACTGGGAGAAATTGG + Intergenic
1156169281 18:34462948-34462970 CCTTTCCAAATGGGAAAAATTGG + Intergenic
1156207829 18:34905625-34905647 CCATTCCAAATGGGAGAAATTGG + Intergenic
1156290756 18:35747305-35747327 CAGCTCCAATAGGGAAAAATGGG + Intergenic
1156344218 18:36241325-36241347 CCATTTTAAATGGGAGAAATTGG + Intronic
1156467644 18:37357889-37357911 CCATTCCAAATGGGAGAAATTGG - Intronic
1156614929 18:38772191-38772213 CCACTCCAAATGGGAGAAATTGG + Intergenic
1156651191 18:39228600-39228622 CCATTCCAAATGGGAGAAATTGG - Intergenic
1156809149 18:41225448-41225470 CCATTCCAAATGGGAGAAATTGG - Intergenic
1156892428 18:42205316-42205338 CCATTCTAAATGGGAGAAATTGG - Intergenic
1157158537 18:45290884-45290906 CTTCTCTAATTTGGAAAATTAGG + Intronic
1157820610 18:50765626-50765648 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1158061417 18:53348223-53348245 CCATTCCAAATGGGAGAAATTGG + Intronic
1158101597 18:53835360-53835382 CCATTCCAAATGGGAGAAATTGG - Intergenic
1158222142 18:55160806-55160828 CCATTCCAAATGGGAGAAATTGG - Intergenic
1158449037 18:57547058-57547080 CCATTCCAAATGGGAGAAATTGG - Intergenic
1158543867 18:58379361-58379383 CAACCCTAAGTGGGAGAAATCGG - Intronic
1158786628 18:60721123-60721145 CCATTCTTAATGGGAGAAATTGG + Intergenic
1159083519 18:63761292-63761314 CCATTCCAAATGGGAGAAATTGG - Intronic
1159138068 18:64360777-64360799 CCATTCTAAGTGGGAGAAATTGG + Intergenic
1159357852 18:67359343-67359365 CCATTCCAAATGGGATAAATTGG - Intergenic
1159461113 18:68723532-68723554 CCATTCCAAATGGGAGAAATTGG + Intronic
1159508127 18:69361534-69361556 CCATTCCAAATGGGAGAAATTGG - Intergenic
1159617616 18:70599203-70599225 CCACTCCAAATGTGAGAAATTGG - Intergenic
1159643291 18:70888271-70888293 CCATTCCAAATGGGAGAAATTGG - Intergenic
1159718718 18:71858674-71858696 CCATTCCAAATGGGAGAAATTGG + Intergenic
1159750972 18:72302503-72302525 CCATTCCAAATGGGAGAAATTGG + Intergenic
1159765305 18:72481379-72481401 CCATTCTAAATCGGAGAAATTGG - Intergenic
1159892234 18:73963899-73963921 TCATTCCAAATGGGAAAAATTGG + Intergenic
1159996536 18:74970479-74970501 CCATTCCAAATGGGAGAAATTGG + Intronic
1160042047 18:75354027-75354049 CCTCTCCAAATGGGAGAAATTGG - Intergenic
1160096523 18:75878350-75878372 CCATTCCAAATGGGAGAAATTGG - Intergenic
1160295151 18:77630744-77630766 CCATTCCAAATGGGAGAAATTGG + Intergenic
1160315562 18:77842519-77842541 CCAGACTAATTTGGAAAATTGGG - Intergenic
1160573796 18:79837121-79837143 CCATTCCAAATGGGAGAAATTGG + Intergenic
1162296148 19:9815151-9815173 CCATTCCAAATGGGAGAAATTGG + Intronic
1162593086 19:11605951-11605973 CCATTCCAAATGGGAGAAATTGG + Intronic
1163539784 19:17901020-17901042 CCATTCAAAATGGGAGAAATTGG - Intergenic
1164274691 19:23706057-23706079 CCACTCCAAATGGGAGAAATTGG - Intergenic
1164414002 19:28031148-28031170 CCATTCTAATTGGGAGAAATTGG + Intergenic
1164447471 19:28330254-28330276 CCATTCCAAATGGGAAAAAGTGG - Intergenic
1164851083 19:31484874-31484896 CCATTCCAAATGGGAGAAATTGG + Intergenic
1165248159 19:34509785-34509807 CCATTCCAAATGGGAGAAATTGG + Exonic
1165888308 19:39095326-39095348 CCATTCCAAATGGGAGAAATTGG + Intronic
1166118057 19:40667684-40667706 CCACTCTGCTTGGGAAAGCTGGG - Exonic
1166263792 19:41663723-41663745 CCATTCCAAATGGGAGAAATTGG + Intronic
1166410123 19:42551080-42551102 CCATTCCAAATGGGAGAAATTGG - Intronic
1166526487 19:43513577-43513599 CCATTCTAAATGGAAGAAATTGG - Intronic
1167818025 19:51901288-51901310 CCACTCTTATTAGGAAATAGTGG + Intronic
1168038272 19:53737826-53737848 CCACTGTAATTGAGGATAATGGG + Intergenic
1168105922 19:54165631-54165653 CCCCTCATATTGGGACAAATGGG + Intronic
1168702521 19:58449710-58449732 CCATTCCAAATGGGAGAAATTGG - Intergenic
924965981 2:76935-76957 CCATTCCAAATGGGAGAAATTGG + Intergenic
924993720 2:338459-338481 CCATTCCAAATGGGAGAAATTGG - Intergenic
925001128 2:403661-403683 CCATTCCAAATGGGAGAAATTGG + Intergenic
925036032 2:686517-686539 CCATTCCAAATGGGATAAATTGG - Intergenic
925295308 2:2772485-2772507 CTTCTTTAATTGGGAAGAATGGG + Intergenic
925354489 2:3228362-3228384 CCATTCCAAATGGGAGAAATTGG - Intronic
925443459 2:3908004-3908026 CCATTCCAAATGGGAGAAATTGG + Intergenic
925481993 2:4285649-4285671 CCATTCCAAATGGGAGAAATTGG - Intergenic
925638372 2:5964548-5964570 CCATTCTAATTGGGAGAAATTGG + Intergenic
925661724 2:6209802-6209824 CCATTCTAGCTGGGAGAAATTGG - Intergenic
925669243 2:6293581-6293603 CCATTCCAAATGGGAGAAATTGG - Intergenic
925805073 2:7640781-7640803 CCATTCCAAATGGGAGAAATTGG + Intergenic
925821256 2:7801789-7801811 CCACTCCAAATGGGATAAATTGG - Intergenic
926280504 2:11442205-11442227 CCATTCCAAATGGGAGAAATTGG + Intergenic
926465007 2:13177003-13177025 CCATTCCAAATGGGAGAAATTGG + Intergenic
926579818 2:14622784-14622806 CCATTCCAAATGGGAGAAATTGG + Intergenic
926597783 2:14810002-14810024 CCATTCCAAATGGGAGAAATTGG - Intergenic
926653354 2:15370739-15370761 CCATTCCAAATGGGAGAAATTGG - Intronic
926734971 2:16066570-16066592 AAAGACTAATTGGGAAAAATGGG + Intergenic
926840990 2:17080119-17080141 CCATTCCAAATGGGAGAAATTGG - Intergenic
926919401 2:17926025-17926047 CCATTCCAAATGGGAGAAATAGG + Intronic
926929531 2:18023322-18023344 CCATTCCAAATGGGGAAAATTGG + Intronic
926952220 2:18254659-18254681 CCATTCCAAATGGGAGAAATTGG - Intronic
927380812 2:22477104-22477126 CCATTCCAAATGGGAGAAATTGG - Intergenic
927396275 2:22655008-22655030 CCATTCCAAATGGGATAAATTGG - Intergenic
927438140 2:23088196-23088218 CCATTCTGAATGGGAGAAATTGG + Intergenic
927605706 2:24484423-24484445 CCATTCCAAATGGGAGAAATTGG - Intergenic
927611775 2:24548658-24548680 CCATTCCAAATGGGAGAAATTGG + Intronic
927641180 2:24846498-24846520 CCATTCCAAATGGGAGAAATTGG - Intronic
927660840 2:24991477-24991499 CCATTCCAAATGGGAGAAATTGG - Intergenic
928211082 2:29324198-29324220 CCACTCTAAGAGAGACAAATTGG + Intronic
928465662 2:31520171-31520193 CCATTCTGAATGGGAGAAATTGG - Intergenic
928474962 2:31616598-31616620 CCATTCCAAATGGGAGAAATTGG - Intergenic
928680052 2:33692553-33692575 CCATTCCAAATGGGAAAAATTGG + Intergenic
928725706 2:34171501-34171523 CCACTCTAAATGGAAGAAATTGG + Intergenic
928808989 2:35198784-35198806 CCATTCCAAATGGGAGAAATTGG - Intergenic
928837061 2:35559600-35559622 CCATTCTAAATGGGAGAAATAGG - Intergenic
928950948 2:36812497-36812519 CCAATCTTAGTGGGAAAACTGGG - Intronic
929358203 2:41051278-41051300 CCATTCTAAATGGGAGAAATTGG - Intergenic
929382435 2:41368590-41368612 TTACTCTAAATGGGAAAAAATGG + Intergenic
929689091 2:44059824-44059846 CCACTCCAAATGGGAGAAATTGG + Intergenic
929770936 2:44891600-44891622 CCATTCCAAATGGGAGAAATTGG + Intergenic
930076227 2:47407758-47407780 CCATTCCAAATGGGAGAAATTGG - Intronic
930263195 2:49170730-49170752 CCATTCCAAATGGGAGAAATTGG - Intergenic
930280345 2:49362205-49362227 CCATTCCAAATGGGAGAAATTGG + Intergenic
930299285 2:49594533-49594555 CCATTCCAAATGGGAGAAATTGG - Intergenic
930419750 2:51135515-51135537 CCATTCTAAATGGGACAAATTGG - Intergenic
930481347 2:51952252-51952274 CCATTCCAAATGGGAGAAATTGG + Intergenic
930536034 2:52647808-52647830 CCATTCCAAATGGGAGAAATTGG + Intergenic
930988848 2:57626421-57626443 CCAATCTGATTGGGATAAAAAGG + Intergenic
931006522 2:57855943-57855965 CCATTCCAAATGGGAGAAATTGG + Intergenic
931111906 2:59120070-59120092 CCACTCTAATATGTAAAATTTGG + Intergenic
931154193 2:59608704-59608726 CCATTCTAAATGGGAGAAATTGG - Intergenic
932243758 2:70179006-70179028 CCACACTAATTTAGAAATATAGG - Intronic
932317935 2:70798579-70798601 CCATTCCAAATGGGAGAAATTGG + Intergenic
932428205 2:71657140-71657162 CCATTCCAAATGGGAGAAATTGG + Intronic
932552400 2:72785017-72785039 CCATTCCAAATGGGAGAAATTGG + Intronic
932849614 2:75171771-75171793 CCATTCCAAGTGGGAGAAATTGG - Intronic
932904324 2:75733405-75733427 CCATTCCAAATGGGAGAAATTGG + Intergenic
932935598 2:76098038-76098060 CCACTCTAAATGGGAGAAATTGG + Intergenic
932960721 2:76409364-76409386 CCATTCCAAATGGGAGAAATTGG - Intergenic
933065106 2:77782274-77782296 CCATTATAAATGGGAGAAATTGG - Intergenic
933088503 2:78088655-78088677 CCACTCTGTTTGGCAACAATGGG + Intergenic
933790886 2:85882906-85882928 CCATTCCAAATGGGAGAAATTGG - Intronic
933798621 2:85942071-85942093 CCATTCCAAATGGGAGAAATTGG + Intergenic
934055070 2:88244486-88244508 CCATTCCAAGTGGGATAAATTGG - Intergenic
934700930 2:96439447-96439469 CCATTCCAAATGGGAGAAATTGG - Intergenic
934940474 2:98497893-98497915 CCATTCCAAATGGGAGAAATTGG - Intronic
935495620 2:103777247-103777269 CCATTCCAAAAGGGAAAAATAGG - Intergenic
935927858 2:108089604-108089626 CCATTCCAAATGGGAGAAATTGG - Intergenic
936014429 2:108947085-108947107 CCATTCCAAATGGGAAAAATTGG + Intronic
936161878 2:110089545-110089567 CCATTCCAAATGGGAGAAATTGG - Intronic
936182785 2:110281809-110281831 CCATTCCAAATGGGAGAAATTGG + Intergenic
936543827 2:113373486-113373508 CCATTCCAAATGGGAGAAATTGG + Intergenic
936788636 2:116124534-116124556 CCATTCCAAATGGGAGAAATTGG - Intergenic
936822652 2:116542161-116542183 CCATTCCAAATGGGAGAAATTGG + Intergenic
936843443 2:116802193-116802215 CCATTCCAAATGGGAGAAATTGG + Intergenic
936915798 2:117637987-117638009 CCATTCCAAATGGGAGAAATTGG - Intergenic
936940942 2:117883397-117883419 CCATTCCAAATGGGAGAAATTGG - Intergenic
936969713 2:118165256-118165278 CCATTCCAAATGGGAGAAATTGG - Intergenic
937142360 2:119612987-119613009 CCATTCCAAATGGGAGAAATTGG + Intronic
937620636 2:123980873-123980895 CCATTCTAATTGGGAGAAATTGG - Intergenic
937763001 2:125628043-125628065 CCATTCCAAATGGGACAAATTGG - Intergenic
937881192 2:126866100-126866122 CCATTCTAAATGGGAGAAATTGG + Intergenic
938176787 2:129140721-129140743 TAACTATAATGGGGAAAAATTGG - Intergenic
938411765 2:131070796-131070818 CCACTCTAAAGGGAAAAAATGGG + Intronic
938513773 2:131980298-131980320 CCATTCCAGATGGGAAAAATTGG + Intergenic
938820333 2:134951409-134951431 CCACACTACTTTGGAAAAGTGGG + Intronic
939037474 2:137149736-137149758 CCATTCCAAATGGGAAAAATTGG - Intronic
939053333 2:137332367-137332389 CCATTCTGAATGGGAGAAATTGG - Intronic
939190531 2:138912249-138912271 CCATTCCAAATGGGAGAAATTGG + Intergenic
939214532 2:139219021-139219043 CCATTCCAAATGGGACAAATTGG - Intergenic
939272696 2:139960416-139960438 CCATTCCAAATGGGAGAAATTGG - Intergenic
939445907 2:142310083-142310105 CCACTCCAAATGGGAGAAATTGG + Intergenic
939506822 2:143056525-143056547 CCATTTTAAATGGGAGAAATTGG + Intergenic
939752343 2:146063598-146063620 CCATTCCAAATGGGATAAATTGG + Intergenic
939757932 2:146137153-146137175 CCACTCCAAATGGGAGAAATTGG + Intergenic
939781741 2:146458383-146458405 CCATTCAAAATGGGAGAAATTGG + Intergenic
939842455 2:147205786-147205808 CCATTCCAAATGGGAGAAATTGG + Intergenic
939847710 2:147268452-147268474 CCATTTCAAATGGGAAAAATTGG + Intergenic
940136002 2:150436365-150436387 CCATTCCAAATGGGAGAAATTGG - Intergenic
940355560 2:152738051-152738073 CCATTCCAAATGGGATAAATTGG + Intronic
940402806 2:153267013-153267035 CCATTCCAAATGGGAGAAATTGG + Intergenic
940430801 2:153587935-153587957 CCATTCCAAATGGGAGAAATTGG + Intergenic
940484180 2:154276022-154276044 CCATTCCAAATGGGAGAAATTGG - Intronic
940888767 2:159014719-159014741 CCATTCCAAATGGGAGAAATTGG + Intronic
941123823 2:161562134-161562156 CCATTCCAAATGGGAGAAATTGG - Intronic
941165416 2:162078467-162078489 CCATTCCAAATGGGAGAAATTGG + Intergenic
941227144 2:162864621-162864643 CCATTCCAAATGGGAGAAATTGG + Intergenic
941319820 2:164040962-164040984 CCATTCGAAATGGGAAAACTTGG + Intergenic
941338013 2:164268682-164268704 CCATTCCAAATGGGAGAAATTGG - Intergenic
941346321 2:164373049-164373071 CCATTCCAAATGGGAGAAATTGG - Intergenic
941423985 2:165320112-165320134 CCATTCCAAATGGGAGAAATTGG + Intronic
941468841 2:165860343-165860365 CCATTCCAAATGGGAGAAATTGG + Intronic
941490694 2:166139036-166139058 CCATTCAAAATGGGAGAAATTGG - Intergenic
