ID: 1045216480

View in Genome Browser
Species Human (GRCh38)
Location 8:100154114-100154136
Sequence CTGTATTTTCATATAATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045216480 Original CRISPR CTGTATTTTCATATAATGCT TGG Intergenic
901218428 1:7567714-7567736 ATGTATTTTCACAAGATGCTGGG + Intronic
904776304 1:32909289-32909311 CTGTATTTCCATATAAATTTAGG - Intergenic
904957749 1:34299771-34299793 CAGAATTTTCATATATTGCTAGG - Intergenic
907814974 1:57909775-57909797 CTGTATCTTGATAGCATGCTTGG + Intronic
908344721 1:63220281-63220303 CTGTTTTTTCATATATTTGTTGG - Intergenic
909472513 1:76044173-76044195 CTGTATTTGCATGTGATGCCTGG + Intergenic
909801171 1:79809508-79809530 CTGTATTTTCATTTGCAGCTTGG - Intergenic
910455553 1:87393849-87393871 ATGCATTTTCATATCCTGCTTGG - Intergenic
910987694 1:93022313-93022335 CTCTATTTTCATATACGGTTCGG + Intergenic
911696818 1:100897682-100897704 GTATACTTTTATATAATGCTTGG + Intronic
911719391 1:101174013-101174035 CTGTATTATACTATAATGGTGGG + Intergenic
911852955 1:102841651-102841673 CTGTAAATGCATATAATTCTGGG - Intergenic
912784163 1:112583538-112583560 GTGTATCTGCATATAGTGCTAGG - Intronic
914672205 1:149879467-149879489 CTGCATTTTCATATGAAGCCTGG - Intronic
915684031 1:157613005-157613027 GTGTTTTTTCATATACTGGTTGG - Intergenic
916955056 1:169823539-169823561 CTGTTTTATCATAAAATGGTAGG - Intronic
917179048 1:172273942-172273964 CTGTATTTTCATGCAATGGGGGG + Intronic
917335441 1:173920231-173920253 CTATATTTGAAAATAATGCTGGG - Intergenic
918213707 1:182374696-182374718 CAGTATTTTCTTTTCATGCTGGG - Intergenic
918461857 1:184784833-184784855 ATTTATTTTCCTATAGTGCTTGG + Intergenic
918548840 1:185716694-185716716 CTGTATGTGCACATAATGCTAGG + Intergenic
918575741 1:186057239-186057261 CTGTGGTTTCCTATGATGCTTGG - Exonic
919037626 1:192335526-192335548 CTGGACATTCATATAGTGCTAGG + Intronic
919111704 1:193227785-193227807 CTGTATTATTATATATTGATAGG + Intronic
919122406 1:193357502-193357524 CTTCATTTTCATATACTCCTAGG - Intergenic
920493013 1:206432936-206432958 CGATATTCTCTTATAATGCTTGG - Intronic
920709079 1:208277902-208277924 TTGTATTTTCATTTGGTGCTTGG + Intergenic
921497992 1:215864429-215864451 TTGTATTATCATATAAAGCAGGG + Intronic
921995697 1:221415587-221415609 CTATATTTTCTTAGAATTCTGGG - Intergenic
922404661 1:225299364-225299386 CTGTTTTTTCTCTTAATGCTGGG + Intronic
923549120 1:234947938-234947960 GTGTATTTCCCTATAATTCTTGG - Intergenic
923860379 1:237886835-237886857 GTTCATTTTCATATACTGCTCGG + Exonic
924802469 1:247337550-247337572 CTGTACTTTCATATCATTCTTGG - Intergenic
1064616048 10:17157784-17157806 GTGTATTTTTATGTAATGCCAGG - Exonic
1065269868 10:24017706-24017728 CTGCATTTTCATATAATTTCTGG - Intronic
1068037739 10:51782423-51782445 CTGTATCTTCATATCATACGAGG + Intronic
1068141413 10:53012787-53012809 CTGCATTTTCATCTGAGGCTTGG - Intergenic
1069758920 10:70794311-70794333 ATGTAGCTTCATATACTGCTTGG + Intergenic
1073518959 10:104107201-104107223 CTATATTTTCATACATTGATTGG + Intergenic
1074784695 10:116828610-116828632 CTGTATTTTTGTTTCATGCTGGG - Intergenic
