ID: 1045210829

View in Genome Browser
Species Human (GRCh38)
Location 8:100097883-100097905
Sequence ATTGGAGATTGGGGGAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045210829_1045210835 -3 Left 1045210829 8:100097883-100097905 CCATTGTTCCCCCAATCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1045210835 8:100097903-100097925 AATCCTTTTCTACTACAAAAAGG No data
1045210829_1045210839 19 Left 1045210829 8:100097883-100097905 CCATTGTTCCCCCAATCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1045210839 8:100097925-100097947 GGCTTATGGTGAAAGCAATTTGG No data
1045210829_1045210836 -2 Left 1045210829 8:100097883-100097905 CCATTGTTCCCCCAATCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1045210836 8:100097904-100097926 ATCCTTTTCTACTACAAAAAGGG No data
1045210829_1045210838 5 Left 1045210829 8:100097883-100097905 CCATTGTTCCCCCAATCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1045210838 8:100097911-100097933 TCTACTACAAAAAGGGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045210829 Original CRISPR ATTGGAGATTGGGGGAACAA TGG (reversed) Intronic
903049376 1:20589396-20589418 AGCGGAGACTGGGGGAAGAAGGG - Intronic
903868163 1:26412952-26412974 ATGGGGGGTTGGGGGAATAAGGG - Intronic
904190937 1:28743093-28743115 ATTGGAACTTGGGATAACAAGGG + Exonic
904609261 1:31716002-31716024 CCTGGAGATGGGGGGAAGAAGGG - Intergenic
904613212 1:31736440-31736462 ATGGGAGTCTGGGAGAACAAGGG - Intronic
904956768 1:34291096-34291118 AAGTGGGATTGGGGGAACAATGG + Intergenic
906280735 1:44551719-44551741 ATTGGAGGTGGGGAGACCAATGG - Intronic
906779278 1:48557863-48557885 AGTGGAGATTAGGGGTCCAATGG - Intronic
907093436 1:51751686-51751708 ATTGAAGATTGGGGAAGCAGAGG + Intronic
908633775 1:66139386-66139408 CTTGAAGATGGAGGGAACAATGG - Intronic
911332240 1:96538594-96538616 ATTGTAGAGTGGGTGAACAATGG + Intergenic
912322840 1:108730379-108730401 GTTGAAGATGGGGGCAACAAAGG + Intronic
913990224 1:143605072-143605094 ATTGTAGATTTAGGGAAAAAGGG - Intergenic
915551622 1:156638586-156638608 ACTGGAGATGGGGGGAACTCAGG + Intergenic
916842266 1:168612840-168612862 TTTTGAGTTTGGGGGAACCAGGG + Intergenic
917827225 1:178836349-178836371 ATTGGAGATGATGGGAAAAATGG - Intronic
918136124 1:181675329-181675351 ATTGGAGACAGTGGGAACAGGGG + Intronic
919365419 1:196654904-196654926 ATGGGGGTTTGGGGGAGCAAAGG - Intronic
921340589 1:214129890-214129912 ATAGGAGGTTTGGGGTACAAGGG - Intergenic
1066319998 10:34292969-34292991 ATTGGAAATAGGGGGGACAAAGG + Intronic
1069540834 10:69292731-69292753 ACTGGAGGTTGGGGGAAAACTGG - Intronic
1070271853 10:74964165-74964187 ATTGGGGGTTGGGGGAAAGAAGG + Intronic
1071396737 10:85231357-85231379 ATTGAAAATTGAGTGAACAAGGG - Intergenic
1073171509 10:101513152-101513174 ATTGGAGAATGGTAGAAGAAAGG + Intronic