941560368 2:167036481-167036503 CCATTCCAAATGGGATAAATTGG - Intronic
941578823 2:167269102-167269124 CCATTCTAAATGGGAGAAATCGG - Intergenic
941741977 2:169044737-169044759 CCATTCCAAATGGGAGAAATTGG - Intergenic
941967360 2:171313053-171313075 CCATTCCAAATGGGAGAAATTGG - Intergenic
941977820 2:171424627-171424649 CCATTCCAAATGGGAGAAATTGG - Intronic
942123688 2:172802828-172802850 CCATTCCAAATGGGAGAAATTGG + Intronic
942234403 2:173890070-173890092 CCATTCCAAATGGGATAAATTGG - Intergenic
942319524 2:174724431-174724453 CCATTCCAAATGGGAGAAATTGG + Intergenic
942420050 2:175797882-175797904 CCATTCCAAATGGGAGAAATTGG - Intergenic
942601433 2:177644449-177644471 CCATTCCAAATGGGAGAAATTGG - Intronic
942644416 2:178095273-178095295 CCATTCCAAATGGGAGAAATTGG + Intronic
942649716 2:178154211-178154233 CCAATCTAAATGGGAGAAATTGG + Intergenic
942727603 2:179026930-179026952 CCATTCCAAATGGGAGAAATTGG - Intronic
942733284 2:179082297-179082319 CCATTCCAAATGGGAGAAATTGG + Intergenic
942805715 2:179929500-179929522 CCATTCCAAATGGGATAAATTGG + Intergenic
942950169 2:181712733-181712755 CCATTCCAAATGGGAGAAATTGG - Intergenic
943072106 2:183153469-183153491 CCATTCCAAATGGGAGAAATTGG + Intronic
943093018 2:183396223-183396245 CCATTCCAAATGGGAGAAATTGG - Intergenic
943205218 2:184886142-184886164 CCATTCCAAATGGGAGAAATTGG + Intronic
943251341 2:185524316-185524338 CCATTCCAAATGGGAGAAATTGG - Intergenic
943315717 2:186385563-186385585 CCATTCCAAATGGGAGAAATTGG + Intergenic
943376489 2:187083836-187083858 ACACTGAAATTGGGAAAAACTGG + Intergenic
943415008 2:187590988-187591010 CCATTCTAAAGGGGAGAAATTGG + Intergenic
943478107 2:188384737-188384759 CCATTCCAAATGGGAGAAATTGG + Intronic
943543279 2:189243860-189243882 CCATTCAAAATGGGAGAAATTGG + Intergenic
943565424 2:189510382-189510404 CCATTCCAAATGGGAGAAATTGG - Intergenic
943788245 2:191901961-191901983 CCATTCCAAATGGGAGAAATTGG - Intergenic
943804984 2:192112425-192112447 CCATTCCAAATGGGAGAAATTGG - Intronic
943936162 2:193919335-193919357 CCATTCCAAATGGGAGAAATTGG - Intergenic
944371112 2:198985060-198985082 CCATTCAAAATGGGAGAAATTGG + Intergenic
944477688 2:200124482-200124504 CCACTCCATATGGGAGAAATTGG + Intergenic
944800253 2:203231695-203231717 CCATTCCAAATGGGAGAAATTGG - Intergenic
945114187 2:206394532-206394554 CCATTCCAAATGGGAGAAATTGG - Intergenic
945325022 2:208472029-208472051 CCATTCCAAATGGGATAAATTGG - Intronic
945357944 2:208860867-208860889 CCATTCTAAATGGGAGAAACTGG - Intergenic
945360207 2:208887208-208887230 CCATTCCAAATGGGAGAAATTGG - Intergenic
945457173 2:210063693-210063715 CCATTCCAAATGGGAAAAATTGG - Intronic
945484842 2:210382583-210382605 CCATTCCAAATGGGAGAAATTGG - Intergenic
945623496 2:212171249-212171271 CCATTCCAAATGGGAGAAATTGG - Intronic
945681438 2:212918735-212918757 CCAAACAAATTCGGAAAAATTGG + Intergenic
945713554 2:213330493-213330515 CCATTCCAAATGGGAGAAATTGG - Intronic
945756708 2:213856120-213856142 CCATTCCAAATGGGAGAAATTGG + Intronic
946732165 2:222720349-222720371 CCACTCCAAATGGGAGAAATTGG + Intergenic
946757635 2:222963346-222963368 CCATTCCAAATGGGAGAAATTGG - Intergenic
946760507 2:222988938-222988960 CCATTCCAAATGGGAGAAATTGG + Intergenic
946930003 2:224661919-224661941 CCATTCCAAATGGGAGAAATTGG + Intergenic
946988697 2:225303275-225303297 CCATTCCAAATGGGAAAAATTGG - Intergenic
947296357 2:228635226-228635248 CCATTCCAAATGGGAGAAATTGG + Intergenic
947646979 2:231749361-231749383 CCATTCCAAATGGGAGAAATTGG - Intronic
947888634 2:233596114-233596136 CCATTCCAAATGGGAGAAATTGG - Intergenic
947893357 2:233645557-233645579 CCATTCCAACTGGGAAAAATTGG + Intronic
948009211 2:234637197-234637219 CCATTCCAAATGGGAGAAATTGG - Intergenic
948016671 2:234696843-234696865 CCATTCCAAATGGGAAAAATTGG + Intergenic
948837772 2:240634491-240634513 CCATTCCAAATGGGATAAATTGG - Intergenic
1169592926 20:7164594-7164616 CCACTCCTAATGGGAGAAATTGG - Intergenic
1169676263 20:8158718-8158740 CCATTCCAAATGGGAGAAATTGG + Intronic
1169985133 20:11435629-11435651 CCATTCCAAATGGGAGAAATTGG + Intergenic
1170337010 20:15281472-15281494 CCATTCCAAATGGGAGAAATTGG + Intronic
1170364851 20:15587627-15587649 CCATTCCAAATGGGAGAAATTGG + Intronic
1171074726 20:22110970-22110992 ACTCTCTAATTGGGCAATATAGG - Intergenic
1172811916 20:37654278-37654300 CCATTCCAAATGGGAGAAATTGG + Intergenic
1172893101 20:38281030-38281052 CCATTCCAAATGGGAGAAATCGG + Intronic
1173023617 20:39287897-39287919 CCATTCCAAATGGGAGAAATTGG - Intergenic
1173054733 20:39599992-39600014 CAATTCTAATTGGAAAAAAAAGG - Intergenic
1173263963 20:41461103-41461125 CCATTCCAAATGGGAGAAATTGG - Intronic
1173323331 20:42009577-42009599 CCATTCCAAATGGGAGAAATTGG + Intergenic
1173491546 20:43486827-43486849 CCATTCCAAATGGGAGAAATTGG + Intergenic
1174951117 20:55042154-55042176 CCATTCCAAATGGGAGAAATTGG - Intergenic
1175008587 20:55711333-55711355 CCATTCCAAATGGGAGAAATTGG - Intergenic
1175044667 20:56093787-56093809 TCACTCCAAATGGGAGAAATTGG + Intergenic
1175195286 20:57239225-57239247 CCATTCCAAATGGGAGAAATTGG + Intronic
1176358707 21:5974296-5974318 CCATTCTGAATGGGAGAAATTGG - Intergenic
1176688963 21:9881373-9881395 CCATTCCAAATGGGAGAAATTGG + Intergenic
1176780010 21:13182598-13182620 CCATTCCAGATGGGAAAAATTGG - Intergenic
1176925542 21:14745024-14745046 CTGCTCTAAATGGGAGAAATTGG + Intergenic
1176934010 21:14845761-14845783 CCATTCCAAATGGGAGAAATTGG + Intergenic
1177238811 21:18429166-18429188 CCATTCCAAATGGGAGAAATTGG - Intronic
1177267097 21:18798971-18798993 CCATTCCAAATGGGAGAAATTGG - Intergenic
1177367134 21:20153141-20153163 CCATTCCAAATGGGAAAAATTGG + Intergenic
1177393114 21:20501827-20501849 CCATTCTAAATAGGAGAAATTGG + Intergenic
1177401814 21:20614497-20614519 CCATTCTAAATGGGAGAAATTGG - Intergenic
1177471204 21:21563276-21563298 CTATTCCAAATGGGAAAAATTGG + Intergenic
1177473169 21:21584577-21584599 CCATTCCAAATGGGAGAAATTGG - Intergenic
1177478220 21:21651543-21651565 CCATTCCAAATGGGAGAAATTGG - Intergenic
1177561291 21:22757643-22757665 CTGCTGTAATTGGGACAAATAGG + Intergenic
1177594055 21:23212733-23212755 CTATTCTAAATGGGAGAAATTGG + Intergenic
1177628851 21:23700873-23700895 CCATTCCAAATGGGAGAAATTGG - Intergenic
1177653534 21:23987329-23987351 CCATTCCAAATGGGAAAAATTGG + Intergenic
1177654804 21:24003719-24003741 CCATTCCAAATGGGAGAAATTGG + Intergenic
1177656275 21:24020775-24020797 CCATTCCAAATGGGAGAAATTGG - Intergenic
1177686784 21:24447523-24447545 CCATTCCAAATGGGAGAAATAGG + Intergenic
1177742250 21:25168325-25168347 CCATTCTACATGGGATAAATTGG - Intergenic
1177767418 21:25474257-25474279 CCATTCCAAATGGGAGAAATTGG - Intergenic
1178004014 21:28196431-28196453 CCATTCCAAATGGGAGAAATTGG + Intergenic
1178224412 21:30699228-30699250 CCATTCCAAATGGGAGAAATTGG + Intergenic
1178338698 21:31766749-31766771 CCATTCCAAATGGGAGAAATTGG - Intergenic
1178681912 21:34679674-34679696 CCACTCCAAGTGGGAGAAGTTGG + Intronic
1178709712 21:34905352-34905374 CCACTCTAATTGGGAAAGGTGGG - Intronic
1179065213 21:38018283-38018305 CCATTCCAAATGGGAGAAATTGG - Intronic
1179450267 21:41463745-41463767 CCATTCCAAATGGGAGAAATTGG - Intergenic
1179764811 21:43564254-43564276 CCATTCTGAATGGGAGAAATTGG + Intronic
1180295304 22:10928875-10928897 ACACCCTAATAGGGAAAAAAGGG - Intergenic
1181563952 22:23722593-23722615 CCTCTCTAAAAGGGATAAATTGG + Intergenic
1182330085 22:29545545-29545567 CCATTCCAAATGGGAGAAATTGG + Intronic
1182505160 22:30776983-30777005 CCATTCCAAATGGGAGAAATTGG - Intronic
1182650558 22:31847970-31847992 CCATTCCAAATGGGAGAAATTGG + Intronic
1182816896 22:33172161-33172183 CCATTCTAAATGGGAGAAATTGG - Intronic
1182913308 22:34005677-34005699 CCATTCCAAATGGGAGAAATTGG + Intergenic
1184312017 22:43651872-43651894 CCATTCAAAATGGGAGAAATTGG - Intronic
1184507311 22:44912102-44912124 CCATTCCAAATGGGAGAAATTGG - Intronic
1184713176 22:46265090-46265112 CCATTCCAAATGGGAGAAATTGG + Intergenic
949230351 3:1743580-1743602 CCACTCCAAATGGGAGAAATTGG + Intergenic
949662088 3:6291460-6291482 CCATTCAAAATGGGAGAAATTGG + Intergenic
949673228 3:6424143-6424165 CCATTCCAAATGGGAGAAATTGG + Intergenic
950146100 3:10651007-10651029 CCATTCCAAATGGGAGAAATTGG - Intronic
950589397 3:13925336-13925358 CCATTCCAAATGGGAGAAATTGG - Intergenic
950696177 3:14702935-14702957 CCATTCCAAATGGGAAAAAATGG + Intronic
950800834 3:15550750-15550772 CCATTCCAAATGGGAGAAATTGG - Intergenic
950832403 3:15887751-15887773 CCATTCTAAAAGGGAGAAATAGG - Intergenic
951058148 3:18172607-18172629 CCATTCCAAATGGGAGAAATTGG + Intronic
951180595 3:19654435-19654457 CCATTCCAAATGGGAGAAATTGG + Intergenic
951316872 3:21197803-21197825 CCATTCTAACTGGGATAAAATGG + Intergenic
951317653 3:21205799-21205821 CCATTCCAAATGGGAGAAATTGG - Intergenic
951320314 3:21236409-21236431 CCACTCTAATTGTGATAGATTGG + Intergenic
951773421 3:26283384-26283406 CCATTCCAAATGGGAGAAATTGG + Intergenic
951801659 3:26603266-26603288 CCATTCCAAATGGGAGAAATTGG + Intergenic
951920773 3:27852256-27852278 CCATTCTAAATGGGAGAAATTGG + Intergenic
951935404 3:28017300-28017322 CCACTATCTTTGAGAAAAATTGG + Intergenic
952170190 3:30798824-30798846 CCATTCCAAATGGGAGAAATTGG + Intronic
952202588 3:31147049-31147071 CCATTCAAAATGGGAGAAATTGG + Intergenic
952504445 3:33995379-33995401 CCATTCCAAATGGGAGAAATCGG + Intergenic
952569838 3:34701374-34701396 CCATTTTAAATGGGATAAATTGG + Intergenic
952589431 3:34932791-34932813 CCATTCCAAATGGGAAAAATTGG - Intergenic
952596713 3:35027592-35027614 CCATTCCAAATGGGAGAAATTGG + Intergenic
952605808 3:35145780-35145802 CCATTCCAAATGGGAGAAATTGG + Intergenic
952671469 3:35974362-35974384 CCATTCCAAATGGGATAAATTGG + Intergenic
952831324 3:37567648-37567670 TCATTCCAAATGGGAAAAATTGG + Intronic
953101418 3:39832756-39832778 CCACCTGAATGGGGAAAAATTGG - Intronic
953185048 3:40629860-40629882 CCATTCCAAATGGGAGAAATTGG - Intergenic
953359279 3:42280674-42280696 CCATTCCAAATGGGAAAAATTGG - Intergenic
953446716 3:42974653-42974675 CCATTCCAAATGGGAGAAATTGG - Intronic
953624751 3:44561662-44561684 CCATTCCAAATGGGAGAAATTGG + Intronic
953681106 3:45038933-45038955 CAACTCTAAAAGTGAAAAATAGG + Intergenic
953826835 3:46260478-46260500 CCATTCTAAATGGGAGAAATTGG + Intronic
954345471 3:49994034-49994056 CCACTCGAATTACGAAAATTAGG - Intronic
954605575 3:51906633-51906655 CCATTCTAAATGGGAGAAATTGG - Intergenic
954759484 3:52863762-52863784 CCACTCCAAATGGGAGAAATTGG + Intronic
955395367 3:58553552-58553574 CCATTCCAAATGGGAGAAATTGG + Intergenic
955826387 3:62951916-62951938 CCATTCCAAATGGGAAACATTGG - Intergenic
955970726 3:64435892-64435914 CCATTCCAAATGGGAGAAATTGG - Intronic
956475037 3:69610535-69610557 CCATTCCAAATGGGAACAATTGG - Intergenic
956571416 3:70700353-70700375 ACACTCTATTAGGGGAAAATAGG + Intergenic
956679203 3:71762137-71762159 GCAGGCTAATTGGGAAAACTTGG + Intergenic
956714095 3:72063182-72063204 CCATTCCAAATGGGAGAAATTGG + Intergenic
956938504 3:74131407-74131429 CCATTCCAAATGGGAGAAATTGG + Intergenic
956947006 3:74234576-74234598 CCACTCTTAATGGGAGAAATTGG + Intergenic
957276175 3:78093779-78093801 CCATTCCAAATGGGAGAAATTGG - Intergenic
957374386 3:79337019-79337041 CCATTCCAAATGGGAGAAATTGG - Intronic
957457725 3:80473308-80473330 CCATTCCAAATGGGAGAAATTGG - Intergenic
957557443 3:81780321-81780343 CCATTCCAAGTGGGAGAAATTGG + Intergenic
957762087 3:84572211-84572233 CCACTCCAAATGAGAGAAATTGG + Intergenic
957820921 3:85373231-85373253 CCATTCCAAATGGGATAAATTGG + Intronic
957945390 3:87057149-87057171 CCATTCAAAATGGGAGAAATTGG + Intergenic
957949604 3:87107655-87107677 CCATTCTAAATGGGAGGAATTGG - Intergenic
957982363 3:87526055-87526077 CAACTCTAAATGGGAGAAATTGG - Intergenic