1074947037 10:118290029-118290051 CTGTTTTATATTATAATGCTTGG - Intergenic
1078186381 11:9055162-9055184 CTGTATTCTCAAAGATTGCTGGG + Intronic
1078502245 11:11892117-11892139 TTGTATTTTCATAAAATCATAGG + Intronic
1080193605 11:29581285-29581307 CTGTTTTTTCATATCATTGTTGG - Intergenic
1080296340 11:30733312-30733334 CTGTCTTTTAATAAAATGTTCGG + Intergenic
1082759978 11:57117939-57117961 CTGTTTTTTCATATGATTGTTGG - Intergenic
1082772198 11:57216732-57216754 CTTTAATTTCATTTAATTCTGGG - Intergenic
1086133727 11:83425843-83425865 CTGTTTGTTCATATTATTCTTGG - Intergenic
1087248073 11:95863515-95863537 GTGTATTTTTGTATAATGATGGG - Intronic
1087507381 11:99043052-99043074 CTTTATTTTCTTATAAGGATAGG - Intronic
1088935839 11:114399838-114399860 ATGTATTTTCATTTAATACGTGG - Intronic
1090281622 11:125461155-125461177 CTCTATTTTCATTTGTTGCTGGG - Intronic
1090851446 11:130574097-130574119 CTGTATTTTCTAATAAAACTTGG + Intergenic
1092741531 12:11635182-11635204 CTATATTTTTAAATAATGCATGG + Intergenic
1093298578 12:17423733-17423755 GTGTATTTGCATATATTGTTGGG + Intergenic
1093612525 12:21179830-21179852 CTGTATCTACATATAAAGATGGG - Intronic
1093923829 12:24889600-24889622 CAGTCTTTTGTTATAATGCTGGG + Intronic
1095645148 12:44535145-44535167 ATGTATTTTCATATAAACTTTGG + Intronic
1095871963 12:47037883-47037905 TTGTTTTTTCAAATCATGCTTGG - Intergenic
1097729930 12:63116718-63116740 CAGTCTTTTGTTATAATGCTGGG - Intergenic
1098098670 12:66988683-66988705 CTGTATTTTTAAATAATACCTGG + Intergenic
1098499521 12:71174620-71174642 CTTTATTTTCACAAAATTCTGGG + Intronic
1100008884 12:89928818-89928840 CTGTAGGTTAATATAATCCTTGG + Intergenic
1100049218 12:90425397-90425419 CTATATTTTAAAATAATGATAGG + Intergenic
1100241657 12:92715632-92715654 CTGCATGGTCATATAATGTTAGG + Intergenic
1101033434 12:100681864-100681886 CTGTTATTTCATATAGTCCTAGG + Intergenic
1101097501 12:101357922-101357944 CTGCATTTTCATATGATCCCTGG + Intronic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1102691208 12:114762505-114762527 CTGTCTTGTCGTATAACGCTTGG - Intergenic
1105276414 13:18932154-18932176 TTGTTATTCCATATAATGCTAGG + Intergenic
1105742151 13:23337974-23337996 CTATATCTTCATAAAATCCTTGG + Exonic
1106623918 13:31399207-31399229 CTGTATTTTCAACTCATGATTGG + Intergenic
1106850538 13:33785734-33785756 TTGTTTTTTCATATAAAGCAAGG - Intergenic
1107351673 13:39521011-39521033 CTGTGTTTTCAGATCATGCCTGG - Intronic
1108255049 13:48601778-48601800 ATTTATTTTGCTATAATGCTTGG - Intergenic
1108572185 13:51762612-51762634 CTCCATTTCCATAAAATGCTTGG - Exonic
1109076943 13:57847546-57847568 CTGTATTTTCAAATAATGCCAGG - Intergenic
1109210868 13:59534469-59534491 ATGCATTTTCATACCATGCTGGG - Intergenic
1109689399 13:65866076-65866098 CTGTTTTTCCCTATGATGCTAGG - Intergenic
1110109877 13:71732671-71732693 CTGTATTTACAAATAAAGGTAGG - Intronic
1110319979 13:74150163-74150185 CTGTATTTCTATATTATACTAGG - Intergenic
1110365243 13:74676239-74676261 CTGAATTGTTATAGAATGCTGGG - Intergenic
1110883111 13:80597975-80597997 CTATACTTTCATATTATCCTTGG - Intergenic