1074906792 10:117871331-117871353 ATAGGAGATGGGGGTAGCAATGG + Intergenic
1075812692 10:125237008-125237030 ATTGGAGATTGGGGCTACTTAGG + Intergenic
1075902909 10:126057578-126057600 ATTGGAGTTTGGGGCAGCAGGGG - Intronic
1077238966 11:1500751-1500773 ATTGGAGGGTGGGGGCACAAGGG - Intronic
1078285629 11:9951808-9951830 AAAGCAGACTGGGGGAACAATGG + Intronic
1078402493 11:11040348-11040370 TTTGGAGATTGGGGGGCCACTGG + Intergenic
1081272189 11:41098157-41098179 CTTGGAGTTTGGGGGAAGTAAGG - Intronic
1081758858 11:45563041-45563063 ATGGGAGGTTGGGGGAAGTATGG + Intergenic
1081782961 11:45726197-45726219 ATGGGAAATAGGGGGAGCAAAGG + Intergenic
1085629495 11:78102236-78102258 ATTAGAGGTTGAGGGAACAGGGG - Intronic
1085872133 11:80362894-80362916 ATTGGAAATTTTGGTAACAACGG - Intergenic
1088838594 11:113602884-113602906 ATTGTTGATTTGGGGAATAATGG - Intergenic
1089096003 11:115920615-115920637 ATTGGAAATGGGGGGAAATAAGG - Intergenic
1089288752 11:117424831-117424853 TTGGTAGAATGGGGGAACAAGGG + Intergenic
1089517977 11:119045658-119045680 TTGGGAGTTTGGGGGAGCAAAGG + Intronic
1092490236 12:8938401-8938423 TTTGAAGAGTGGGGCAACAATGG - Intronic
1096242835 12:49968383-49968405 ATTAGAGATTGGGGAAAGTAAGG - Intronic
1096501633 12:52067433-52067455 ATTGGAGAGTGGTGGTACATAGG + Intergenic
1096672865 12:53210727-53210749 ACTGGGGATTGGAGGAAGAAAGG + Exonic
1097038163 12:56137711-56137733 TTTTGGGATTGGGGGAAAAATGG - Intronic
1097274447 12:57802913-57802935 ATGGGCCTTTGGGGGAACAAAGG - Intronic
1097651753 12:62307201-62307223 ATTGGAGTTTGGGAGGTCAAAGG - Intronic
1097676867 12:62612423-62612445 ATTGGAGAATGTGGGAAGAGTGG - Intergenic
1097689301 12:62719324-62719346 TTTGGAGATATGGGGAAGAAAGG + Intronic
1100512512 12:95290622-95290644 ATTGGAGATGGAGGGAGGAATGG + Intronic
1100701099 12:97149348-97149370 ACTTGTGATTGGGGGAATAATGG - Intergenic
1101318215 12:103649305-103649327 ATTAGTGACTGGGGGACCAAGGG - Intronic
1103852581 12:123942983-123943005 AAGGGAGTTTGGGGGAACAGAGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1107804271 13:44139850-44139872 TTGGGAGGTTGGGGGAAGAAAGG + Intergenic
1108258916 13:48637696-48637718 ACTGGAGGCTGGGGAAACAAGGG + Intergenic
1108837295 13:54567502-54567524 AATGGAGAGTATGGGAACAAAGG + Intergenic
1109131997 13:58598486-58598508 ATTGGAGGCTGTGGGAACAAAGG + Intergenic
1110066525 13:71113932-71113954 CTTGCAGAATGGTGGAACAAAGG - Intergenic
1111583626 13:90256227-90256249 AATGGAGATTGGGGAAACACTGG + Intergenic
1114356663 14:21917049-21917071 AGTGGAGTTTGGGAGAAAAACGG + Intergenic
1115031493 14:28800930-28800952 ATTAGAGACTGAGGGAATAAGGG - Intronic
1115998227 14:39215419-39215441 ATTGGAACTTGGGATAACAAGGG + Intergenic
1116734377 14:48670818-48670840 AGTGGTGAGTGAGGGAACAAAGG + Intergenic
1116797552 14:49408088-49408110 ACTGGATATTGGGGGAAATAAGG - Intergenic