957987401 3:87589755-87589777 CCATTCCAACTGGGAGAAATTGG + Intergenic
957988091 3:87596782-87596804 CCATTCAAAATGGGAGAAATTGG + Intergenic
958018479 3:87969523-87969545 CCATTCAAAATGGGAGAAATTGG - Intergenic
958066026 3:88545493-88545515 CCATTCCAAATGGGAGAAATTGG - Intergenic
958087204 3:88825568-88825590 CCTCAGTAATAGGGAAAAATAGG + Intergenic
958152033 3:89703635-89703657 CCATTCCAAATGGGAGAAATTGG + Intergenic
958157237 3:89770938-89770960 CCATTCCAAATGGGAGAAATTGG + Intergenic
958175383 3:89990019-89990041 CCATTCCAAATGGGAGAAATTGG - Intergenic
958481698 3:94652305-94652327 CCATTCCAAATGGGAGAAATAGG - Intergenic
958550510 3:95606784-95606806 CCATTCCAAATGGGAGAAATTGG + Intergenic
958583111 3:96052049-96052071 CCATTCCAAGTGGGAGAAATTGG + Intergenic
958611809 3:96436262-96436284 TCATTCTAAATGGGAGAAATTGG + Intergenic
958630277 3:96674539-96674561 CCACTCTAATTGTTTATAATGGG + Intergenic
958650000 3:96926607-96926629 TTACTCTAAATGGGAGAAATTGG + Intronic
958836939 3:99157122-99157144 CCAGTCTAGATGGGAGAAATTGG - Intergenic
958955073 3:100458322-100458344 CCATTCCAAATGGGAGAAATTGG + Intergenic
959054540 3:101554253-101554275 CCATTCCAAATGGGAGAAATTGG - Intergenic
959113733 3:102151728-102151750 CCATTCCAAATGGGATAAATTGG + Intronic
959119120 3:102211908-102211930 CCATTCCAAATGGGATAAATTGG + Intronic
959161100 3:102725159-102725181 CCATTCCAAATGGGAGAAATTGG - Intergenic
959171954 3:102854662-102854684 CCATTCCAAATGGGAGAAATTGG + Intergenic
959172435 3:102859611-102859633 CCATTCCAAATGGGAAAAACTGG + Intergenic
959233569 3:103690065-103690087 CCATTCCAAATGGGAGAAATTGG + Intergenic
959267878 3:104167342-104167364 CCATTCCAAATGGGAAAAGTTGG + Intergenic
959299349 3:104578308-104578330 CCATTCCAAATGGGAGAAATTGG + Intergenic
959311892 3:104749047-104749069 CCATTCTAAAAGGGAAAAATAGG - Intergenic
959319172 3:104848749-104848771 CCATTCCAAATGGGAAAAATTGG - Intergenic
959390188 3:105763105-105763127 CCATTCTGAATGGGAGAAATTGG - Intronic
959439885 3:106361858-106361880 CCATTCCAAATGGGAGAAATTGG - Intergenic
959507481 3:107171833-107171855 CCATTCCAAGTGGGAGAAATTGG - Intergenic
959523256 3:107344874-107344896 CCACTCTAATTGGGCTGAGTGGG + Intergenic
959624423 3:108433261-108433283 CCATTCCAAATGGGAGAAATTGG - Intronic
959719437 3:109470323-109470345 CCATTCCAAGTGGGAGAAATTGG - Intergenic
959754642 3:109883287-109883309 CTGTTCTAAATGGGAAAAATTGG + Intergenic
959893582 3:111583119-111583141 CCATTCTAAATGGGAGAAATTGG + Intronic
959988082 3:112599198-112599220 CCACTGGACTTGGGAAAACTGGG - Intergenic
960255459 3:115506376-115506398 CCATTCCAAATGGGAGAAATTGG - Intergenic
960341445 3:116479569-116479591 CCATTCCAAATGGGACAAATTGG - Intronic
960564325 3:119117824-119117846 CCATCCCAAATGGGAAAAATTGG + Intronic
960843020 3:121979154-121979176 CCATTCCAAATGGGAGAAATTGG - Intergenic
960849559 3:122037507-122037529 CCATTCCAAATGGGAGAAATTGG - Intergenic
961067715 3:123890489-123890511 CCATTCTAAATGGGAGAATTTGG + Intergenic
961823346 3:129586383-129586405 ACACTCTAATGGGGGAACATGGG + Intronic
962035111 3:131643390-131643412 CCAATCCAAATGGGATAAATTGG - Intronic
962045853 3:131758417-131758439 CCATTCCAAATGGGAGAAATTGG - Intronic
962067081 3:131992439-131992461 CCATTCCAAATGGGAGAAATTGG - Intronic
962170712 3:133098656-133098678 CCATTCCAAATGGGAGAAATTGG + Intronic
962339415 3:134569406-134569428 CCATTCCAAATGGGAGAAATTGG + Intronic
962440103 3:135405839-135405861 CCATTCCAAATGGGAGAAATTGG + Intergenic
962480899 3:135797526-135797548 CCACTGTAATTTTAAAAAATTGG - Intergenic
962659303 3:137585362-137585384 TCATTCTAAATGGGAGAAATTGG + Intergenic
962770106 3:138603690-138603712 CCATTCCAAATGGGAGAAATTGG + Intergenic
962951881 3:140227246-140227268 CCAATCCAAATGGGAGAAATTGG + Intronic
963363144 3:144302770-144302792 CCACTGCAAATGGGAGAAATTGG + Intergenic
963368356 3:144367131-144367153 CCATTCCAAATGGGAGAAATTGG + Intergenic
963391098 3:144665148-144665170 CCATTCTGAATGGGAGAAATTGG + Intergenic
963471529 3:145747943-145747965 CCATTCCAAATGGGAGAAATTGG + Intergenic
963581767 3:147134807-147134829 CCATTCCAAATGGGAGAAATTGG + Intergenic
963592910 3:147286052-147286074 CCATTCCAAATGGGAGAAATTGG + Intergenic
964088610 3:152847391-152847413 CCATTCCAAATGGGAGAAATTGG - Intergenic
964427486 3:156568760-156568782 CCATTCCAAATGGGAGAAATTGG - Intergenic
964457386 3:156883244-156883266 CCATTCCAAATGGGGAAAATGGG - Intronic
964605611 3:158556784-158556806 CCATTCCAAATGGGAGAAATTGG - Intergenic
964632838 3:158831370-158831392 CCACTCTAATTTACAATAATAGG + Intergenic
964654636 3:159052580-159052602 CCATTCCAAATGGGAGAAATTGG - Intronic
964910850 3:161777768-161777790 CTACTCTAAATGAGAGAAATTGG - Intergenic
964912566 3:161800650-161800672 CCATTCAAAATGGGAGAAATTGG + Intergenic
964923506 3:161926966-161926988 CCATTCTGAATGGGAGAAATTGG - Intergenic
964926490 3:161964133-161964155 CCATTCTAAATGGGGGAAATTGG - Intergenic
964933931 3:162059111-162059133 CCATTCCAAATGGGAGAAATTGG + Intergenic
964978488 3:162648148-162648170 CCATTCCAAATGGGAGAAATTGG - Intergenic
965025021 3:163291266-163291288 CAATTCCAAATGGGAAAAATTGG + Intergenic
965067843 3:163875161-163875183 CCATTCCAAATGGGAGAAATTGG - Intergenic
965083486 3:164065163-164065185 CCATTCCAAATGGGAGAAATTGG - Intergenic
965092510 3:164181225-164181247 CCACTCCAAATGGGAGAAATTGG + Intergenic
965198924 3:165631801-165631823 CCATTCCAAATGGGATAAATTGG - Intergenic
965203558 3:165692363-165692385 CCATTCCAAATGGGAGAAATTGG + Intergenic
965264958 3:166531490-166531512 CCATTCTAAATGGGATAAGTTGG + Intergenic
965649573 3:170919564-170919586 CCATTCCAAATGGGAGAAATTGG - Intergenic
965776971 3:172241994-172242016 CCATTCGAAATGGGAGAAATTGG + Intronic
965838898 3:172881046-172881068 CCATTCCAAATGGGAGAAATTGG - Intergenic
965897349 3:173594295-173594317 CCATTCCAAATGGGAGAAATTGG + Intronic
966047111 3:175565613-175565635 CCACTTTATTAGGGAAAAACAGG - Intronic
966074866 3:175924116-175924138 CCATTCCAAATTGGAAAAATTGG + Intergenic
966153680 3:176892880-176892902 CCATTCCAAATGGGAGAAATTGG - Intergenic
966333321 3:178840093-178840115 CCATTCCAAATGGGAGAAATTGG + Intronic
966733270 3:183168267-183168289 CCATTCCAAATGGGAGAAATTGG + Intergenic
967406273 3:189119250-189119272 CCATTCTACATGGGAGAAATTGG - Intronic
967412429 3:189180467-189180489 CCATTCCAAATGGGAGAAATTGG + Intronic
967462215 3:189760378-189760400 CCATTCCAAATGGGAGAAATTGG + Intronic
967513581 3:190340847-190340869 CCATTCCAAATGGGAGAAATTGG + Intronic
967566650 3:190980500-190980522 CCATTCTGAATGGGAGAAATTGG - Intergenic
967582829 3:191179690-191179712 CCACTCCAAATGGGAGAAATTGG - Intergenic
967633975 3:191778941-191778963 CCATTCCAAATGGGAAAAATTGG - Intergenic
967689618 3:192458557-192458579 CCATTCCAAATGGGAAAAATTGG - Intronic
967749936 3:193101931-193101953 CCATTCCAAATGGGAGAAATTGG - Intergenic
967776932 3:193394839-193394861 CCATTCTGAATGGGAGAAATTGG + Intergenic
967908397 3:194520622-194520644 CCATTCCAAATGGGAGAAATTGG - Intergenic
968217251 3:196903784-196903806 CCACTATAATTGGGACCAGTAGG - Intronic
968295221 3:197571147-197571169 CCATTCCAAATGGGAGAAATGGG - Intronic
968354492 3:198093752-198093774 CCATTCCAAATGGGAGAAATTGG + Intergenic
968767263 4:2479150-2479172 CCATTCCAAATGGGAGAAATTGG - Intronic
968892778 4:3380111-3380133 CCATTCCAAATGGGAGAAATTGG + Intronic
969072667 4:4551947-4551969 CCATTCCAAATGGGAGAAATTGG - Intergenic
969152016 4:5177702-5177724 CCATTCCAAATGGGAGAAATTGG + Intronic
969901565 4:10355033-10355055 CCACTCTAAAAGTGATAAATTGG + Intergenic
969996343 4:11316924-11316946 CCATTCCAAATGGGAGAAATTGG + Intergenic
970217977 4:13779258-13779280 CCATTCCAAATGGGAGAAATTGG + Intergenic
970343961 4:15135488-15135510 CCATTCCAAATGGGAGAAATTGG + Intergenic
970351624 4:15207270-15207292 CCATTCCAAATGGGAGAAATTGG - Intergenic
970569218 4:17363254-17363276 ACCCTCTAACTGGGAAAATTAGG - Intergenic
970577644 4:17443726-17443748 CCATTCCAAGTGGGAGAAATTGG + Intergenic
970678184 4:18476866-18476888 CCATTCCAAATGGGAGAAATTGG + Intergenic
970721758 4:18996829-18996851 CCATTCGAAATGGGAGAAATTGG + Intergenic
970742139 4:19251092-19251114 CCATTCTAAATGGGAGAAATTGG - Intergenic
970750363 4:19352641-19352663 CCATTCTAAATAGGATAAATTGG + Intergenic
970784814 4:19783314-19783336 CCATTCAAATTGGGAGAAATTGG + Intergenic
970801256 4:19976016-19976038 CCACTCCAAATGGGAGAAATTGG + Intergenic
970868084 4:20781992-20782014 CCATTCCAAATGGGAGAAATTGG + Intronic
970909228 4:21255129-21255151 CCTCTATAGTTGGGCAAAATGGG - Intronic
970979055 4:22075487-22075509 CCATTCCAAATGGGAGAAATTGG - Intergenic
970987554 4:22176280-22176302 CCATTCCAAATGGGATAAATTGG + Intergenic
970997502 4:22283692-22283714 CCATTCCAAATGGGAGAAATTGG - Intergenic
971072019 4:23105091-23105113 CCATTCCAAATGGGAGAAATTGG - Intergenic
971277830 4:25215047-25215069 CCATTCCAAATGGGAGAAATTGG + Intronic
971499163 4:27300185-27300207 CCATTCCAAATGGGAGAAATTGG + Intergenic
971591412 4:28473741-28473763 CCATTCCAAATGGGAGAAATTGG - Intergenic
971593400 4:28497506-28497528 CCATTCCAAATGGGATAAATTGG + Intergenic
971649781 4:29257072-29257094 CCATTCCAAATGGGAGAAATTGG - Intergenic
971815153 4:31477388-31477410 CCATTCAAAATGGGAGAAATTGG - Intergenic
971844818 4:31905751-31905773 CCATTCCAAATGGGAGAAATTGG + Intergenic
971912267 4:32809832-32809854 CCACTCTAAATGGGAGAAATTGG + Intergenic
971939867 4:33200442-33200464 TCATTCTAAATGGGAAAAATAGG - Intergenic
971972303 4:33635571-33635593 CCATTCCAAATGGGAGAAATTGG - Intergenic
972002600 4:34058086-34058108 CCATTCCAAGTGGGAGAAATTGG + Intergenic
972014576 4:34226961-34226983 TCATTCTAAATGGGAGAAATTGG - Intergenic
972103045 4:35446191-35446213 CCACTCCAAATGGGAGAAAGTGG - Intergenic
972220537 4:36949743-36949765 CCATTCCAAATGGGAGAAATTGG + Intergenic
972301913 4:37792613-37792635 CCATTCCAAATGGGAAAAACTGG - Intergenic
972370464 4:38418950-38418972 CCATTCCAAATGGGAGAAATTGG + Intergenic
972485266 4:39534416-39534438 CCATTCCAAATGGGAGAAATTGG - Intergenic
972748942 4:41969422-41969444 CCATTCCAAATGGGAGAAATTGG - Intergenic
972832777 4:42833364-42833386 CCATTCCAAATGGGATAAATTGG - Intergenic
972839544 4:42914456-42914478 CCACTCCAAATGGGAGAAATTGG - Intronic
972857037 4:43119987-43120009 CCATTCCAAATGGGAGAAATTGG + Intergenic
972872208 4:43313601-43313623 CCATTCCAATTGGGAAAAATTGG - Intergenic
972890815 4:43554043-43554065 CCATTCCAAATGGGAGAAATTGG - Intergenic
972953916 4:44365834-44365856 CTTGTATAATTGGGAAAAATTGG + Intronic
973078527 4:45961578-45961600 CCATTCTAAATGGGGTAAATTGG + Intergenic
973094568 4:46180229-46180251 CCATTCCAAATGGGAGAAATTGG - Intergenic
973107849 4:46361921-46361943 CCATTCTAAATGGGAGAAATTGG - Intronic
973131455 4:46653542-46653564 CCATTCCAAATGGGAGAAATTGG + Intergenic
973213108 4:47638146-47638168 CCATTCCAAATGGGAGAAATTGG - Intronic
973552235 4:52047681-52047703 CCATTCCAAATGGGAGAAATTGG + Intergenic
973881666 4:55279013-55279035 CCATTCTAAAAGGGAGAAATAGG - Intergenic
974322583 4:60369917-60369939 CCATTCTAAATGTGAGAAATTGG - Intergenic
974469146 4:62296400-62296422 CCATTCCAAATGGGATAAATTGG + Intergenic
974569712 4:63628632-63628654 TCACTACAAATGGGAAAAATTGG - Intergenic
974606263 4:64156277-64156299 CCATTCAAAAAGGGAAAAATTGG + Intergenic
974725521 4:65794235-65794257 CCATTCCAAATGGGAGAAATTGG + Intergenic
974763471 4:66308549-66308571 CCATTCCAAATGGGAGAAATTGG - Intergenic
974832956 4:67211613-67211635 CTACTCCAAATGGGAAAAAATGG - Intergenic
974842211 4:67310984-67311006 CCATTCCAAATGGGAGAAATTGG - Intergenic
974845944 4:67351366-67351388 CTGTTCTAAATGGGAAAAATTGG + Intergenic
974867442 4:67597769-67597791 CCATTCAAAATGGGAGAAATTGG - Intronic
974872575 4:67661015-67661037 CCATTCCAAATGGGAGAAATTGG - Intronic