1115167505 14:30465337-30465359 CTGTATTTCCATATAGTGGGTGG + Intergenic
1115492868 14:33975096-33975118 CTGAATTTTCAAGCAATGCTAGG + Intronic
1115785377 14:36819912-36819934 CTGCATATTCATATAAAGATAGG - Intronic
1116224255 14:42128094-42128116 CTGTATTTTCATATCATCATTGG - Intergenic
1116856975 14:49961172-49961194 CTGTATTTTCAGAGAAGGCGGGG + Intergenic
1118562569 14:67102352-67102374 TTTTATTTTTATATATTGCTTGG - Intronic
1118669484 14:68107605-68107627 CTGTATTTTTATCCTATGCTAGG - Intronic
1119118517 14:72050748-72050770 CTGTATTTTCAATTCATGTTTGG - Intronic
1119819146 14:77598942-77598964 TTTTACTTTTATATAATGCTGGG - Intronic
1120134274 14:80847626-80847648 CTGTATTTTCACATTATTTTAGG - Intronic
1120363419 14:83535110-83535132 CTTTACTTTCATATAATCTTTGG + Intergenic
1120444193 14:84573013-84573035 ATGTATTTTCAGATAAAACTTGG - Intergenic
1120546906 14:85823081-85823103 CTATGTTTTCATTAAATGCTAGG + Intergenic
1121090111 14:91175392-91175414 CTGCATTTTCACAAAAGGCTAGG - Intronic
1121114553 14:91334658-91334680 CTGGATTTTCATATAAACCTGGG + Intronic
1121892565 14:97608562-97608584 CTGTCTTGTCATCGAATGCTTGG - Intergenic
1122000571 14:98648240-98648262 CTGTGTGTTCATAAAGTGCTTGG + Intergenic
1122554586 14:102570642-102570664 CAGTCTTTTCATACAACGCTGGG - Intergenic
1123957581 15:25354393-25354415 CTGTAGTTTCTTCTAGTGCTTGG + Exonic
1127373617 15:58362572-58362594 CTGTATTTTAAAAGAATGCAGGG + Intronic
1128357405 15:66937701-66937723 CTGTATTTTCACATGATGAAAGG - Intergenic
1129257671 15:74343303-74343325 CTGTTTTTTCATCGAATTCTTGG + Intronic
1129646472 15:77438554-77438576 CTGCATTTTCTTATATAGCTTGG + Intronic
1130505813 15:84540403-84540425 GAGTATTTTCAAATATTGCTGGG - Intergenic
1131292765 15:91121460-91121482 CTTTATTTTCCCATAATTCTTGG + Intronic
1132075688 15:98818023-98818045 CTGTATCCTCATATAGTGGTGGG + Intronic
1133846791 16:9462163-9462185 ATTTATTTTCATAAAATTCTGGG + Intergenic
1134393219 16:13838987-13839009 CTGCATATTCATAAAATGCTCGG + Intergenic
1138011535 16:53385386-53385408 CTGTATTTTCATTTGATTCTGGG + Intergenic
1138306839 16:55985066-55985088 CTTTTTTTTCATATACTTCTTGG + Intergenic
1138780131 16:59775076-59775098 CAGTATTTTGTTATAATGTTTGG + Intergenic
1138968503 16:62115556-62115578 ATGTATTTTCATATAAATGTAGG + Intergenic
1140580127 16:76221338-76221360 CTCTTTTTTCATAAAATGCCAGG + Intergenic
1141080012 16:81042276-81042298 ATGCATTTTCATAAAGTGCTAGG - Exonic
1141795999 16:86274651-86274673 CTGTAGTTTCATAAAATGGCAGG - Intergenic
1144036356 17:11369622-11369644 CTGTATTCTCATAAGACGCTGGG + Intronic
1150043681 17:61890187-61890209 TGGTAATTTCATATAATACTTGG - Intronic
1150716941 17:67580320-67580342 CCATATTTTCATATTATGCCAGG - Intronic
1150807766 17:68332800-68332822 CTGCATTTTCATATTTTACTGGG + Intronic
1155585896 18:27364507-27364529 CTGTATTTTAAAATAATACATGG + Intergenic
1155604121 18:27584087-27584109 GTGTATTTTCATGCACTGCTAGG - Intergenic
1155681915 18:28497993-28498015 CTGCATTTTAGAATAATGCTTGG - Intergenic
1155724547 18:29063272-29063294 ATGTGTTTTCATTTAATGTTTGG - Intergenic
1155761013 18:29567117-29567139 CTATATTTTCATATACTATTTGG - Intergenic