1117855865 14:60032609-60032631 TTTAGAAATTGGGTGAACAAGGG - Intronic
1118003887 14:61548102-61548124 GTTGGAGATTGGGTAAACGAGGG - Intronic
1124819950 15:33034808-33034830 ACTGGAGATTGAGGGCACAGGGG - Intronic
1128331168 15:66756669-66756691 AGTGGAGATTGGGGCCAGAAGGG + Intronic
1128655505 15:69458626-69458648 CCTGGAGATTTGGGGAACGAGGG - Intergenic
1131656573 15:94466631-94466653 ATGGGAGATTGGGGGCACGAGGG - Intronic
1131811707 15:96180124-96180146 AATGGAGAATGGAGGAACCAAGG - Intergenic
1132094056 15:98969037-98969059 ATCGGAGTTTGGAGAAACAAAGG + Intronic
1133358027 16:5151277-5151299 ATTGGAGATCTGGGGAATACGGG - Intergenic
1133416190 16:5608952-5608974 AATGGATATGGGGGGAAGAAAGG - Intergenic
1133838675 16:9388901-9388923 AGTGGATATTGGTGGAAAAAGGG + Intergenic
1137589038 16:49682253-49682275 GTTGGAGAATGGGGGGAAAATGG - Intronic
1137699204 16:50484312-50484334 ACTGGAGGTTGGGAGAACAATGG + Intergenic
1138223098 16:55269670-55269692 AATGGAGATTGGGGGAAGGATGG + Intergenic
1139531044 16:67542900-67542922 ATTGGAGACTGGGGGACTACAGG - Exonic
1139634482 16:68249639-68249661 ACTGGAGAGTAGAGGAACAAGGG - Intronic
1141623044 16:85247324-85247346 ATTGGACATTGGATGGACAATGG + Intergenic
1142654295 17:1380909-1380931 ATTGTAGAGAAGGGGAACAAGGG - Intronic
1144179691 17:12740327-12740349 TTTGGGGATTGGGGGAAGATTGG - Intronic
1146095374 17:29925290-29925312 ATTGGGGATTGGTGGGAGAATGG + Intronic
1148210400 17:45805141-45805163 GTTGGAGCTTGGGGCAAAAAGGG - Intronic
1151179592 17:72317310-72317332 ATCTGAGATTTGGGGAAGAAGGG + Intergenic
1153629785 18:7058297-7058319 TTGAGAGATTGTGGGAACAATGG - Intronic
1154427700 18:14284522-14284544 ATATGAGATTGGGGGGCCAAAGG + Intergenic
1159482926 18:69014244-69014266 ATGGAAGTTTGGAGGAACAAAGG - Intronic
1159929135 18:74294155-74294177 ATTATAGAGTGGGGGAACAGAGG - Intergenic
1160349391 18:78161930-78161952 CTGTGTGATTGGGGGAACAAGGG - Intergenic
1163224912 19:15952833-15952855 ATGGGTGATTGGGGGAGCAGGGG - Intergenic
1163645983 19:18489424-18489446 AGTGGTGGTTGGGGGAACCAGGG - Intronic
1164463114 19:28465213-28465235 ATGGGAGAGTGGAGGAACAGTGG + Intergenic
1166226499 19:41399015-41399037 CTTGGAGATGGGGAGAAGAAAGG + Intronic
1202637625 1_KI270706v1_random:55916-55938 ATGTGAGATTGGGGGGCCAAAGG - Intergenic
925529552 2:4844141-4844163 ATTGGGGTTTGGGGAGACAAGGG + Intergenic
925828148 2:7870577-7870599 ATTAGGTATTGGAGGAACAAAGG - Intergenic
925961642 2:9022700-9022722 ATCAGAGATTGGGGGCAGAAAGG + Intergenic
926865693 2:17355900-17355922 ACTGGAGAATGGTGGAAGAACGG - Intergenic
929068036 2:37999907-37999929 ATTTGAGAGTGGGAGAACTAAGG - Intronic
929167718 2:38900403-38900425 ATAGAAGATGGGAGGAACAAAGG + Intronic
932055071 2:68435019-68435041 ATGGGAGATGGGGAGAAAAAGGG + Intergenic
933406854 2:81871577-81871599 ATTTGAAATAGGGGGAAAAATGG - Intergenic