974923386 4:68269780-68269802 CCATTCCAAATGGGATAAATTGG + Intergenic
974925372 4:68291882-68291904 CCATTCTAAATGGCAAAAAATGG + Intergenic
974963270 4:68730281-68730303 CCATTCCAAATGGGAGAAATTGG + Intergenic
974973412 4:68859168-68859190 CCATTCCAAATGGGAGAAATTGG - Intergenic
975216578 4:71762307-71762329 CCATTAAAAATGGGAAAAATTGG - Intronic
975312103 4:72914105-72914127 CCATTCCAAATGGGAGAAATTGG - Intergenic
975629105 4:76381484-76381506 CTATTCCAAATGGGAAAAATAGG - Intronic
975632489 4:76417226-76417248 CCATTCTAAATAGGAGAAATTGG - Intronic
975804228 4:78096094-78096116 CCATTCCAAATGGGAGAAATTGG + Intronic
975918012 4:79347725-79347747 CCACTCCAAATGGGATAAATTGG - Intergenic
975942224 4:79660983-79661005 CCAATCCAAATGGGAGAAATTGG - Intergenic
975952225 4:79788118-79788140 CCATTCCAAATGGGAGAAATCGG + Intergenic
976003697 4:80402028-80402050 CCATTCCAAATGGGATAAATTGG - Intronic
976050822 4:81009727-81009749 CCATTCCAAATGGGAGAAATTGG - Intergenic
976051196 4:81012914-81012936 CCATTCCAAATGGGAGAAATTGG - Intergenic
976051492 4:81016115-81016137 CCATTCCAAATGGGAGAAATTGG + Intergenic
976461110 4:85314083-85314105 CCATTCCAAATGGGAGAAATTGG + Intergenic
976678205 4:87726144-87726166 CCATTCCAAATGGGAGAAATTGG - Intergenic
976680702 4:87753056-87753078 CCATTCCAAATGGGAGAAATTGG + Intergenic
976726816 4:88223046-88223068 CCATTCCAAATGGGACAAATTGG - Intronic
976853501 4:89576317-89576339 CCAATCCAAATGGGAGAAATTGG - Intergenic
976875526 4:89849863-89849885 CCATTCCAAATGGGACAAATTGG + Intergenic
977005976 4:91570004-91570026 CCATTCCAAATGGGAGAAATTGG + Intronic
977026004 4:91820505-91820527 CCATTCTAAATGGGAGAAATTGG + Intergenic
977097862 4:92769142-92769164 CCATTCCAAATGGGAGAAATTGG + Intronic
977189216 4:93978356-93978378 CCACTCCAAATGAGAGAAATTGG - Intergenic
977503866 4:97877970-97877992 CCATTCCAAATGGGAAAAATTGG + Intronic
977703986 4:100051597-100051619 CCATTCCAAATGGGAGAAATTGG + Intergenic
977973139 4:103233628-103233650 CTATTCCAAATGGGAAAAATTGG - Intergenic
977977822 4:103287251-103287273 CCATTCCAAATGGGAGAAATTGG - Intergenic
977988605 4:103415361-103415383 CCATTCTAAATGGGAGAAATTGG - Intergenic
977989121 4:103420117-103420139 CCATTCCAAATGGGAGAAATTGG + Intergenic
978044904 4:104114165-104114187 CCATTCCAAATGGGAGAAATTGG + Intergenic
978201672 4:106029471-106029493 CCATTCCAACTGGGAGAAATTGG - Intergenic
978213088 4:106162118-106162140 CCATTCCAATTGGGAGAAATTGG + Intronic
978226323 4:106339028-106339050 CCATTCCAAATGGGAGAAATTGG - Intronic
978252545 4:106650126-106650148 CCATTCCAAATGGGAGAAATTGG - Intergenic
978421446 4:108537656-108537678 CCAATCAAGTTGGGAAAATTGGG + Intergenic
978579456 4:110217813-110217835 CCATTCCAAATGGGAGAAATTGG + Intergenic
978682552 4:111399399-111399421 CATCTCTACTTGGGTAAAATCGG - Intergenic
978809838 4:112837779-112837801 CCATTCCAAATGGGATAAATTGG - Intronic
978920222 4:114174931-114174953 CCATTCCAAATGGGACAAATTGG + Intergenic
978921106 4:114183734-114183756 CCATTCCAAATGGGAGAAATTGG - Intergenic
978939166 4:114416020-114416042 CCATTCCAAATGGGAGAAATTGG - Intergenic
979027671 4:115597542-115597564 CCATTCCAAATGGGAGAAATTGG - Intergenic
979079079 4:116311752-116311774 CCATTCCAAATGGGAGAAATTGG + Intergenic
979177204 4:117679606-117679628 CCATTCCAAATGGGAAAAATTGG - Intergenic
979183486 4:117758451-117758473 CCATTCCAAATGGGAGAAATTGG - Intergenic
979411552 4:120385127-120385149 CCATTCCAAATGGGATAAATTGG - Intergenic
979414366 4:120417890-120417912 CCACTCCAAATGAGAGAAATTGG - Intergenic
979426328 4:120572089-120572111 CCATTCCAAATGGGAGAAATTGG + Intergenic
979464569 4:121021820-121021842 CCATTCCAAATGGGAGAAATTGG + Intergenic
979805053 4:124960894-124960916 CCATTCCAAATGGGAGAAATTGG + Intergenic
979839826 4:125423920-125423942 CCATTCCAAATGGGAGAAATTGG - Intronic
979867728 4:125776996-125777018 CCATTCCAAATGGGAGAAATTGG - Intergenic
979906474 4:126300137-126300159 CCATTCAAAATGGGAGAAATTGG + Intergenic
979948107 4:126859893-126859915 CCATTCCAAATGGGAGAAATTGG + Intergenic
979951253 4:126896831-126896853 CCATTCTAAATAGGAGAAATTGG + Intergenic
980084384 4:128376804-128376826 CCATTCCAAATGGGAGAAATTGG + Intergenic
980280006 4:130707020-130707042 CCATTCCAAATGGGAGAAATTGG + Intergenic
980335637 4:131469451-131469473 CCATTCCAAATGGGAGAAATTGG - Intergenic
980352348 4:131699192-131699214 CCATTCCAAATGGGAGAAATTGG + Intergenic
980425056 4:132617862-132617884 CCATTCCAAATGGGAGAAATTGG + Intergenic
980430093 4:132683473-132683495 CCATTCCAAATGGGAGAAATTGG + Intergenic
980523103 4:133957244-133957266 CCATTCCAAATGGGAGAAATGGG + Intergenic
980560084 4:134460858-134460880 CCATTCCAAATGGGAAAAATTGG - Intergenic
980579691 4:134733079-134733101 CCATTCCAAATGGGAGAAATTGG - Intergenic
980620958 4:135303134-135303156 CTACTCTAAATAGGAAACATTGG + Intergenic
980646191 4:135644707-135644729 CCACTCTACCTGGGAGAAATTGG - Intergenic
980757915 4:137190322-137190344 CCATTCCAAATAGGAAAAATTGG + Intergenic
980786791 4:137566345-137566367 CCACTCTACTTAGGAAATATGGG + Intergenic
980846668 4:138332907-138332929 CCATTCCAAATGGGAGAAATTGG + Intergenic
981061771 4:140432347-140432369 CCACTACAAATGGGAGAAATTGG - Intergenic
981184025 4:141780080-141780102 CCATTCCAAATGGGAGAAATTGG - Intergenic
981289842 4:143061737-143061759 CATTTATAATTGGGAAAAATTGG + Intergenic
981363112 4:143870511-143870533 CCATTCTAAATAGGATAAATTGG + Intergenic
981373841 4:143991306-143991328 CCACTCTAAATAGGAGCAATTGG + Intergenic
981382937 4:144094571-144094593 CCATTCTAAATAGGATAAATTGG + Intergenic
981393197 4:144216602-144216624 CCATTCCAAATGGGAGAAATTGG + Intergenic
981503022 4:145472958-145472980 CCATTCCAAATGGGAGAAATGGG + Intergenic
981516292 4:145613357-145613379 CCATTCCAAAAGGGAAAAATAGG - Intergenic
981795454 4:148590045-148590067 CCATTCCAAATGGGAGAAATTGG - Intergenic
981799269 4:148636982-148637004 CCATTCCAAATGGGAGAAATTGG + Intergenic
981915431 4:150027590-150027612 CCATTCCAAGTGGGAGAAATTGG - Intergenic
982019744 4:151191137-151191159 CCATTCCAAATGGGAGAAATTGG - Intronic
982193033 4:152877408-152877430 CCATTCCAAATGGGAGAAATTGG - Intronic
982279224 4:153666561-153666583 CCATTCCAAATGGGAGAAATTGG - Intergenic
982299966 4:153868247-153868269 CCATTCCAAATGGGAGAAATTGG - Intergenic
982301288 4:153881578-153881600 CCATTCCAAATGGGAGAAATTGG - Intergenic
982319644 4:154064737-154064759 CCATTCTAAAAGGGGAAAATTGG - Intergenic
982430408 4:155315721-155315743 CCATTCAAAATGGGAGAAATTGG - Intergenic
982483050 4:155934731-155934753 CCATTCCAAATGGGAGAAATTGG - Intronic
982524890 4:156466335-156466357 CCATTCCAAATGGGAGAAATTGG + Intergenic
982554351 4:156840911-156840933 CCATTCCAAATGGGAGAAATTGG - Intronic
982566800 4:156996483-156996505 TCATTCTAAGAGGGAAAAATTGG + Intergenic
982608289 4:157540590-157540612 CCATTCCAAATGGGAGAAATTGG - Intergenic
982829471 4:160042756-160042778 CCATTCCAAATGGGAGAAATTGG + Intergenic
982832864 4:160085923-160085945 CCATTCCAAATGGGAGAAATTGG + Intergenic
983006466 4:162490917-162490939 CCACTCCAAATGGGAGAAATTGG - Intergenic
983068047 4:163235264-163235286 CCATTCCAAATGGGAGAAATTGG + Intergenic
983083467 4:163415192-163415214 CCATTCCAAATGGGAGAAATTGG - Intergenic
983245541 4:165283416-165283438 CCATTCCAAATGGGAGAAATTGG + Intronic
983320717 4:166192324-166192346 CCATTCCAAATGGGAGAAATTGG - Intergenic
983337434 4:166415367-166415389 CCATTCCAAATGGGAGAAATTGG + Intergenic
983419551 4:167500328-167500350 CCATTCCAAATGGGAGAAATTGG + Intergenic
983431710 4:167659412-167659434 CCATTCCAAATGGGAAAAATTGG + Intergenic
983489267 4:168368870-168368892 CCATTCCAAATGGGAGAAATTGG - Intronic
983669159 4:170215747-170215769 CCATTCCAAATGGGAGAAATTGG - Intergenic
983718570 4:170816667-170816689 CCATTCCAAATGGGAGAAATTGG - Intergenic
983723760 4:170893067-170893089 CCATTCCAAATGGGAGAAATTGG + Intergenic
983825223 4:172250228-172250250 CCACTCCAAATGGGAGAAATTGG - Intronic
983847377 4:172536997-172537019 CCATTCCAAATGGGAGAAATTGG - Intronic
983855079 4:172633453-172633475 CCATTCCAAATGGGAGAAATTGG - Intronic
983874841 4:172863554-172863576 CCATTCCAAATGGGAGAAATTGG - Intronic
983952867 4:173662534-173662556 CCAATCCAAATGGGAGAAATTGG - Intergenic
984026406 4:174548105-174548127 CCATTCCAAATGGGAGAAATTGG - Intergenic
984056934 4:174941946-174941968 CCATTCCAAAAGGGAAAAATTGG + Intronic
984131186 4:175877954-175877976 TCACTCGAAATGGGAGAAATTGG + Intronic
984353143 4:178621591-178621613 CCATTCCAAATGGGATAAATTGG + Intergenic
985076865 4:186224577-186224599 CCATTCCAAATGGGAGAAATTGG - Intronic
985094930 4:186403805-186403827 CCATTCCAAATGGGAGAAATTGG + Intergenic
985155900 4:186987072-186987094 CCATTCCAAATGGGAAACATTGG + Intergenic
985160048 4:187034652-187034674 CCATTCCAAATGGGAGAAATTGG - Intergenic
985183917 4:187295968-187295990 CCATTCCAAATGGGAGAAATTGG + Intergenic
985220390 4:187697485-187697507 CCATTCCAAATGGGAGAAATTGG - Intergenic
985368519 4:189260296-189260318 CCATTCCAAATGGGAGAAATTGG + Intergenic
985853024 5:2402577-2402599 CCATTCCAAATGGGAGAAATTGG - Intergenic
986014754 5:3748103-3748125 CCATTCCAAATGGGAGAAATTGG - Intergenic
986113848 5:4750136-4750158 CCATTCCAAATGGGAGAAATTGG + Intergenic
986194708 5:5527323-5527345 CCATTCCAAATGGGAGAAATTGG - Intergenic
986246461 5:6011732-6011754 CCATTCCAAATGGGAGAAATTGG + Intergenic
986419857 5:7568917-7568939 CCAGTTTAATTGGAAAAGATGGG - Intronic
986455218 5:7911855-7911877 CCATTCCAAATGGGAGAAATTGG + Intergenic
986533465 5:8762309-8762331 CCATTCAAAATGGGAGAAATTGG - Intergenic
986563424 5:9086047-9086069 CCATTCCAAATGGGAGAAATTGG - Intronic
986640535 5:9867865-9867887 CCATGCTAAATGGGAGAAATTGG + Intergenic
986867562 5:12007875-12007897 CCATTCCAAATGGGAGAAATTGG + Intergenic
986869157 5:12027489-12027511 CCATTCCAAATGGGAGAAATTGG + Intergenic
986960255 5:13202463-13202485 CCATTCCAAATGGGAGAAATTGG + Intergenic
986983526 5:13475438-13475460 CCATTCCAAATGGGAGAAATTGG - Intergenic
987102488 5:14604665-14604687 CCATTCCAAATGGGAGAAATTGG + Intronic
987493711 5:18616064-18616086 CCATTCCAATTTGGAGAAATTGG + Intergenic
987562299 5:19540124-19540146 CCATTCCAAATGGGAAAAATTGG + Intronic
987655069 5:20796596-20796618 CCATTCCAAATGGGAGAAATTGG + Intergenic
987655543 5:20800862-20800884 CCATTCCAAGTGGGAGAAATTGG - Intergenic
987663665 5:20908140-20908162 CCATTCCAAATGGGAGAAATTGG - Intergenic
987680856 5:21134008-21134030 CCATTCCAAATGGGAGAAATTGG - Intergenic
987802937 5:22721403-22721425 CCATTCCAAATGGGAGAAATTGG - Intronic
987807002 5:22781990-22782012 CCATTCCAAATGGGAGAAATTGG - Intronic
987881244 5:23749207-23749229 CCATTCCAAGTGGGAGAAATTGG + Intergenic
987909328 5:24121889-24121911 CTATTCCAAATGGGAAAAATTGG + Intronic
987984977 5:25134531-25134553 CCATTCCAAGTGGGAGAAATTGG - Intergenic
988014174 5:25530998-25531020 CCATTCCAAATGGGAGAAATGGG - Intergenic
988038701 5:25860803-25860825 CCATTCCAAATGGGAGAAATTGG + Intergenic
988134948 5:27158551-27158573 CCATTCCAAATGGGAGAAATTGG - Intergenic
988147737 5:27331543-27331565 CCATTCTAAATGGGAGAAATTGG - Intergenic
988159579 5:27502551-27502573 CCATTCCAAATGGGAAAAATTGG + Intergenic
988204304 5:28114900-28114922 CCATTTCAAATGGGAAAAATTGG + Intergenic
988221163 5:28348743-28348765 CCATTCCAAATGGGAGAAATTGG + Intergenic
988335952 5:29909441-29909463 CCATTCCAAATGGGAGAAATTGG + Intergenic
988345811 5:30036202-30036224 CCATTCCAAATGGGAAATATTGG - Intergenic
988379340 5:30480600-30480622 CCATTCTAAATGGGAGAACTTGG + Intergenic
988724862 5:33916469-33916491 CCATTCCAAATGGGAGAAATTGG - Intergenic
988740035 5:34061075-34061097 CCATTCCAAATGGGAGAAATAGG + Intronic
988759020 5:34294049-34294071 CCATTCCAAATGGGAGAAATTGG + Intergenic