1156452222 18:37273363-37273385 CTGTATTTAAAAGTAATGCTAGG + Intronic
1156718699 18:40043678-40043700 CTGTATTTTTATATTCTTCTTGG + Intergenic
1156959695 18:43010414-43010436 CTTAATTTTCATATTATGCCTGG - Intronic
1157055749 18:44226478-44226500 CTGTAAATTCATCTAATCCTGGG + Intergenic
1158359428 18:56655094-56655116 CTTTATTTTGATATAATTATAGG + Intronic
1158857489 18:61557699-61557721 CAGTATTTCCATATAGTGCTGGG + Intergenic
1158963754 18:62606511-62606533 TTCTCTTTTCATTTAATGCTGGG + Intergenic
1159304235 18:66618443-66618465 ATGTATTTTCATTTGATGCCTGG - Intergenic
1159474032 18:68894606-68894628 GTGAATTTTCATATGATTCTTGG + Intronic
1161801856 19:6420777-6420799 CAGTAGTTTCATAAAATACTAGG - Intronic
1163456430 19:17408777-17408799 ATGTATTTTTATATATTGGTTGG + Intronic
1164126065 19:22319506-22319528 ATGTATTTTTGAATAATGCTAGG - Intergenic
1165808753 19:38597558-38597580 CTGTATTCTCATAGCATCCTTGG - Exonic
1167416356 19:49375077-49375099 CTTTATTTCCATATGGTGCTTGG - Exonic
1168335633 19:55596033-55596055 CTGTATTTAGATACAGTGCTAGG - Intronic
925523084 2:4769530-4769552 CTTTATTTTCATTTATTTCTAGG + Intergenic
926368756 2:12159128-12159150 TTGTATTTTCATATAAATGTAGG + Intergenic
926988900 2:18655300-18655322 ATATTTTTTCATATAAAGCTTGG + Intergenic
927469890 2:23365596-23365618 CTGTATATTAATATAATTCTTGG - Intergenic
927620139 2:24647044-24647066 CTTTATTTTCATGTGATGTTTGG + Intronic
929513954 2:42589347-42589369 ATATATTTTCATCTAATTCTTGG + Intronic
931262421 2:60631840-60631862 CTGTATTTTCCTTGAAAGCTGGG - Intergenic
931292307 2:60883562-60883584 CTGAACTTACTTATAATGCTAGG - Intronic
931403759 2:61956014-61956036 CTGTTTTTACATATAAAGCACGG + Intronic
932157216 2:69428681-69428703 ATGTATTTTCCTATTATGCCTGG - Intronic
932157380 2:69430513-69430535 CTATTTTTTCCTATTATGCTTGG + Intronic
933067382 2:77815163-77815185 CTTTGTTTTCAGATAATGCCAGG + Intergenic
933501272 2:83114717-83114739 GACTATTTTCATATAATGCTGGG + Intergenic
935137107 2:100316435-100316457 ATATATTTTTATATAATGATGGG - Intronic
935145691 2:100393639-100393661 CTGTATTTTCTGATGATGCCAGG + Exonic
935381172 2:102452443-102452465 CTGTATTTTCTGATTCTGCTCGG - Exonic
935791625 2:106596409-106596431 CTGTATTTTACCATATTGCTGGG + Intergenic
937686631 2:124705225-124705247 CTGTATTTAAATCCAATGCTTGG + Intronic
937704756 2:124907035-124907057 CTGTATTATGATATAGTGCCGGG - Intronic
938952823 2:136271903-136271925 CAGTAGTTTCTTATAATCCTTGG - Intergenic
939718706 2:145619125-145619147 CACTATTTTCCTATAATGGTAGG + Intergenic
940753783 2:157658773-157658795 CTGTATTTTAATAAGATCCTCGG - Intergenic
941138828 2:161751358-161751380 TTTTTTTTTCATATATTGCTAGG + Intronic
941194271 2:162427326-162427348 TAGTATTTTCATACATTGCTGGG - Intronic
941200550 2:162503235-162503257 CTATATATTCATATAATGGTAGG + Intronic
941804733 2:169699790-169699812 CTTTTTTTTCATATATTTCTTGG + Intronic
942508431 2:176669249-176669271 CTGGTTTTTCCTATATTGCTGGG + Intergenic
942634871 2:177992194-177992216 TATTATTTTGATATAATGCTGGG - Intronic
943575319 2:189625119-189625141 ATGTATTTTCATGTAGTGCTGGG + Intergenic