936712555 2:115148990-115149012 AAAGGAGTTTGTGGGAACAAGGG - Intronic
937387887 2:121453559-121453581 ATTGGGGATTGGGGCAGGAATGG - Intronic
939585709 2:144002662-144002684 ATTGGTGATTTGGGAAACACAGG - Intronic
941161488 2:162040542-162040564 CTTGGAGACTGGGGGAAGGAAGG + Intronic
941970082 2:171340844-171340866 CTTGGAGGTTGGGGGAAGAATGG - Intronic
947010474 2:225560749-225560771 ATAGGGGCTTGGGGAAACAAAGG + Intronic
947737945 2:232467497-232467519 CTTGGACAATGGGGGAAGAACGG - Intergenic
948379692 2:237543377-237543399 AGTGGTGAGTGGGGGAACAGTGG + Intronic
1169371981 20:5034962-5034984 ATAGGAGATGGAGTGAACAAGGG - Intergenic
1169742772 20:8913389-8913411 ATTGAAGATTAAAGGAACAAAGG - Intronic
1170510602 20:17072589-17072611 ATTGGATATTGGGGAGAGAATGG - Intergenic
1172054529 20:32144953-32144975 AGTGGAGACTGGGAGCACAATGG - Intronic
1172861304 20:38054584-38054606 ATTTGAGTTGGGGGAAACAAAGG + Intronic
1173356302 20:42294387-42294409 ATTGGAGATTGAAGGAAAAAAGG + Intronic
1174946465 20:54991661-54991683 ATTGGTGATTTGGGGGAAAATGG - Intergenic
1175064576 20:56273979-56274001 ACTGAAGCTTGGGGGAAAAAAGG - Intergenic
1177279781 21:18966340-18966362 TTTGGACATTGGTGGAAAAATGG + Intergenic
1177318584 21:19492636-19492658 ATTGCTGATCAGGGGAACAATGG + Intergenic
1178834204 21:36082812-36082834 GTTGGAGATTGGGGAAAGTAAGG - Intergenic
1178994313 21:37384161-37384183 ATTGGAGTTAGGGGTAACCAAGG + Intronic
1179178795 21:39028020-39028042 ATTGAGGATTGGGGGAACCTAGG + Intergenic
1182718848 22:32381381-32381403 ACTAGAGCTTGGGGGAAGAAGGG + Intronic
950623723 3:14228706-14228728 ATGGGAGACTGGAGGAACACAGG + Intergenic
952412267 3:33060089-33060111 GTTGGAGAGTGGGAGAAGAATGG + Intronic
953922004 3:46958632-46958654 GTTGGGGATTGGATGAACAATGG - Intronic
954911640 3:54115577-54115599 TTCAGAGATTGGGGGAACAGAGG - Intergenic
956790574 3:72677023-72677045 AATAGGGATTGGGGGAACAGGGG + Intergenic
956921722 3:73937072-73937094 AGTAGAAATTGGGGGAACTAAGG - Intergenic
957682081 3:83449899-83449921 ATTTGAGATGAGGGGCACAAGGG + Intergenic
960619845 3:119627221-119627243 ATCAGAAATTGGGGGAAAAACGG + Intronic
961612423 3:128151798-128151820 AGTGGAGAGTGGTGGAACGAAGG + Intronic
962048370 3:131785474-131785496 TCTGGAGATTGGGGGAGCCATGG - Intronic
962189032 3:133290821-133290843 TTTGGAGCATGAGGGAACAAAGG + Intronic
962911836 3:139859365-139859387 ATTGGAGAATGGCTGAGCAAGGG - Intergenic
963103109 3:141624014-141624036 AGTGGAGACTGGGTGAGCAAGGG - Intergenic
963129062 3:141841346-141841368 ATTGGCGATTGATAGAACAAAGG - Intergenic
963826335 3:149958357-149958379 TTTGAAGATAGGGGGAAGAAGGG - Intronic
964412749 3:156415931-156415953 TGGGGACATTGGGGGAACAACGG - Intronic
964691216 3:159452295-159452317 ATTGGGGGATGGGGGGACAAGGG - Intronic
964991685 3:162820375-162820397 TTTGGAGTTTAGGGAAACAAAGG - Intergenic