988768013 5:34403031-34403053 CCATTCCAAGTGGGAGAAATTGG + Intergenic
988768492 5:34407306-34407328 CCATTCCAAATGGGAGAAATTGG - Intergenic
988808999 5:34766520-34766542 CCATTCCAAATGGGAGAAATTGG - Intronic
988911130 5:35845263-35845285 CCATTCCAAATGGGAGAAATTGG + Intergenic
988976368 5:36520629-36520651 CCACTAAGAATGGGAAAAATTGG - Intergenic
989218228 5:38926944-38926966 CCATTCTAAATGGGAGAAATCGG + Intronic
989523577 5:42427789-42427811 CCATTCCAAATGGGAGAAATTGG + Intronic
989673336 5:43945914-43945936 CCATTCCAAATGGGAGAAATTGG + Intergenic
989689366 5:44121903-44121925 CTACTCTAATGTTGAAAAATAGG + Intergenic
989767534 5:45104418-45104440 CCATTCCAAATGGGAGAAATTGG - Intergenic
989786992 5:45344569-45344591 CTATTCTAAATGGGAGAAATTGG + Intronic
990083471 5:51945348-51945370 CCATTCCAAATGGGAGAAATTGG - Intergenic
990093326 5:52082744-52082766 CCATTCTAAATGGGAGAAATTGG + Intergenic
990136110 5:52645603-52645625 CCATTCCAAATGGGAGAAATTGG - Intergenic
990329674 5:54713360-54713382 CCATTCCAAATGGGATAAATTGG - Intergenic
990526837 5:56636497-56636519 CCACTGTCATTGGTAGAAATTGG + Intergenic
990747625 5:58976699-58976721 CCACTTTCATGGTGAAAAATGGG + Intronic
990758207 5:59099601-59099623 CCACACTCATGGGTAAAAATTGG + Intronic
990844491 5:60121946-60121968 CCATTCCAAATGGGAGAAATTGG + Intronic
991009881 5:61871691-61871713 CCATTCCAAATGGGAGAAATTGG + Intergenic
991186638 5:63816036-63816058 CCATTCTAAAAGGGAGAAATTGG - Intergenic
991206958 5:64060351-64060373 CCATTCCAAATGGGAGAAATTGG - Intergenic
991223008 5:64237382-64237404 CCATTCCAAATGGGAGAAATTGG - Intronic
991616114 5:68498515-68498537 CCATTCCAAATGGGAGAAATTGG - Intergenic
991700187 5:69309986-69310008 CCATTCCAAATGGGAGAAATTGG - Intronic
991940735 5:71849893-71849915 CCATTCCAAGTGGGAGAAATTGG + Intergenic
992138171 5:73768552-73768574 TCACTCCAAATGGGAAAAATTGG - Intronic
992215923 5:74524549-74524571 CCATTCCAAATGGGAGAAATTGG - Intergenic
992651463 5:78864784-78864806 CCATTCCAAATGGGAGAAATTGG + Intronic
992854780 5:80849038-80849060 CCATTCCAAATGGGAGAAATTGG + Intronic
992969538 5:82042664-82042686 CCATTCTAAATGGGAGACATTGG + Intronic
993024236 5:82627266-82627288 CCATTCCAAATGGGAGAAATTGG - Intergenic
993037053 5:82769798-82769820 CCATTCCAAATGGGAGAAATTGG - Intergenic
993146215 5:84096499-84096521 CCATTCCAAATGGGAGAAATCGG - Intronic
993531065 5:89026553-89026575 CCATTCCAAATGGGAGAAATTGG + Intergenic
993575231 5:89591652-89591674 CCATTCCAAATGGGAGAAATTGG - Intergenic
993590542 5:89790199-89790221 CCATTCCAAATGGGAGAAATTGG + Intergenic
993743236 5:91564878-91564900 CTATTCTAAATGGGAGAAATTGG + Intergenic
993792469 5:92224104-92224126 CCATTCCAAATGGGAGAAATTGG + Intergenic
993881782 5:93371328-93371350 TCAATTTAAATGGGAAAAATTGG - Intergenic
993890228 5:93463807-93463829 CCATTCCAAATGGGAGAAATTGG - Intergenic
993985487 5:94592287-94592309 CCATTCCAAATGGGAGAAATTGG + Intronic
994303748 5:98178264-98178286 CCATTCCAAATGGGAGAAATTGG + Intergenic
994440726 5:99800102-99800124 CCATTCCAAATGGGAGAAATTGG + Intergenic
994542727 5:101121072-101121094 CCATTCCAAATGGGAGAAATTGG + Intergenic
994576566 5:101586470-101586492 CCATTCCAAATGGGAGAAATTGG - Intergenic
994590680 5:101768534-101768556 CCATTCCAAATGGGAGAAATTGG + Intergenic
994655888 5:102592904-102592926 CCATTCTAAATGGGAGAAATTGG + Intergenic
994696155 5:103075203-103075225 CCTCTCCAAATGGGAGAAATTGG - Intergenic
994764620 5:103900617-103900639 CCATTCTAAATGGGAGAAACTGG - Intergenic
994828620 5:104747623-104747645 CCATTTTAAATGGGAGAAATTGG - Intergenic
994840985 5:104924429-104924451 CTATTCTAAAAGGGAAAAATTGG - Intergenic
994878209 5:105451729-105451751 CCATTCCAAATGGGAGAAATCGG - Intergenic
994920004 5:106031588-106031610 CCATTCCAAATGGAAAAAATTGG + Intergenic
995129370 5:108613332-108613354 CCATTCCAAATGGGAGAAATTGG - Intergenic
995277632 5:110294966-110294988 CCACTCCAAAAGGGAGAAATAGG - Intronic
995288271 5:110417321-110417343 CAACTCAAAGTGGGAAGAATGGG + Intronic
995370054 5:111408787-111408809 CCATTCCAAATGGGAGAAATTGG + Intronic
995608176 5:113880557-113880579 CCACTCCAAATAGGAGAAATTGG - Intergenic
995630448 5:114126865-114126887 CCATTCCAAATGGGAGAAATTGG + Intergenic
995690869 5:114824838-114824860 CCATTCCAAATGGGATAAATTGG + Intergenic
995698351 5:114905228-114905250 CCATTCCAAATGGGAGAAATTGG + Intergenic
995723757 5:115164923-115164945 CCATTCCAAATGGGAAAAATTGG + Intronic
995774542 5:115711474-115711496 CCATTCCAAATGGGAGAAATTGG + Intergenic
995839450 5:116429894-116429916 CCAGTTTAATTAGGTAAAATCGG - Intergenic
995860628 5:116636721-116636743 CCATTCCAAATGGGAGAAATTGG + Intergenic
995872447 5:116757043-116757065 CCATTCGAAATGGGAGAAATTGG - Intergenic
995988771 5:118210359-118210381 CCATTCCAAATGGGAGAAATTGG - Intergenic
996180041 5:120407631-120407653 CCATTCCAAATGGGAGAAATTGG - Intergenic
996196426 5:120612117-120612139 CCATTCTAAATGGGAGAGATTGG - Intronic
996222477 5:120950358-120950380 CCATTCCAAATGGGAAGAATTGG - Intergenic
996246501 5:121270975-121270997 CCATTCCAAATGGGAGAAATTGG + Intergenic
996670681 5:126113704-126113726 CCACTTCAAATGGGAGAAATTGG - Intergenic
996834665 5:127777346-127777368 CCATTCCAAATGGGAGAAATTGG - Intergenic
996839819 5:127836121-127836143 CCATTCCAAATGGGAGAAATTGG + Intergenic
996911467 5:128661152-128661174 CCATTCCAAATGGGATAAATTGG - Intronic
996967218 5:129320726-129320748 CCATTCCAAATGGGAGAAATTGG + Intergenic
997036761 5:130202372-130202394 CCATTCCAAATGGGATAAATGGG + Intergenic
997093050 5:130879041-130879063 CCATTCCAAATGGGAGAAATTGG - Intergenic
997108162 5:131045436-131045458 CCATTCCAAATGGGAGAAATTGG + Intergenic
997181343 5:131832219-131832241 CCATTCTAAATGGGAGAAATTGG + Intronic
997274536 5:132573764-132573786 CCATTCCAAATGGGAGAAATTGG + Intronic
997856932 5:137381053-137381075 CCATTCCAAATGGGAGAAATTGG + Intronic
997877637 5:137563659-137563681 CCACTGTTATTGGGAAAGGTGGG - Intronic
997932150 5:138081644-138081666 CCTCTCTGCTTGGGGAAAATAGG - Intergenic
998144751 5:139720820-139720842 CCATTCTAAATGGGAGAAATTGG - Intergenic
998758929 5:145410994-145411016 CCATTCCAAATGGGAGAAATTGG + Intergenic
999129574 5:149272306-149272328 CCACTCTAAAGGGGAAAACAAGG + Intronic
999473777 5:151879253-151879275 CCATTCTAAATGGGAGACATTGG - Intronic
999504333 5:152179662-152179684 CCATTCCAAGTGGGAAAAATTGG + Intergenic
1000030413 5:157396751-157396773 CCATTCCAAATGGGAGAAATTGG + Intronic
1000226623 5:159267351-159267373 CCATTCCAAATGGGAGAAATTGG - Intronic
1000574984 5:162966274-162966296 CCATTCCAAATGGCAAAAATTGG + Intergenic
1000612424 5:163388622-163388644 CCATTCCAAATGGGAGAAATTGG + Intergenic
1000648350 5:163785285-163785307 CCATTCCAAATGGGAGAAATTGG + Intergenic
1000659579 5:163920852-163920874 CCATTCCAAATGGGAGAAATTGG - Intergenic
1000751015 5:165097129-165097151 CCATTCCAAATGGGAGAAATTGG + Intergenic
1000808003 5:165821489-165821511 CCATTCTAATGGGTAAAAAGTGG + Intergenic
1001473308 5:172031383-172031405 CCATTCCAAATGGGAGAAATTGG + Intergenic
1001846638 5:174927935-174927957 CCATTATAATGGTGAAAAATTGG - Intergenic
1002869917 6:1157336-1157358 CCATTCCAAATGGGAGAAATTGG - Intergenic
1002958153 6:1888817-1888839 CCATTCTAAATGGGAGAAATTGG + Intronic
1003226817 6:4213705-4213727 CCATTCTAAATGGAAGAAATTGG + Intergenic
1003228031 6:4223918-4223940 TCATTCCAAATGGGAAAAATTGG - Intergenic
1003386765 6:5675010-5675032 CCATAGTAATTGGGAAATATTGG - Intronic
1003401673 6:5795888-5795910 CCATTCCAAATGGGAGAAATTGG + Intergenic
1003402160 6:5799618-5799640 CCACTCCAAAAGGGAGAAATAGG + Intergenic
1003767801 6:9260922-9260944 CCACTCCAAATGGGAGAAATTGG + Intergenic
1004430309 6:15536986-15537008 CCATTCCAAATGGGAGAAATTGG - Intronic
1004830752 6:19474840-19474862 CCACTCCAAATGGGAGAAATTGG + Intergenic
1005329179 6:24732323-24732345 CCATTCCAAATGGGAGAAATTGG - Intergenic
1005655186 6:27928648-27928670 CCATTCCAAATGGGAGAAATTGG + Intergenic
1005921806 6:30408093-30408115 CCATTCCAAATGGGAGAAATTGG - Intergenic
1006574329 6:35033172-35033194 TCAATCTAATTTGGAATAATAGG - Intronic
1006697237 6:35941245-35941267 CCATTCCAAATGGGAGAAATTGG - Intergenic
1007866108 6:44972238-44972260 CCATTCTAAATGGGAGAAATTGG + Intronic
1007889384 6:45272001-45272023 CCATTCCAAATGGGAGAAATTGG - Intronic
1007984757 6:46196915-46196937 CCATTCCAAATGGGATAAATAGG + Intergenic
1008260930 6:49366060-49366082 CCATTCTAAATGGGAGAAATGGG + Intergenic
1008283854 6:49626322-49626344 CCATTCCAAATGGGAGAAATTGG + Intronic
1008363678 6:50650620-50650642 CCATTCCAAATGGGACAAATTGG - Intergenic
1008498972 6:52161401-52161423 CCATCCCAAATGGGAAAAATTGG - Intergenic
1008756211 6:54797786-54797808 CCATTCCAAATGGGAGAAATTGG - Intergenic
1008820997 6:55630322-55630344 CCATTCTAAATGGGAGAAATAGG - Intergenic
1009344395 6:62595718-62595740 CCAATCCAAATGGGATAAATTGG - Intergenic
1009346178 6:62614816-62614838 CCATTCCAAATGGGAAAAATTGG - Intergenic
1009391234 6:63146247-63146269 CCATTCTAAATGGGAGAAACTGG - Intergenic
1009396699 6:63207334-63207356 CCATTCCAAATGGGAGAAATAGG - Intergenic
1009503230 6:64443258-64443280 CCATTCCAAATGGGAAAACTTGG - Intronic
1009550847 6:65089488-65089510 CCATTCCAAATGGGAGAAATTGG - Intronic
1009594558 6:65717399-65717421 CCATTCCAAATGGGAGAAATTGG - Intergenic
1009605018 6:65856883-65856905 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1009607715 6:65895842-65895864 CCATTCCAAATGGGATAAATTGG + Intergenic
1009816876 6:68748393-68748415 CCATTCCAAATGGGAGAAATTGG + Intronic
1009824402 6:68847135-68847157 CCATTCCAAATGGGAGAAATTGG - Intronic
1009945843 6:70341171-70341193 CCATTCCAAATGGGAGAAATTGG + Intergenic
1009967660 6:70594066-70594088 CCATTCCAAAAGGGAAAAATAGG - Intergenic
1010282680 6:74038982-74039004 CCATTCCAAATGGGAGAAATTGG - Intergenic
1010324013 6:74544425-74544447 CCATTCCAATTGGGATAAACTGG + Intergenic
1010467896 6:76190594-76190616 CCATTCCAAATGGGAGAAATTGG - Intergenic
1010514988 6:76761924-76761946 CCATTCCAAATGGGAGAAATTGG + Intergenic
1010531038 6:76967282-76967304 CCACTCCGAATGGGAGAAATTGG - Intergenic
1010549340 6:77201656-77201678 CCATTCCAAATGGGATAAATTGG - Intergenic
1010555647 6:77275526-77275548 CCATTCCAAATGGGAGAAATTGG - Intergenic
1010713961 6:79206996-79207018 CCATTCCAAATGGGAGAAATTGG - Intronic
1010879799 6:81153506-81153528 CCATTCCAAATGGGAGAAATTGG + Intergenic
1010884446 6:81218630-81218652 CCATTCTCAATGGGAGAAATTGG - Intergenic
1010900620 6:81423267-81423289 CCACTTCAAATGGGAGAAATTGG - Intergenic
1010920294 6:81672726-81672748 CCATTCCAAATGGGAGAAATTGG + Intronic
1011088761 6:83571538-83571560 CCATTCCAAATGGGAGAAATTGG - Intronic
1011122164 6:83965456-83965478 CCATTCCAAATGGGAGAAATTGG - Exonic
1011152446 6:84289583-84289605 CCATTCTAAATGGGAGAAATTGG + Intergenic
1011169385 6:84489170-84489192 CCATTCCAAATGGGAGAAATTGG + Intergenic
1011263981 6:85496828-85496850 CCATTCCAAATGGGAGAAATTGG + Intergenic
1011348941 6:86401502-86401524 CCATTCCAAATGGGAGAAATTGG + Intergenic
1011378566 6:86718419-86718441 CCATTCCAAATGGGAGAAATTGG + Intergenic
1011439078 6:87368860-87368882 CCATTCCAAATGGGAGAAATTGG + Intronic
1011461875 6:87613662-87613684 CCATTCCAAATGGGAGAAATTGG + Intronic
1011792794 6:90916099-90916121 CCATTCCAAATGGGATAAATTGG - Intergenic
1011876708 6:91971297-91971319 CCATTCCAAATGGGAGAAATTGG + Intergenic
1011916479 6:92512088-92512110 CCACTCCAAATGGAAGAAATTGG - Intergenic
1011948230 6:92934124-92934146 CCAATCCAAATGGGAGAAATTGG + Intergenic
1012045077 6:94263433-94263455 CCATTCCAAATGGGAGAAATTGG + Intergenic
1012074731 6:94669768-94669790 CCATTCCAAATGGGAGAAATTGG - Intergenic
1012141568 6:95632142-95632164 CCATTCCAAATGGGAGAAATTGG - Intergenic
1012161243 6:95888283-95888305 CCATTCCAAATGGGAGAAATTGG + Intergenic