943935784 2:193914798-193914820 CTTTATTTTCATATAAAGTTGGG - Intergenic
943968741 2:194374818-194374840 CTGTAGTTCCATAGACTGCTGGG + Intergenic
944016488 2:195045471-195045493 CTGTATTTTCAAATGGTCCTTGG - Intergenic
944366612 2:198928392-198928414 TTGTATTTTGTTATAATGTTAGG - Intergenic
944406384 2:199389044-199389066 CTGAATTATTATATACTGCTGGG - Intronic
944698390 2:202223886-202223908 CTGTAATTTCCTTCAATGCTGGG + Intronic
944724811 2:202459988-202460010 CCGTTTTTTCATATAATTGTTGG - Intronic
947143757 2:227044417-227044439 CTGTATTTACAAACCATGCTGGG + Intronic
1169184204 20:3599599-3599621 CTGTATTTTCATTCCACGCTTGG - Intronic
1169668066 20:8061608-8061630 CTGTATTTGCTTCTAATCCTGGG - Intergenic
1170166500 20:13365089-13365111 TCTTATTTTCATATAATGTTTGG + Intergenic
1170454180 20:16517135-16517157 CTGTATTTTCATCTTGTCCTTGG - Intronic
1171048573 20:21834257-21834279 GTGTATTTTTATATACTGATAGG - Intergenic
1171935983 20:31274916-31274938 CTTTATTTCCATATGCTGCTTGG - Intergenic
1173963233 20:47091216-47091238 CTGGATTCTCATTTAATCCTGGG - Intronic
1174791109 20:53479257-53479279 CTGCATTTTAATAGAATGTTTGG - Intronic
1176876472 21:14135166-14135188 CTGTTTTCTCATATATTTCTTGG - Intronic
1177351436 21:19946964-19946986 ATGTATTGTCTTATAATTCTGGG + Intergenic
1177465190 21:21468795-21468817 GTTTATTGTCATATCATGCTAGG + Intronic
1179102793 21:38369378-38369400 CTGTTTTTTCAAATAATTGTTGG + Intergenic
1179108679 21:38426276-38426298 CTGTGTTTTCATATTAGGATGGG - Intronic
1179203319 21:39247601-39247623 CTGTGTTTTCATATAAATTTGGG + Intronic
1180304870 22:11066180-11066202 CTTTATTTTCATACACTGATTGG - Intergenic
949208034 3:1464256-1464278 AACTATTTTCATATAATGTTTGG - Intergenic
950588578 3:13917179-13917201 GTGTATTTTTATATATTGGTGGG - Intergenic
951693974 3:25426959-25426981 CTGTATTTTAATAAAAGGATTGG + Intronic
951877650 3:27445116-27445138 CTGTACTTTCACACAAGGCTGGG - Intronic
952493293 3:33892678-33892700 CAGTCTTTTGTTATAATGCTGGG - Intergenic
954945899 3:54424174-54424196 CTGTATTTTCATTTTGTACTGGG + Intronic
955422887 3:58757323-58757345 CTGTATTTTCATATATTTAAGGG + Intronic
956236355 3:67076082-67076104 CTGCATTTCCATCTACTGCTTGG - Intergenic
956280997 3:67556610-67556632 CTGTATCTGCATATATTTCTTGG + Intronic
956610528 3:71117822-71117844 CTGTATTTTCATGCTAGGCTCGG + Intronic
957168064 3:76700494-76700516 CTGTTTTTTCTTCTAATGCCAGG + Intronic
957205212 3:77188857-77188879 ATATATTTTCAAACAATGCTTGG + Intronic
957421423 3:79976820-79976842 CTGTCATTTTAAATAATGCTTGG + Intergenic
957586328 3:82137159-82137181 CTATCTTGTCATATAATCCTGGG - Intergenic
957968393 3:87351619-87351641 ATCTATTTTCATATCATGTTTGG - Intergenic
962453513 3:135542710-135542732 CTGTATCATAATATAATGGTGGG - Intergenic
962866649 3:139452913-139452935 TTGTTTTTCCATTTAATGCTAGG + Exonic
963560627 3:146860578-146860600 GTGTATTATCAAATAATTCTTGG - Intergenic
963589597 3:147241218-147241240 GTATATTTTGAAATAATGCTTGG - Intergenic
965343661 3:167520484-167520506 CTGTACAATCATAGAATGCTGGG - Intronic
965369112 3:167839037-167839059 CTGTATTAGCAGATAATGTTAGG + Intergenic