965113086 3:164451836-164451858 GTTAGAGAGTGGGGGATCAAAGG + Intergenic
967057612 3:185843327-185843349 ATTGGAGAGTGGGGACAGAAAGG + Intergenic
967112393 3:186305514-186305536 AGTAGGGATTGGGGGAACCATGG + Intronic
972946208 4:44259146-44259168 CTTGGAGATAGTGGGAAGAATGG - Intronic
973393189 4:49573148-49573170 ATGTGAGATTGGGGGGCCAAAGG + Intergenic
974419901 4:61659985-61660007 ATTGGATATTGGGGGGACAGAGG + Intronic
975841032 4:78474410-78474432 ATTGGAACTTGGGGGAAAAAAGG + Intronic
978298489 4:107237382-107237404 ATTGGACATTGGGGACTCAAGGG - Intronic
979001570 4:115227516-115227538 TTTGGAGACTGTGTGAACAATGG - Intergenic
979317695 4:119284061-119284083 ATTGGAGATGGGGTTATCAAAGG + Intronic
981514041 4:145587860-145587882 ATTGGAGGTTGGGGGAAGGCTGG - Intergenic
982563299 4:156957786-156957808 ATTGGAAATGGGAGGCACAAAGG - Intronic
983152856 4:164307085-164307107 ATCTAAGATTGGGGGAACACAGG + Intronic
1202764942 4_GL000008v2_random:141771-141793 ATGTGAGATTGGGGGGCCAAAGG - Intergenic
986166759 5:5279372-5279394 ACTGGGGATTAGAGGAACAATGG - Intronic
989780867 5:45263091-45263113 CTTGAAGAATGGGGGAAGAAAGG + Intronic
991382652 5:66047352-66047374 ATTGAAGAATGGATGAACAAAGG - Intronic
991964335 5:72076342-72076364 ATGGGGGATAGGGGGAACATAGG - Intergenic
991987858 5:72308352-72308374 ATTGGAGATCGAGGCAGCAAGGG - Intronic
995470468 5:112496470-112496492 ATTGGAGTTTGGGGAAATTAAGG + Intergenic
1001324358 5:170710790-170710812 GTTGAAGAATGAGGGAACAAGGG - Intronic
1002113070 5:176933920-176933942 ATTGGTGATTGGTGGAGTAAGGG - Intronic
1004987724 6:21101709-21101731 TTTGGAGACTGGGGGAAAAAAGG - Intronic
1005020589 6:21414566-21414588 ATTGTATGTTGGGGGAAAAAAGG - Intergenic
1008711955 6:54238021-54238043 ATTGTAAAATGGGGGAAAAATGG - Intronic
1009598144 6:65763077-65763099 TTTGGAGAATGGGAGAAGAAGGG + Intergenic
1010066875 6:71692547-71692569 AGAGGAGATTGGTGGAACAATGG + Intergenic
1010693301 6:78936885-78936907 CTTGGAAATTAGGGGAACTAAGG + Exonic
1013793134 6:113858164-113858186 ATTTGTGTTTGGGGGCACAATGG + Intronic
1014216364 6:118756019-118756041 AATGGAGGTTTGGGGAACTAAGG - Intergenic
1015182333 6:130373952-130373974 AAGGGAGATTTGGGTAACAAAGG - Intronic
1016195323 6:141329186-141329208 TTTGGAAATTGGGGGAACTTTGG - Intergenic
1016295386 6:142567737-142567759 AATGGAGATTTGGGGAGCCAAGG - Intergenic
1016907903 6:149169518-149169540 ATTGGAGATGGGGGTGAAAAGGG - Intergenic
1017123488 6:151045394-151045416 AGTGGAGAGAGGGGGAAAAAGGG - Intronic
1017193801 6:151679946-151679968 ATTAGAGATGGGGAGTACAAGGG - Intronic
1017262746 6:152406207-152406229 ATTGGAGATTGGAGGGTCACAGG - Intronic
1018525023 6:164700813-164700835 ATTGGGGATTGGGGGAATGAGGG - Intergenic
1019141596 6:169950040-169950062 GTTGGAGGTTGGGGGGACAGTGG + Intergenic