1012194102 6:96317745-96317767 CCATTCCAAATGGGATAAATTGG + Intergenic
1012213680 6:96556487-96556509 CCATTCCAAATGGGAGAAATTGG + Intergenic
1012224225 6:96686474-96686496 CCATTCCAAATGGGACAAATTGG - Intergenic
1012240013 6:96860686-96860708 CCATTCCAAATGGGACAAATTGG - Intergenic
1012380537 6:98615183-98615205 CCATTCCAAATGGGAGAAATTGG + Intergenic
1012619763 6:101328465-101328487 CCACTATAGTTTGGAAAAATAGG + Intergenic
1012723940 6:102784277-102784299 CCATTCCAAATGGGAGAAATTGG - Intergenic
1012756730 6:103240928-103240950 CAATTCCAAATGGGAAAAATTGG - Intergenic
1012762387 6:103318299-103318321 CCATTCCAAATGGGAGAAATTGG - Intergenic
1012771066 6:103436156-103436178 CCATTCCAAATGGGAGAAATTGG + Intergenic
1012780008 6:103546300-103546322 CCATTCCAAATGGGAGAAATCGG + Intergenic
1012826281 6:104151152-104151174 CCATTCCAAATGGGAGAAATTGG + Intergenic
1012881711 6:104798902-104798924 ACAATTTAATTGGAAAAAATTGG - Intronic
1012994996 6:105964172-105964194 GCACTGTAATTGTGAACAATAGG - Intergenic
1013077106 6:106781229-106781251 CCATTCCAAATGGGAGAAATTGG - Intergenic
1013091200 6:106902227-106902249 CCATTTTAAAAGGGAAAAATTGG - Intergenic
1013436070 6:110108866-110108888 CCTATCTGATTGGGAAAATTAGG - Intronic
1013558680 6:111283189-111283211 CCATTCCAATTGGGAGAAATTGG + Intergenic
1013829465 6:114255148-114255170 CCATTTTAAATGGGAGAAATTGG + Intronic
1013884397 6:114945271-114945293 CCATTCCAAATGGGATAAATTGG + Intergenic
1013935452 6:115587916-115587938 CCATTCCAAATGGGAGAAATTGG - Intergenic
1013947308 6:115736475-115736497 CCATTCCAAATGGGAGAAATGGG - Intergenic
1014068056 6:117150246-117150268 CCATTCCAAATGGGAGAAATTGG + Intergenic
1014116139 6:117670474-117670496 CCATTCCAAATGGGAGAAATTGG - Intergenic
1014133694 6:117863957-117863979 CCATTCCAATTGGGAGAAATTGG + Intergenic
1014143531 6:117971147-117971169 CCATTCCAAGTGGGAGAAATTGG + Intronic
1014247398 6:119082533-119082555 CCATTCCAACTGGGAGAAATTGG + Intronic
1014342521 6:120227805-120227827 CCATTCTAAATGGGAGAAATTGG + Intergenic
1014482368 6:121954364-121954386 CCATTCCAAATGGGAAAAATTGG + Intergenic
1014649420 6:124017575-124017597 CCATTCCAAATGGGAGAAATTGG + Intronic
1014857261 6:126417226-126417248 CCATTCCAAATGGGAGAAATTGG - Intergenic
1014863156 6:126496150-126496172 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1014875668 6:126655576-126655598 CCATTCCAAATGGGAGAAATGGG - Intergenic
1014883873 6:126756275-126756297 CCATTTCAATTGGGATAAATTGG + Intergenic
1014951287 6:127558732-127558754 CCTCTCCAAATGGGAGAAATTGG - Intronic
1015130558 6:129803926-129803948 CCATTCCAAATGGGAGAAATTGG - Intergenic
1015667797 6:135650947-135650969 CCATTCCAAATGGGAGAAATGGG - Intergenic
1015713039 6:136162766-136162788 CCATTCCAAATGGGAGAAATTGG + Intronic
1015815752 6:137209117-137209139 CCATTCCAAATGGGAGAAATTGG - Intronic
1016020826 6:139235084-139235106 CTATTCCAAATGGGAAAAATTGG - Intergenic
1016202486 6:141429823-141429845 CCATTCCAAATGGGAGAAATTGG + Intergenic
1016230704 6:141800701-141800723 CCATTCTAAATTGGAAAAATTGG - Intergenic
1016243009 6:141953612-141953634 CCATTCTAAATGGGAGAAATTGG - Intergenic
1016264244 6:142213170-142213192 CCATTCTTAATGGGAGAAATTGG + Intronic
1016437038 6:144047999-144048021 CCATTCCAAATGGGAGAAATTGG + Intronic
1016504899 6:144768020-144768042 CCACTCTAATGAGGACAAATGGG + Intronic
1016649517 6:146448034-146448056 CCATTCCAAATGGGAGAAATTGG + Intergenic
1016649522 6:146448070-146448092 CCATTCCAAATGGGAGAAATTGG + Intergenic
1016721634 6:147304858-147304880 CCATTCCAAATGGGAGAAATTGG - Intronic
1016785980 6:148011172-148011194 CCATTCCAAATGGGAGAAATTGG - Intergenic
1017338886 6:153296745-153296767 CAGCTTTATTTGGGAAAAATAGG - Intergenic
1017525304 6:155237143-155237165 CCATTCCAAATGGGAGAAATTGG + Intronic
1017580536 6:155859781-155859803 CCATTCCAAATGGGAAAAAATGG - Intergenic
1017640751 6:156491285-156491307 CCATTCTAGATAGGAAAAATTGG - Intergenic
1017654349 6:156613511-156613533 CCATTCCAACTGGGAGAAATTGG + Intergenic
1018041088 6:159922649-159922671 CCATTCCAAATGGGAGAAATTGG - Intergenic
1018093646 6:160366320-160366342 CCATTCCAAATGGGAAAAATTGG + Intronic
1018407776 6:163505621-163505643 CCATTCCAAATGGGAGAAATTGG - Intronic
1018416308 6:163605129-163605151 CCATTCCAAATGGGAGAAATTGG - Intergenic
1018482503 6:164205910-164205932 CCACTCCAAATGGGAGAAATTGG - Intergenic
1018516028 6:164581105-164581127 CCATTCTAAATAGGAGAAATTGG + Intergenic
1018527547 6:164729404-164729426 CCATTCCAAATGGGAGAAATTGG - Intergenic
1018534588 6:164806939-164806961 CCATTTCAATTGAGAAAAATTGG + Intergenic
1018573818 6:165237174-165237196 CCATTCCAAATGGGAGAAATTGG - Intergenic
1020456079 7:8374762-8374784 CCATTCCAAATGGGAGAAATTGG - Intergenic
1020579109 7:9971814-9971836 CCATTTCAAATGGGAAAAATTGG - Intergenic
1020581856 7:10012256-10012278 CCATTCTAAATGGGAGAAATTGG - Intergenic
1020608170 7:10363218-10363240 CCTCTTTAAATGGGAGAAATTGG - Intergenic
1020869384 7:13608149-13608171 CCATTCTAAATGGGAGAAATTGG - Intergenic
1021134511 7:16948976-16948998 CCATTCCAAATGGGAGAAATTGG - Intergenic
1021401020 7:20209504-20209526 CCATTCCAAATGGGAGAAATTGG - Intronic
1021425083 7:20490646-20490668 CCATTCCAAAAGGGAAAAATTGG - Intergenic
1022595898 7:31713217-31713239 CCATTCCAAATGGGAGAAATTGG + Intergenic
1023060564 7:36322180-36322202 CCATTCCAAATGGGAGAAATTGG - Intergenic
1023188441 7:37554735-37554757 CCATTCCAAATGGGAGAAATTGG + Intergenic
1023216153 7:37865270-37865292 CCATTCCAAGTGGGAGAAATTGG + Intronic
1023386287 7:39661485-39661507 CCATTCCAAATGGGAGAAATTGG + Intronic
1023650440 7:42363914-42363936 CCATTCCAAATGGGAGAAATTGG + Intergenic
1023804154 7:43859440-43859462 CCATTCCAAATGGGAGAAATTGG - Intergenic
1024021351 7:45373707-45373729 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1024406505 7:48988071-48988093 CCATTCCAAATGGGAGAAATTGG - Intergenic
1024438492 7:49387754-49387776 CCATTCCAAATGGAAAAAATTGG + Intergenic
1024721110 7:52138581-52138603 CCATTCCAAATGGGAGAAATTGG + Intergenic
1024771764 7:52731741-52731763 CCATTCCAAATGGGAGAAATTGG - Intergenic
1024912238 7:54458664-54458686 CCACTCTAAATGGGAGAAATTGG - Intergenic
1025632334 7:63286371-63286393 CCACTACAAATGGGAGAAATTGG + Intergenic
1025650229 7:63459861-63459883 CCACTACAAATGGGAGAAATTGG - Intergenic
1025725318 7:64052904-64052926 CCACTTCAAATGGGAGAAATTGG - Intronic
1025861888 7:65338085-65338107 CCATTCCAAATGGGAGAAATTGG - Intergenic
1026278756 7:68903240-68903262 CCATTCCAAATGGGAGAAATTGG - Intergenic
1027300318 7:76827458-76827480 CCATTCCAATAGGGAGAAATTGG + Intergenic
1027458683 7:78424794-78424816 CCATTCCAAATGGGAGAAATTGG - Intronic
1027549627 7:79574517-79574539 CCATTCCAAATGGGAGAAATTGG - Intergenic
1027556559 7:79670850-79670872 CCATTCCAAATGGGATAAATTGG - Intergenic
1027560150 7:79719182-79719204 CCATTCCAAATGGGAGAAATTGG + Intergenic
1027605277 7:80292202-80292224 CCATTCCAAATGGGAGAAATTGG + Intergenic
1027993476 7:85394797-85394819 CCATTCTAAATGGGATAAATTGG + Intergenic
1028045142 7:86108247-86108269 CCATTCCAAATGGGAGAAATTGG - Intergenic
1028249609 7:88525809-88525831 CCATTCCAAATGGGAGAAATTGG + Intergenic
1028253188 7:88559443-88559465 CCATTCCAAATGGGAAAACTTGG - Intergenic
1028314568 7:89384179-89384201 CCATTCCAAGTGGGAGAAATTGG - Intergenic
1028359927 7:89955557-89955579 CCATTCCAAATGGGAGAAATTGG + Intergenic
1028438181 7:90829455-90829477 CCATTCTAACAGGGAGAAATTGG + Intronic
1028455356 7:91032417-91032439 CCAACCTTATTTGGAAAAATGGG + Intronic
1028493743 7:91441675-91441697 CCATTCCAAATGGGAGAAATTGG - Intergenic
1028957842 7:96713640-96713662 TCATTCTAAATGGGAGAAATTGG - Intergenic
1030144600 7:106340811-106340833 CCATTCCAAATGGGAGAAATTGG + Intergenic
1030452480 7:109730650-109730672 CCAATCCAACTGGGAGAAATTGG + Intergenic
1030459131 7:109808567-109808589 CCATTCCAAATGGGAGAAATTGG - Intergenic
1030606298 7:111642381-111642403 CCTCTCTAATAGTGATAAATTGG + Intergenic
1030722304 7:112884484-112884506 CCATTCCAAATGGGAGAAATTGG + Intronic
1030786683 7:113671404-113671426 CCATTCCAAATGGGAGAAATTGG - Intergenic
1030850978 7:114486694-114486716 CCATTCCAAATGGGAGAAATTGG + Intronic
1030868830 7:114731981-114732003 CCATTCCAAATGGGAGAAATTGG - Intergenic
1030915257 7:115304353-115304375 CCATTCTAGATGGGAGAAATTGG - Intergenic
1030970133 7:116045996-116046018 CCATTCCAAATGGGAGAAATTGG - Intronic
1030975636 7:116119164-116119186 CTTCTCTATTTGGTAAAAATGGG - Intronic
1030986116 7:116244359-116244381 CCATTCCAAATGGGAGAAATTGG + Intronic
1031238752 7:119211400-119211422 CCATTCCAAATGGGAGAAATTGG - Intergenic
1031429593 7:121650904-121650926 CCTTTCTAAATGGGAGAAATTGG - Intergenic
1031519346 7:122744353-122744375 CCACTCTTATTGGGATTTATTGG + Intronic
1031645660 7:124222083-124222105 CCATTCCAAATGGGAGAAATTGG - Intergenic
1031652141 7:124303952-124303974 CCATTCCAAATGGGAGAAATTGG - Intergenic
1031668986 7:124519513-124519535 CCATTCTAAATGGGAGAAATTGG - Intergenic
1031702528 7:124943269-124943291 CCATTCCAAATGGGAAAAATTGG - Intergenic
1031703881 7:124958790-124958812 CCATTCCAAATGGGAGAAATTGG - Intergenic
1031768180 7:125807392-125807414 CCACAGGAACTGGGAAAAATAGG + Intergenic
1031783381 7:125998040-125998062 CCATTCCAAATGGGAGAAATTGG - Intergenic
1031914041 7:127545840-127545862 CCATTCTAAGTGGGAGAAATTGG + Intergenic
1032318355 7:130861674-130861696 CCATTCCAATTGGGAGAAATTGG - Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1032996568 7:137453390-137453412 CATCTCTAATTAGGTAAAATAGG + Intronic
1033054300 7:138035369-138035391 CCATTCCAAATGGGAGAAATTGG + Intronic
1033225074 7:139554812-139554834 CCATTCAAAATGGGAGAAATTGG - Intergenic
1033518050 7:142129197-142129219 CCATTCCAAATGGGAGAAATTGG - Intronic
1033580216 7:142726224-142726246 CCATTCCAAATGGGAGAAATTGG + Intergenic
1033602189 7:142896465-142896487 ACTCTCTAGGTGGGAAAAATAGG - Intergenic
1033716863 7:144011176-144011198 CCATTCCCAATGGGAAAAATTGG - Intergenic
1033721297 7:144061809-144061831 CCATTCCAAATGGGAGAAATTGG - Intergenic
1033759909 7:144427077-144427099 CCATTCCAAATGGGAGAAATTGG + Intergenic
1033988367 7:147253961-147253983 CCACAGTAAGTGCGAAAAATGGG + Intronic
1034040665 7:147873871-147873893 CCATTCCAAATGGGAGAAATTGG + Intronic
1034510618 7:151531789-151531811 CCATTCCAAATGGGAGAAATTGG + Intergenic
1034573187 7:151973552-151973574 CCATTCCAAATGGGAGAAATTGG - Intronic
1035149824 7:156860726-156860748 CCATTCTAAATGGGAGAAACTGG + Intronic
1035452035 7:158983516-158983538 CCATTCCAAATGGGAGAAATTGG + Intergenic
1035864600 8:3069114-3069136 CCATTCCAATAGGGAGAAATTGG + Intronic
1036457622 8:8923834-8923856 CCAATCCAAATGGGAGAAATTGG + Intergenic
1036981563 8:13474798-13474820 CCATTCCAAATGGGAGAAATTGG - Intronic
1037206087 8:16321340-16321362 CCATTCTAAATGGGAGAAATTGG - Intronic
1038110982 8:24496712-24496734 CCATTCCAAATGGGAGAAATTGG - Intronic
1038219600 8:25594765-25594787 CCACACTAAATGGGCAAGATGGG + Intergenic
1039202156 8:35107403-35107425 CCACTTAAAGTGGGAAAAAATGG - Intergenic
1039497606 8:37992776-37992798 CCATTCCAAATGGGAGAAATTGG + Intergenic
1039511504 8:38095689-38095711 CCATTCCAAATGGGAGAAATTGG - Intergenic
1039642665 8:39241044-39241066 CCATTCCAAATGGGAGAAATTGG + Intronic
1039652221 8:39354037-39354059 CCATTCCAAATGGGAGAAATTGG - Intergenic
1039657192 8:39422990-39423012 CCATTCCAAATGGGAGAAATTGG + Intergenic
1039666951 8:39544043-39544065 CCATTCCAAATGGGAGAAATTGG + Intergenic
1040094981 8:43434271-43434293 CCATTCCAAATGGGAGAAATTGG - Intergenic
1040721378 8:50328978-50329000 CCATTCCAAATGGGAGAAATTGG + Intronic
1040835888 8:51731241-51731263 CCATTCCAAATGGGAGAAATTGG + Intronic
1040922074 8:52632232-52632254 TCACTTTGCTTGGGAAAAATAGG - Intronic