965790289 3:172380008-172380030 TAGTTTTTTCATAAAATGCTTGG + Intronic
965982603 3:174711754-174711776 CTGTATTTTATTATAGTGCAAGG + Intronic
967053899 3:185810966-185810988 CTCTATTTTCATATAATTGGAGG - Intronic
967211637 3:187175322-187175344 CTGTTTTTACATCTCATGCTGGG - Intronic
967259216 3:187625562-187625584 CAGTCTTTTGTTATAATGCTGGG + Intergenic
967637726 3:191823696-191823718 CTGTAAATTCATATGATACTGGG - Intergenic
968219964 3:196929762-196929784 CTGTATGTGTATATGATGCTAGG + Intronic
970822893 4:20239736-20239758 CTCTATTTTCTTTTAGTGCTAGG - Intergenic
971299492 4:25430078-25430100 CTGCATTTTCATTTTAAGCTGGG + Intergenic
971527102 4:27634381-27634403 ATATATTTTCATATAATTCTAGG + Intergenic
974248558 4:59355539-59355561 CTGTTTTTTCATATGATCGTTGG + Intergenic
975111223 4:70629234-70629256 CTGTATTTTGAGATACTTCTAGG - Intronic
976494404 4:85710689-85710711 CTGTATTTTCATATGCTTTTTGG - Intronic
976543925 4:86311004-86311026 CTGTGTAATCATATAGTGCTTGG - Intronic
976564252 4:86535334-86535356 CTGTATCTTCATGTGATGCTTGG - Intronic
976920101 4:90429526-90429548 CTATATTGTTCTATAATGCTTGG - Intronic
977313609 4:95416964-95416986 CTGTAGTCTCATTTAATTCTTGG + Intronic
977373516 4:96170602-96170624 CTGCATTTTCATTTTGTGCTGGG + Intergenic
977794740 4:101150807-101150829 CTTTATTTTCATCTAATTTTTGG + Intronic
979721769 4:123908193-123908215 CTGTATTTTAAAATAAGGATTGG + Intergenic
981308698 4:143273911-143273933 GTGTATTTGCATTAAATGCTTGG - Intergenic
982694462 4:158583662-158583684 CTGTATTTTCAGAAAAGCCTAGG - Intronic
982869293 4:160556015-160556037 CTGAACTTACCTATAATGCTGGG + Intergenic
982985512 4:162201123-162201145 CAGTATTTTGTTATAATGTTGGG - Intergenic
983123009 4:163911884-163911906 CTTTATTTTCTTATAGTTCTGGG - Intronic
983304710 4:165971524-165971546 CTGAATTTTAAGCTAATGCTGGG - Intronic
983430261 4:167640851-167640873 CTGTATTTTAATCTAATGTTTGG + Intergenic
983478927 4:168249290-168249312 TCCTCTTTTCATATAATGCTGGG + Intronic
984409764 4:179381689-179381711 CTCTTTTTTCATATGATGCATGG + Intergenic
984680846 4:182607787-182607809 CTGTATATTCTGATAATGTTTGG + Intronic
986420423 5:7575208-7575230 CTGCATTTTAATATAATCTTTGG + Intronic
986824223 5:11503302-11503324 GTTTCTTTTCATATACTGCTCGG + Intronic
987225002 5:15831054-15831076 CTGTATTTTCATCAAAGGCATGG - Intronic
987341751 5:16945613-16945635 AGGTATATTCATATAATGCAAGG - Intergenic
988408352 5:30853855-30853877 CAATATTTCCATATACTGCTAGG - Intergenic
989015688 5:36930066-36930088 TTGTATTTTCCTATAAAGTTAGG + Intronic
989539687 5:42604629-42604651 CAGTCTTTTATTATAATGCTGGG - Intronic
989741814 5:44782581-44782603 TTATATCTTCATGTAATGCTTGG - Intergenic
990080501 5:51907346-51907368 CTGTATTTTTTTTTAAAGCTGGG - Intergenic
991991034 5:72339488-72339510 ATGCATTTCCATATACTGCTGGG + Intronic
993090074 5:83414652-83414674 CTTTATTGTCATACAATTCTTGG + Intergenic
993128146 5:83860993-83861015 CTGTAAGTTCATCTAATGTTAGG - Intergenic
993223472 5:85134339-85134361 TTTTATTTTCATATATTTCTAGG + Intergenic
994637948 5:102365611-102365633 CAGTATTTTCAAATTATGATGGG - Intergenic