1020880790 7:13761040-13761062 TTTGGAGAATGGCAGAACAATGG + Intergenic
1023503966 7:40880864-40880886 ATTGGATATTGATGGAACCAGGG + Intergenic
1025275519 7:57578964-57578986 ATAGGGGGTTGGGGAAACAATGG - Intergenic
1025708993 7:63890750-63890772 AGTGTAGATTTGGGGAACGATGG + Intergenic
1026137802 7:67678788-67678810 ATTGGAGCTTGAGGAAACAAGGG + Intergenic
1026389214 7:69882847-69882869 ATTTGGCATTGGAGGAACAATGG - Intronic
1027754508 7:82195431-82195453 ATTGGAGATTGGAGGGATAGTGG + Intronic
1028389933 7:90304229-90304251 TTTGGGAATTGGGGTAACAATGG - Intronic
1028620613 7:92823556-92823578 TTTGGAGATTGGGGCTAGAAGGG - Intronic
1035709281 8:1700164-1700186 CTTGTAGATTGGGGGAAGACAGG - Intronic
1038217628 8:25577219-25577241 ATGGGAGGATGGGGGAACAAGGG + Intergenic
1038360994 8:26877067-26877089 GTTGGGGAATGGGGGAAAAATGG + Intergenic
1038365090 8:26923428-26923450 AGTGGGGGTTGGGGGAAGAATGG + Intergenic
1039132799 8:34286560-34286582 ATTGGATATTAGTGGAAGAAAGG - Intergenic
1039333787 8:36567790-36567812 TTGGGAGAATGGGGGAACATAGG - Intergenic
1040851407 8:51904493-51904515 ATTGCAGATTAGGAGAAGAAAGG - Intergenic
1041289024 8:56290853-56290875 ATTGGAGAATGGTGGCATAAAGG - Intergenic
1042580849 8:70278054-70278076 ATTGGAGAGTGGGAGAAAATGGG - Intronic
1043217779 8:77617180-77617202 ATGGGAGATTTGGGGAATGATGG + Intergenic
1045210829 8:100097883-100097905 ATTGGAGATTGGGGGAACAATGG - Intronic
1045719665 8:105093517-105093539 TTTTAAGATTGGGGGTACAAAGG - Intronic
1045845284 8:106627848-106627870 AGTGGAGATTGAGGGCACAGGGG + Intronic
1046371025 8:113306641-113306663 ATGGGACATTGAGGGAGCAAAGG + Intronic
1054888682 9:70228447-70228469 TTTGGAAATTGGGGGAAAAGAGG + Intergenic
1055402092 9:75934527-75934549 GTTGGGGGTTGGGGGAGCAAAGG + Intronic
1057923286 9:99117607-99117629 ATTGTACACTGGGGGAAAAAAGG - Intronic
1057955166 9:99401478-99401500 ATTGGAGTTTGTGGTACCAATGG - Intergenic
1059962048 9:119575150-119575172 ATGGTAAAATGGGGGAACAAAGG - Intergenic
1203545692 Un_KI270743v1:126659-126681 ATGTGAGATTGGGGGGCCAAAGG - Intergenic
1185823744 X:3229014-3229036 ATTGGAGGATGGGGAAACAGGGG + Intergenic
1186076978 X:5891299-5891321 ATAGAAGAATGGGGGAAGAAAGG - Exonic
1187096937 X:16158518-16158540 ATTTTAAATTGGGGGAAAAAAGG - Intergenic
1188763908 X:34066835-34066857 TTTGGAGATTGGAGTAAGAATGG - Intergenic
1189966785 X:46381872-46381894 ATCAGAGTTTTGGGGAACAAAGG - Intergenic
1195229721 X:102834025-102834047 AGTGGAGATGGGGGGAAGAGGGG - Intergenic
1195543874 X:106093204-106093226 ATGGGAAATTGTGGGAACCATGG + Intergenic
1197761272 X:130030140-130030162 AAGGGTGCTTGGGGGAACAAAGG + Intronic
1197775264 X:130114628-130114650 GTTGGAGACTGGGGGAAGCAGGG - Intergenic
1198630748 X:138635430-138635452 ATTTGATATTGTGGGAACTATGG - Intronic
1198819375 X:140630455-140630477 CTTGGAGAGTGGGGGAAATAGGG - Intergenic