1041075067 8:54161641-54161663 CCATTCCAAATGGGAGAAATGGG - Intergenic
1041430754 8:57778247-57778269 CCATTCCAAATGGGAGAAATTGG - Intergenic
1041438080 8:57863656-57863678 CCATTCCAAATGGGAGAAATTGG - Intergenic
1041780959 8:61578121-61578143 CCATTCAAAATGGGAGAAATTGG + Intronic
1041823829 8:62068822-62068844 CCATTCCAAATGGGAGAAATTGG - Intergenic
1041849939 8:62379180-62379202 CCACTACAAGTGGGAGAAATTGG - Intronic
1041919422 8:63166060-63166082 CCATTCCAAATGGGAGAAATTGG - Intergenic
1041925739 8:63234358-63234380 CCATTCCAAATGGGAGAAATTGG + Intergenic
1041953964 8:63536932-63536954 CCACTCCAAATGGGAGAAATTGG + Intergenic
1041955384 8:63553627-63553649 CCATTCCAAATGGGAAAAATTGG + Intergenic
1041965206 8:63667964-63667986 CCATTCCAAATGGGAGAAATGGG - Intergenic
1042161925 8:65905238-65905260 CCATTCCAAATGGGAGAAATTGG - Intergenic
1042169848 8:65980661-65980683 CCATTCCAAGTGGGAGAAATTGG - Intergenic
1042407461 8:68422338-68422360 CCATTCCAAATGGGAGAAATTGG + Intronic
1042467677 8:69146727-69146749 CCACTTTAATTGGGAACACATGG - Intergenic
1042635337 8:70867915-70867937 TCATTCCAAATGGGAAAAATTGG + Intergenic
1042682792 8:71405071-71405093 CTACTCTTATTTGTAAAAATTGG - Intronic
1042728266 8:71902649-71902671 CCATTCCAAATGGGAGAAATTGG + Intronic
1042923222 8:73940443-73940465 CCATTCCAAATGGGAGAAATTGG - Intronic
1043289758 8:78582716-78582738 GCACTCAAATTGGAATAAATGGG + Intronic
1043297384 8:78682879-78682901 CCATTCTAAATTGGAGAAATGGG + Intronic
1043426191 8:80150721-80150743 CCATTCCAAATGGGAGAAATTGG - Intronic
1043644423 8:82499277-82499299 CCACTCAAAATGGGAGAAATTGG - Intergenic
1043694835 8:83205052-83205074 CCATTCCAAATGGGAGAAATTGG - Intergenic
1043834626 8:85032766-85032788 CCATTCCAAATGGGAGAAATTGG + Intergenic
1044010183 8:86984716-86984738 CCATTCCAAATGGGAGAAATTGG - Intronic
1044052029 8:87516736-87516758 CCTCTCTAAAAGTGAAAAATTGG - Intronic
1044087119 8:87955357-87955379 CCATTCCAAATGGGAAAAATTGG + Intergenic
1044125219 8:88451712-88451734 CCATTCCAAATGGGAGAAATTGG + Intergenic
1044129128 8:88498430-88498452 CCATTCTTATTTGTAAAAATAGG + Intergenic
1044220353 8:89662961-89662983 CCATTCCAAATGGGAGAAATTGG + Intergenic
1044234034 8:89809571-89809593 CCATTCCAAATGGGAGAAATTGG - Intergenic
1044304012 8:90617075-90617097 CCATTCCAAATGGGAGAAATTGG - Intergenic
1045139910 8:99268588-99268610 CCATTCCAAATGGGAGAAATTGG - Intronic
1045207502 8:100057179-100057201 CCACTCTAATTGGGAAAAATTGG - Intronic
1045258141 8:100546934-100546956 CCATTCCAAATGGGAGAAATTGG - Intronic
1045422085 8:102026390-102026412 CCATTCCAAATGGGAGAAATTGG + Intronic
1045675953 8:104608083-104608105 CCATTCCAAATGGGAGAAATTGG - Intronic
1045894820 8:107202387-107202409 CCATTCCAAATGGGAGAAATTGG + Intergenic
1045931594 8:107633406-107633428 CCATTCCAAATGGGAGAAATTGG - Intergenic
1046170450 8:110498397-110498419 CCATTCCAAATGGGATAAATTGG - Intergenic
1046184969 8:110701114-110701136 ATAGTCTAATTGAGAAAAATGGG - Intergenic
1046235968 8:111424322-111424344 CCATTCTAAGTGGGAGAAACTGG - Intergenic
1046305367 8:112358200-112358222 CCATTCAAAATGGGAGAAATTGG - Intronic
1046600764 8:116314849-116314871 CCATTCCAAATGGGATAAATTGG + Intergenic
1046607696 8:116389350-116389372 CCATTCCAAATGGGAGAAATTGG - Intergenic
1046618027 8:116499159-116499181 CCATTCCAAATGGGAGAAATTGG + Intergenic
1046689509 8:117267210-117267232 CCACTCCAATTGGGAGGAATTGG + Intergenic
1046703151 8:117423595-117423617 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1046814849 8:118572204-118572226 CCATTCCAAATGGGAGAAATTGG - Intronic
1046839595 8:118841886-118841908 CCATTCTAAATGGGAGAAATTGG - Intergenic
1046917479 8:119692587-119692609 CCATTCTAAATGGGATAAATTGG - Intergenic
1047195006 8:122713142-122713164 CCATTCCAAATGGGAGAAATTGG - Intergenic
1047565666 8:126040994-126041016 CCATTCCAAATGGGAGAAATTGG - Intergenic
1047586984 8:126283360-126283382 CCATTCCAAATGGGAGAAATTGG - Intergenic
1047628142 8:126677737-126677759 CCATTCCAAATGGGAGAAATTGG - Intergenic
1047865945 8:129024268-129024290 CCATTCCAAATGGGAGAAATTGG - Intergenic
1047870024 8:129072012-129072034 CCATTTCAAATGGGAAAAATTGG - Intergenic
1047881008 8:129193336-129193358 CTACTCTCTTTGGGAACAATGGG - Intergenic
1047906307 8:129476715-129476737 CTATTTTAATTAGGAAAAATAGG - Intergenic
1047917970 8:129603388-129603410 CCATTCTAAATGGGAGAAATTGG + Intergenic
1047924581 8:129670100-129670122 CCATTCCAAATGGGAGAAATGGG - Intergenic
1047941368 8:129830353-129830375 CCATTCCAAATGGGAGAAATTGG + Intergenic
1048107423 8:131427116-131427138 CCATTCCAAATGGGAGAAATTGG + Intergenic
1048116785 8:131532372-131532394 CCATTCTAAAAGGGAGAAATCGG - Intergenic
1048404663 8:134107360-134107382 CCATTCCAAATGGGAGAAATTGG - Intergenic
1048416717 8:134235083-134235105 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1048419417 8:134262136-134262158 CCATTCCAAGTGGGAGAAATTGG - Intergenic
1048519201 8:135138317-135138339 CCACTCCAAAAGGGAGAAATCGG + Intergenic
1048669156 8:136696556-136696578 CCATTCCAAATGGGAGAAATTGG - Intergenic
1048700084 8:137078541-137078563 CCATTCTAAATGGGAGAAATTGG - Intergenic
1048726083 8:137386943-137386965 CCACTCCAAAAGGGAGAAATTGG + Intergenic
1048745953 8:137615350-137615372 CCATTCCAAATGGGAGAAATTGG + Intergenic
1048772692 8:137912511-137912533 CTATTCCAAATGGGAAAAATTGG + Intergenic
1048781593 8:138007696-138007718 CCATTCCAAATGGGAGAAATTGG - Intergenic
1048782553 8:138017712-138017734 CCATTCCAAATGGGAGAAATTGG - Intergenic
1048839436 8:138551924-138551946 CCATTCCAACTGGGAGAAATTGG - Intergenic
1048892632 8:138961438-138961460 CCATTCCAAAGGGGAAAAATGGG - Intergenic
1049076389 8:140399586-140399608 CCATTCCAAATGGGAGAAATTGG - Intronic
1050122267 9:2319763-2319785 CCAATCAAATTGGGCTAAATTGG - Intergenic
1050274708 9:3984474-3984496 CCATTCCAAATGGGAGAAATTGG - Intronic
1050905184 9:10994358-10994380 CCATTCCAAATGGGAGAAATTGG - Intergenic
1050945478 9:11511443-11511465 CCATTCAAAATGGGAGAAATTGG - Intergenic
1051015929 9:12475447-12475469 CCATTCCAAATGGGAGAAATTGG - Intergenic
1051128789 9:13835700-13835722 CCATTCCAAATGGGACAAATTGG - Intergenic
1051303402 9:15679075-15679097 CCTCTCTGATTTGGAATAATTGG + Intronic
1051382338 9:16471210-16471232 CCATTCCAAATGGGAGAAATTGG - Intronic
1051450599 9:17193420-17193442 CCATTCCAAATGGGAGAAATTGG + Intronic
1051573244 9:18583861-18583883 CCATTCCAAATGGGAGAAATTGG - Intronic
1051619594 9:19037108-19037130 CCATTCCAAATGGGAGAAATTGG - Intronic
1051743807 9:20276271-20276293 CCATTCCAAATGGGAGAAATTGG + Intergenic
1051946311 9:22573480-22573502 CCATTCCAAATGGGAGAAATTGG - Intergenic
1052006913 9:23360310-23360332 CCACTCCAAATGGGAGAAATTGG + Intergenic
1052071044 9:24081552-24081574 CCATTCCAAATGGGAGAAATTGG - Intergenic
1052080892 9:24203934-24203956 CCATTCCAAATGGGAGAAATTGG - Intergenic
1052108666 9:24551333-24551355 CATCTCTAAATGGGTAAAATAGG - Intergenic
1052173746 9:25432349-25432371 CCATTCCAAGTGGGAAAAATTGG + Intergenic
1052210105 9:25893723-25893745 CCATTCCAAATGGGAGAAATTGG + Intergenic
1052220561 9:26017154-26017176 CCATTCTAAATGGGAGAAATTGG + Intergenic
1052414148 9:28156747-28156769 CCATTCTAAATGGGAGAAATTGG + Intronic
1052701420 9:31941915-31941937 CCATTCGAAATAGGAAAAATTGG - Intergenic
1052705329 9:31988129-31988151 CCACTCCAAATGGGAAAAACTGG + Intergenic
1052846326 9:33339755-33339777 CCATTCCAAATGGGAGAAATTGG + Intronic
1053246110 9:36535922-36535944 CCATTCCAAATGGGAGAAATTGG - Intergenic
1053371422 9:37564697-37564719 CCACTCCAAATGGGAGAGATTGG - Intronic
1053384082 9:37673211-37673233 CCATTCCAAATGGGAGAAATTGG + Intronic
1053572035 9:39319319-39319341 CCATTCCAAATGGGAGAAATTGG - Intergenic
1053780364 9:41600522-41600544 CCATTCCAAATGGGAGAAATTGG - Intergenic
1053882569 9:42611025-42611047 CCATTCCAAATGGGAGAAATTGG + Intergenic
1053890100 9:42683277-42683299 CCATTCCAAATGGGAGAAATTGG - Intergenic
1054093590 9:60878030-60878052 CCATTCCAAATGGGAGAAATTGG - Intergenic
1054115073 9:61153950-61153972 CCATTCCAAATGGGAGAAATTGG - Intergenic
1054125110 9:61299692-61299714 CCATTCCAAATGGGAGAAATTGG + Intergenic
1054168306 9:61810679-61810701 CCATTCCAAATGGGAGAAATTGG - Intergenic
1054221596 9:62418493-62418515 CCATTCCAAATGGGAGAAATTGG + Intergenic
1054229118 9:62490680-62490702 CCATTCCAAATGGGAGAAATTGG - Intergenic
1054592683 9:67028584-67028606 CCATTCCAAATGGGAGAAATTGG + Intergenic
1054669223 9:67770139-67770161 CCATTCCAAATGGGAGAAATTGG + Intergenic
1055142068 9:72887245-72887267 CCATTCCAAATGGGAGAAATTGG - Intergenic
1055170818 9:73255524-73255546 CCATTCCAAATGGGAGAAATTGG - Intergenic
1055364060 9:75525316-75525338 CCATTCCAAATGGGAGAAATTGG - Intergenic
1055595522 9:77861570-77861592 CCATTCCAAATGGGAGAAATTGG + Intronic
1055698728 9:78917756-78917778 CCACTCCAAATTGGAGAAATTGG - Intergenic
1055713253 9:79088554-79088576 CCATTCCAAATGGGAGAAATTGG + Intergenic
1055800660 9:80032427-80032449 CCATTCTAAAAGGGAGAAATTGG + Intergenic
1055858740 9:80723691-80723713 CCATTCCAAATGGGAAAAAATGG + Intergenic
1055886022 9:81063812-81063834 CCATTCCAAATGGGAGAAATTGG - Intergenic
1056012544 9:82346879-82346901 CCATTCCAAATGAGAAAAATTGG - Intergenic
1056434889 9:86566221-86566243 CCACTCCAAATGGGATAAATTGG + Intergenic
1056595237 9:88002470-88002492 CCATTCCAAATGGGAGAAATTGG - Intergenic
1057316380 9:93971527-93971549 CCATTCCAAATGGGAAAAATTGG + Intergenic
1057732577 9:97622820-97622842 CCATTCCAAATGGGAGAAATTGG - Intronic
1058082148 9:100711987-100712009 CCATTCCAAATGGGAGAAATTGG + Intergenic
1058101881 9:100925458-100925480 CCATTCTGAATGGGAGAAATTGG - Intergenic
1058210380 9:102161049-102161071 CCACTCCAAATGGGTGAAATTGG + Intergenic
1058223091 9:102326399-102326421 CCATTCCAAATGGGAGAAATTGG - Intergenic
1058230415 9:102417730-102417752 CCATTCCAAATGGGAGAAATTGG - Intergenic
1058283790 9:103150876-103150898 CCATTCCAAATGGGAGAAATTGG - Intergenic
1058316984 9:103580823-103580845 CCATTCAAAATGGGAGAAATTGG + Intergenic
1058318718 9:103602387-103602409 CAATTCTTATGGGGAAAAATGGG - Intergenic
1058380519 9:104372289-104372311 CCATTCCAAATGGGAGAAATTGG - Intergenic
1058831660 9:108823334-108823356 CCATTCCAAATGGGAGAAATGGG + Intergenic
1058940588 9:109809455-109809477 CCATTCCAAATGGGAGAAATTGG - Intronic
1059022952 9:110596563-110596585 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1059069418 9:111120016-111120038 CCATTCCAAATGGGAGAAATTGG + Intergenic
1059195792 9:112369523-112369545 CCATTCCAAATGGGAGAAATTGG - Intergenic
1059276559 9:113102374-113102396 CCACTCAGATAGGGATAAATAGG - Intergenic
1059562290 9:115347294-115347316 CCATTCCAAATGGGGAAAATTGG + Intronic
1059581657 9:115555948-115555970 CCATTCCAAATGGGAGAAATTGG + Intergenic
1059587166 9:115619214-115619236 CCATTCCAAATGGGAGAAATTGG + Intergenic
1059766879 9:117391862-117391884 CCATTCCAAATGGGAGAAATTGG + Intronic
1059843236 9:118242505-118242527 CCATTCCAAATGGGAGAAATTGG + Intergenic
1060059188 9:120444003-120444025 TCTCTCTTCTTGGGAAAAATGGG - Intronic
1060308245 9:122435512-122435534 CCATTCCAAATGGGAGAAATTGG - Intergenic
1060449468 9:123723208-123723230 CCATTCTGAATGGGAGAAATTGG - Intronic
1060622792 9:125082780-125082802 CCATTCAAAATGGGAGAAATTGG - Intronic
1060653486 9:125351575-125351597 CCATTCCAAATGAGAAAAATTGG + Intronic
1185797824 X:2981841-2981863 CCATTCCAAATGGGAGAAATTGG - Intergenic
1185893713 X:3841253-3841275 CCATTCCAAATGGGAGAAATAGG - Intronic
1185898828 X:3879677-3879699 CCATTCCAAATGGGAGAAATAGG - Intergenic
1185903945 X:3918106-3918128 CCATTCCAAATGGGAGAAATAGG - Intergenic
1186221804 X:7356909-7356931 CCATTCCAAATGGGATAAATTGG + Intergenic
1186679229 X:11854563-11854585 CCATTCCAAATGGGAGAAATTGG + Intergenic