994659837 5:102640606-102640628 ATGTATTTTCATATATCTCTAGG + Intergenic
994688548 5:102987802-102987824 CTGAATTTGCAAATAATCCTAGG - Intronic
995717102 5:115091068-115091090 CTGCATTTGCATATCTTGCTGGG + Intergenic
995819618 5:116214989-116215011 CTCTATTTGCATAGAAGGCTGGG - Intronic
996341102 5:122439851-122439873 TGGTATTTTCATGTTATGCTTGG - Intronic
997099781 5:130956521-130956543 CTTTTTTTTCATATGATTCTTGG + Intergenic
997392330 5:133527242-133527264 GTATATTTTAGTATAATGCTTGG + Intronic
998028806 5:138845553-138845575 CTTTATTTTCATTTAATTGTTGG + Intronic
998259690 5:140620427-140620449 CTGTATGATGATATAATGGTGGG + Intergenic
998740426 5:145194539-145194561 CTTTTTTTTCATATATTTCTTGG - Intergenic
999615992 5:153425019-153425041 CTTTTTTTTCATATGATTCTTGG - Intergenic
1002720577 5:181258820-181258842 CTTCATTTTGAGATAATGCTAGG + Intronic
1004664633 6:17738574-17738596 CTGTTTTTTCATATAAAGCAGGG - Intergenic
1005631545 6:27712728-27712750 CTGTATTTTCATTTTACACTGGG - Intergenic
1005635480 6:27749300-27749322 TTGTAGTTTCATATAATTTTAGG + Intergenic
1005733882 6:28726661-28726683 CTGTATTTTCATTTTACACTGGG - Intergenic
1005907840 6:30280378-30280400 CTGTGTTTTCATATAAATTTTGG + Intergenic
1007168229 6:39843568-39843590 CTGCATTTTCATTTTGTGCTGGG - Intronic
1008884619 6:56418618-56418640 ATGTATCTTCAGATAATTCTTGG + Intergenic
1009634324 6:66245326-66245348 AAGTATTTTTATATAATGCTTGG + Intergenic
1009885969 6:69624447-69624469 GTGTTTTTTCATATAATTCTTGG - Intergenic
1010678519 6:78771914-78771936 CTGTGCTTTCATTTTATGCTAGG - Intergenic
1011616814 6:89204866-89204888 CTGTATTTTCTTATGATTCTTGG + Intronic
1013066119 6:106685842-106685864 CTGTATTTTCAGTTTCTGCTAGG + Intergenic
1013427478 6:110026392-110026414 TTGTGTATTCATATATTGCTAGG + Intergenic
1014289888 6:119546016-119546038 TTGCATTTTCATTTAATTCTGGG - Intergenic
1014302664 6:119701833-119701855 CTGTGTGTTCATATAATGGAAGG - Intergenic
1016629889 6:146216055-146216077 CAGTATTTTCTTAAAATGTTTGG - Intronic
1017423957 6:154301509-154301531 CTGCATTCTTATTTAATGCTAGG + Intronic
1017595120 6:156020196-156020218 CTGTGTTTTCATTTTATTCTGGG - Intergenic
1018329382 6:162710941-162710963 CATTATTTTCATTTAATACTGGG - Intronic
1018589902 6:165408373-165408395 CCTAATTTTCATATGATGCTTGG + Intronic
1021011172 7:15468099-15468121 CTAAATTTTCATATACTTCTGGG + Intronic
1021281595 7:18726285-18726307 CTGTATTTTCACTCAAGGCTTGG - Intronic
1021582998 7:22176918-22176940 CTGTATTTAAAAATACTGCTAGG + Intronic
1021689112 7:23214983-23215005 CTGTGTTTTCACACCATGCTGGG - Intergenic
1022066154 7:26859621-26859643 ATGTATTTTGATAGAAAGCTGGG + Intronic
1022967403 7:35486537-35486559 CTTTATTTTTATATATTGCTAGG - Intergenic
1027650913 7:80867654-80867676 CAGTGGTATCATATAATGCTGGG + Intronic
1028308397 7:89296341-89296363 CTTTATTTTCATATAATTTTTGG + Intronic
1029421716 7:100475478-100475500 CTTTAATTTCAGATAATGTTAGG - Intronic
1030004192 7:105099160-105099182 GTGTATTTTAAGATAAAGCTAGG + Intronic
1030687313 7:112500152-112500174 CTGTATTTTATTATAATTTTTGG + Intergenic