1186704552 X:12127817-12127839 TCATTCTAAATGGGAGAAATTGG + Intergenic
1186797559 X:13061834-13061856 CCATTCCAAATGGGAGAAATTGG + Intergenic
1186954655 X:14669065-14669087 CCATTCCAAATGGGAAAAATTGG + Intronic
1187002702 X:15199261-15199283 CCATTCCAAATGGGAGAAATTGG + Intergenic
1187615694 X:20991294-20991316 CCATTCCAAATGGGAGAAATTGG + Intergenic
1187619065 X:21030263-21030285 CCATTCCAAATGGGAGAAATTGG + Intergenic
1187663128 X:21573045-21573067 CCATTCCAAATGGGAGAAATTGG + Intronic
1187667317 X:21628060-21628082 CCATTCCAAATGGGAGAAATTGG + Intronic
1187894288 X:23966202-23966224 CCATTCCAAATGGGAGAAATTGG + Intergenic
1188018862 X:25135133-25135155 CCATTCCAAATGGGAGAAATTGG - Intergenic
1188055964 X:25541598-25541620 CCACTCCAAATGGGAGAAATTGG + Intergenic
1188069985 X:25706262-25706284 CCATTCCAAATGGGAGAAATTGG - Intergenic
1188114922 X:26231440-26231462 CCATTCCAAATGGGAGAAATTGG + Intergenic
1188170001 X:26912207-26912229 CCATTCCAAATGGGAGAAATTGG - Intergenic
1188449659 X:30295523-30295545 CCATTCCAAGTGGGAGAAATTGG - Intergenic
1188749332 X:33885679-33885701 CCATTCTAAATGGGAGAAATTGG - Intergenic
1188753746 X:33935632-33935654 CCATTCCAAATGGGATAAATTGG + Intergenic
1188804410 X:34569975-34569997 CCATTCCAAATGGGAAAAATTGG + Intergenic
1189176478 X:38962985-38963007 CCATTCCAAATGGGAGAAATTGG + Intergenic
1189228707 X:39435258-39435280 CCATTCTAAATGGGAGAACTTGG + Intergenic
1189371372 X:40432038-40432060 CCATTCCAAATGGGAGAAATTGG - Intergenic
1189408188 X:40744605-40744627 CCATTCCAAATGGGAGAAATTGG + Intergenic
1189553009 X:42113085-42113107 CCATTCCAAATGGGAGAAATTGG + Intergenic
1189669663 X:43394761-43394783 CCATTCCAAATGGGAGAAATTGG + Intergenic
1189871923 X:45393365-45393387 CCACTCCAAAAGGGAGAAATTGG + Intergenic
1189945235 X:46171048-46171070 CCATTCCAAATGGGAGAAATTGG + Intergenic
1190387684 X:49898543-49898565 CCATTCCAAATGGGAGAAATCGG - Intergenic
1190950705 X:55140192-55140214 CCATTCTGAGTGGGAGAAATTGG - Intronic
1191083974 X:56545176-56545198 CCATTCCAAATGGGAGAAATTGG + Intergenic
1191116352 X:56857320-56857342 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1191188655 X:57640699-57640721 CCATTCCAAATGGGAGAAATAGG - Intergenic
1191606824 X:63071658-63071680 CCATTCCAAATGGGAGAAATTGG + Intergenic
1191607902 X:63081743-63081765 CCATTCCAAATGGGAGAAATTGG - Intergenic
1191673448 X:63770363-63770385 CCATTTTAAATGGGAGAAATTGG - Intronic
1191680085 X:63831685-63831707 CCATTCTAAATGGGAAAAATGGG - Intergenic
1191688270 X:63914574-63914596 CCATTCCAAGTGGGAGAAATTGG - Intergenic
1191710906 X:64149324-64149346 CCATTCCAAATGGGAGAAATTGG + Intergenic
1192206672 X:69100983-69101005 CCACTGTCATGGGGAAATATGGG + Intergenic
1192270466 X:69574844-69574866 CCATTCCAAATGGGAGAAATTGG + Intergenic
1192378396 X:70588011-70588033 CCATTCCAAATGGGAGAAATTGG - Intronic
1192527659 X:71861642-71861664 CCATTCCAAATGGGAGAAATTGG + Intergenic
1192689765 X:73349838-73349860 CCATTCCAAATGGGAGAAATTGG - Intergenic
1192742508 X:73906620-73906642 CCATTCCAAATGGGAGAAATTGG - Intergenic
1192887232 X:75348144-75348166 CCACTCCAAATTGGAGAAATTGG - Intergenic
1193004043 X:76596204-76596226 CCATTCCAAATGGGATAAATTGG + Intergenic
1193050735 X:77096635-77096657 CCATTGCAAATGGGAAAAATTGG - Intergenic
1193139870 X:78016629-78016651 CCATTCCAAATGGGAGAAATTGG + Intronic
1193153531 X:78148658-78148680 CCATTCCAAATGGGAGAAATTGG - Intergenic
1193199051 X:78666237-78666259 CCACTCCAAATGGGAGAAATTGG - Intergenic
1193246481 X:79236506-79236528 CCATTCAAAATGGGAGAAATTGG + Intergenic
1193256550 X:79355482-79355504 CCATTCTAAAAGGGAGAAATTGG - Intergenic
1193329728 X:80222793-80222815 CCATTCTAAATGGAATAAATTGG - Intergenic
1193330137 X:80226710-80226732 CCATTCTAAATGGAATAAATTGG + Intergenic
1193370806 X:80694721-80694743 CCATTCCAAATGGGAGAAATTGG - Intronic
1193543121 X:82795412-82795434 CCATTCCAAATGGGAGAAATTGG - Intergenic
1193678157 X:84482907-84482929 CCATTCTAAATGGGATAAATTGG + Intronic
1193759100 X:85442778-85442800 CCATTCCAAATGGGATAAATTGG + Intergenic
1193795378 X:85866845-85866867 CCATTCCAAATGGGAGAAATTGG - Intronic
1193841958 X:86417956-86417978 CCATTCCAAATGGGAGAAATTGG + Intronic
1193917438 X:87382635-87382657 CCATTCCAAATGGGAGAAATTGG - Intergenic
1193918830 X:87400674-87400696 CCATTCCAAATGGGATAAATTGG - Intergenic
1194043263 X:88970106-88970128 CCATTCCAAATGGGAGAAATTGG + Intergenic
1194053736 X:89104710-89104732 CCATTCTACATGGGAGAAATTGG + Intergenic
1194082479 X:89486202-89486224 CCATTCCAAATGGGAGAAATTGG + Intergenic
1194092775 X:89599669-89599691 CCATTCCAAATGGGAGAAATTGG + Intergenic
1194194178 X:90871121-90871143 CCATTCCAAATGGGAGAAATTGG - Intergenic
1194244285 X:91492793-91492815 CCACTCTATAAGGGAGAAATTGG + Intergenic
1194332546 X:92600991-92601013 CCATTCCAAATGGGAGAAATTGG - Intronic
1194364497 X:92996860-92996882 CCATTCCAAATGGGAGAAATTGG - Intergenic
1194463142 X:94197301-94197323 CCATTCCAAATGGGAGAAATTGG - Intergenic
1194474059 X:94336112-94336134 CCATTCCAAATGGGAGAAATTGG - Intergenic
1194500517 X:94676152-94676174 CCATTCCAAATGGGATAAATTGG + Intergenic
1194505537 X:94729590-94729612 CCATTCCAAATGGGAGAAATTGG + Intergenic
1194522548 X:94936296-94936318 CCATTCCAAATGGGAGAAATTGG - Intergenic
1194525334 X:94970165-94970187 CCATTCCAAATGGGAGAAATTGG - Intergenic
1194526946 X:94989066-94989088 CCATTCTGAATGGGAGAAATTGG + Intergenic
1194534187 X:95085614-95085636 CCATTCCAAATGGGAGAAATTGG + Intergenic
1194542317 X:95189911-95189933 CTACTCCAAATGGGAAAAATTGG + Intergenic
1194548503 X:95268823-95268845 CCATTCCAAATGGGAGAAATTGG + Intergenic
1194566508 X:95494894-95494916 CCATTCCAAATGGGAGAAATTGG - Intergenic
1194578394 X:95641475-95641497 CCATTCCAAATGGGAGAAATTGG + Intergenic
1194582909 X:95698041-95698063 CCATTCCAAATGGGAGAAATTGG - Intergenic
1194603888 X:95957728-95957750 CCATTCCAAATGGGAGAAATTGG - Intergenic
1194688626 X:96955642-96955664 CCATTTCAAATGGGAAAAATTGG + Intronic
1194838751 X:98713840-98713862 CCATTCCAAATGGGAAAAATTGG - Intergenic
1194861061 X:98999383-98999405 CCATTCCAAATGGGAGAAATTGG - Intergenic
1194864990 X:99054399-99054421 CCATTCCAAATGGGAGAAATTGG - Intergenic
1194922193 X:99780109-99780131 CCATTCTAAAAGGGAGAAATTGG + Intergenic
1194941584 X:100016808-100016830 CCACTCCAAATGGGAGAAATTGG - Intergenic
1194941595 X:100016876-100016898 CCATTCCAAATGGGAGAAATTGG - Intergenic
1195126661 X:101815025-101815047 CCATTCCAAATGGGAGAAATTGG + Intergenic
1195195145 X:102490109-102490131 CCATTCCAAATGGGAAAAACTGG + Intergenic
1195210004 X:102645670-102645692 CCATTCCAAATGGGAGAAATTGG + Intergenic
1195227964 X:102817794-102817816 CCATTCCAAATGGGATAAATTGG + Intergenic
1195838911 X:109150562-109150584 CCATTCCAAATGGGATAAATTGG - Intergenic
1195863799 X:109408278-109408300 CTGTTCTAAATGGGAAAAATTGG - Intronic
1196036297 X:111149058-111149080 CCATTCCAAATGGGAGAAATTGG + Intronic
1196522296 X:116687638-116687660 CCATTCCAAATGGGAGAAATTGG - Intergenic
1196559389 X:117127128-117127150 CCATTCCAAATGGGAGAAATTGG - Intergenic
1196565987 X:117206131-117206153 CCATTCCAAATGGGAGAAATTGG + Intergenic
1196579470 X:117361999-117362021 CCATTCCAAATGGGAGAAATTGG - Intergenic
1196664754 X:118304681-118304703 CCATTCCAAATGGGAGAAATTGG + Intergenic
1196906532 X:120442393-120442415 CTACTCTACTTTGAAAAAATGGG + Intronic
1196930335 X:120675637-120675659 CCATTCCAAATGGGAGAAATTGG + Intergenic
1196996360 X:121388262-121388284 CCATTCTGAATGGGAGAAATTGG - Intergenic
1197016482 X:121632128-121632150 CCATTCCAAATGGGAGAAATTGG + Intergenic
1197089536 X:122520728-122520750 CCATTCCAAATGGGAGAAATTGG + Intergenic
1197092639 X:122556712-122556734 CCACTCCAAATGGAAGAAATTGG - Intergenic
1197442772 X:126511525-126511547 CCATTCCAAATGGGAGAAATTGG + Intergenic
1197578716 X:128255611-128255633 CCATTCCAAATGGGAGAAATTGG + Intergenic
1197594301 X:128448658-128448680 CCATTCCAAATGGGAGAAATTGG + Intergenic
1197613398 X:128664350-128664372 CAACTCAAATAGGGAAAAATGGG + Intergenic
1197856512 X:130919118-130919140 CCATTCCAAATGGGAGAAATTGG + Intergenic
1197914656 X:131521548-131521570 CCATTCCAAATGGGAGAAATTGG - Intergenic
1198274756 X:135089984-135090006 ACATTCTAAATGGGAGAAATCGG - Intergenic
1198612594 X:138418416-138418438 CCATTCCAAGTGGGAGAAATTGG - Intergenic
1198693349 X:139307938-139307960 CCATTCCAAATGGGAGAAATTGG - Intergenic
1198707305 X:139462811-139462833 CCATTCCAAATGGGAGAAATTGG - Intergenic
1198775362 X:140173264-140173286 CCATTCCAAATGGGAGAAATTGG - Intergenic
1198825714 X:140696063-140696085 CCATGCTAAATGGGAGAAATTGG + Intergenic
1198888105 X:141361717-141361739 CCATTCCAAATGGGAGAAATTGG + Intergenic
1198941645 X:141963510-141963532 CCATTCCAAGTGGGAAAAATTGG + Intergenic
1198990947 X:142514522-142514544 CCATTCCAAATGGGAGAAATTGG + Intergenic
1199003106 X:142663454-142663476 CCATTCCAAATGGGAGAAATTGG - Intergenic
1199060479 X:143350455-143350477 CCATTCCAAATGGGAAAAATTGG + Intergenic
1199062504 X:143375915-143375937 CCATTCCAAATGGGAGAAATTGG + Intergenic
1199071240 X:143477532-143477554 CCATTCCAAATGGGAAAAATTGG - Intergenic
1199112899 X:143955786-143955808 CCACTCCAAATGGAAGAAATTGG - Intergenic
1199170669 X:144731602-144731624 TCATTCTAAATGGGAAAAATTGG + Intergenic
1199182724 X:144878020-144878042 CCTCTCTCATGGGGAGAAATAGG + Intergenic
1199185398 X:144910177-144910199 CCACTCCAAATGGGAGAAATTGG + Intergenic
1199206874 X:145159605-145159627 CCATTCCAAATGGGAAAAATTGG + Intergenic
1199250855 X:145659996-145660018 CCATTCCAAATGGGAGAAATTGG - Intergenic
1199279026 X:145977749-145977771 CCATTCCAAATGGGAGAAATTGG - Intergenic
1199327233 X:146513512-146513534 CCATTCCAAATGGGAGAAATTGG - Intergenic
1199346425 X:146746439-146746461 CCATTCTAAATGGGAGAAATTGG + Intergenic
1199362816 X:146942955-146942977 CCATTCCAAATGGGAGAAATTGG + Intergenic
1199416432 X:147588119-147588141 ACAATCTACTTGAGAAAAATAGG - Intergenic
1199420429 X:147637654-147637676 CCATTCCAAATGGGAGAAATTGG - Intergenic
1199476820 X:148255061-148255083 CCATTACAAATGGGAAAAATTGG - Intergenic
1199560588 X:149159057-149159079 CCATTCCAAATGGGAGAAATTGG + Intergenic
1199580859 X:149358478-149358500 CCATTCTAAGTGGGAGAAATTGG - Intergenic
1199776032 X:151012890-151012912 TCACTCCAAGTGGGAGAAATTGG + Intergenic
1199823121 X:151470915-151470937 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1199868705 X:151877264-151877286 CCATTCCAAGTGGGAGAAATTGG + Intergenic
1199929693 X:152506037-152506059 CCATTCCAAATGGGAGAAATTGG + Intergenic
1199931748 X:152530475-152530497 CCATCCCAATTGGGAGAAATTGG + Intergenic
1200296544 X:154925682-154925704 CCATTCCAAATGGGAGAAATTGG - Intronic
1200353842 X:155526874-155526896 CCATTCCAAATGGGAGAAATTGG - Intronic
1200356872 X:155561709-155561731 CCATTCCAAATGGGAGAAATTGG + Intronic
1200380807 X:155835092-155835114 CCATTCCAAATGGGAGAAATTGG - Intergenic
1200395921 X:155987673-155987695 CCATTCCAAATGGGAGAAATTGG - Intergenic
1200435129 Y:3142083-3142105 CCATTCCAAATGGGAGAAATTGG + Intergenic
1200445415 Y:3255773-3255795 CCATTCCAAATGGGAGAAATTGG + Intergenic
1200540785 Y:4453505-4453527 CCATTCCAAATGGGAGAAATTGG - Intergenic
1200563265 Y:4734091-4734113 CCACTCTATAAGGGAGAAATTGG + Intergenic
1200679570 Y:6194322-6194344 CCATTCCAAATGGGAGAAATTGG + Intergenic
1201452337 Y:14129675-14129697 CCATTCCAAATGGGAGAAATTGG - Intergenic
1201530447 Y:14985324-14985346 TCTCTCTGATGGGGAAAAATGGG + Intergenic
1201592423 Y:15629500-15629522 CCATTCCAAATGGGAGAAATTGG - Intergenic
1201745129 Y:17363619-17363641 CCACTCTAAAAGGGATAAATTGG - Intergenic
1201924023 Y:19265654-19265676 CCATTCCAAATGGGATAAATTGG + Intergenic
1202091452 Y:21194886-21194908 CCATTTTAAATGGGAGAAATTGG - Intergenic