1031714702 7:125094477-125094499 CTGACTTTTCTTATAATGATTGG - Intergenic
1034012282 7:147542779-147542801 CTATATTGTCACATATTGCTAGG + Intronic
1035619007 8:1023802-1023824 TGATATTTTCAAATAATGCTTGG + Intergenic
1036291343 8:7494410-7494432 CTGTCTTTTCTTATATTTCTAGG + Intergenic
1036330146 8:7817126-7817148 CTGTCTTTTCTTATATTTCTAGG - Intergenic
1036483418 8:9157873-9157895 CTTTATATACATATAATGCAAGG + Intronic
1037271742 8:17137546-17137568 CTGTATTTTCATTTCACACTGGG + Intergenic
1043296545 8:78670273-78670295 ATGTATTTCAATATAGTGCTTGG + Intronic
1044417999 8:91957954-91957976 CTGTATTTTCATATACAAGTTGG - Intronic
1044491723 8:92826868-92826890 CTGTATTTTAATATATCCCTTGG - Intergenic
1045216480 8:100154114-100154136 CTGTATTTTCATATAATGCTTGG + Intergenic
1045287142 8:100801668-100801690 CTGCAATTTCATATGAGGCTTGG - Intergenic
1045473407 8:102533259-102533281 ATGAATTTTCATATCATCCTTGG + Intronic
1046028352 8:108752079-108752101 CTGTGTTTTCATATAAGGTAAGG - Intronic
1050690051 9:8216871-8216893 GTGTATTTTCATAGAACTCTTGG + Intergenic
1051165282 9:14255504-14255526 CTGGATTTTTATATCATGTTTGG - Intronic
1051944792 9:22554907-22554929 CAGTATTTTGTTATAATGTTGGG - Intergenic
1052047761 9:23814305-23814327 CTTTATTTTCTTATCCTGCTTGG - Intronic
1055379698 9:75692667-75692689 CTTTATTTTCATAAATTGATAGG + Intergenic
1057827964 9:98385537-98385559 ATGTATTTTCATGTATTTCTGGG + Intronic
1058830521 9:108812318-108812340 TTTTTTTTTCATATAATGATTGG - Intergenic
1058876111 9:109246324-109246346 CTCTATTTTTAAATAATCCTGGG - Intronic
1058894811 9:109390099-109390121 CAGTCTTTTCATATAATCCCAGG - Intronic
1059290543 9:113220443-113220465 GTATATATTAATATAATGCTTGG + Intronic
1059891835 9:118812570-118812592 CAGTCTTTTCTTATAATGTTGGG - Intergenic
1062043885 9:134416398-134416420 CTCTATTTTGTCATAATGCTCGG + Intronic
1186738127 X:12487923-12487945 CTTTATTTTTATCTAATTCTAGG - Intronic
1187022414 X:15397918-15397940 CTGTATTGTCCCATAGTGCTAGG - Intronic
1187092161 X:16107905-16107927 CTGTAATTTCACATAATGGAAGG - Intergenic
1187529161 X:20080889-20080911 CAGTATTTTCCTGTAATGGTGGG + Intronic
1188141885 X:26560606-26560628 CTGTATTTTTATTTTAAGCTTGG - Intergenic
1188685088 X:33059780-33059802 GTGTATTTTCACATAGTGGTTGG + Intronic
1189399202 X:40649774-40649796 TTGAATTTTTATATTATGCTTGG - Exonic
1190618243 X:52260728-52260750 GTGTATTTTTAAATAATGTTTGG - Intergenic
1194949948 X:100113364-100113386 GAATATTTTCATATAGTGCTGGG - Intergenic
1195206709 X:102607347-102607369 GTGTTTTTTCATATAATTTTTGG + Intergenic
1195511096 X:105716070-105716092 CTGTATTTTCATCTACAGCAGGG - Intronic
1196141428 X:112267064-112267086 CAGTATGTTTATATAGTGCTGGG - Intergenic
1198137767 X:133771149-133771171 CACTATTTTAAAATAATGCTTGG + Intronic
1198574819 X:137998441-137998463 CTGTCTTTTCTTATAAATCTGGG + Intergenic
1199030424 X:142992159-142992181 CTTTATTTTTATAAGATGCTCGG + Intergenic
1199299581 X:146197254-146197276 CTGTATTTTCAACTTATGCTGGG + Intergenic
1199654450 X:149980815-149980837 CTGGATTTTAATAAGATGCTAGG + Intergenic
1201369514 Y:13246574-13246596 CTGTATTTTAATATAAACCTTGG - Intergenic