ID: 1045219139

View in Genome Browser
Species Human (GRCh38)
Location 8:100179968-100179990
Sequence GTTGTTTTTCTTAAAGCGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 915
Summary {0: 1, 1: 1, 2: 14, 3: 96, 4: 803}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045219139_1045219140 29 Left 1045219139 8:100179968-100179990 CCTGTCGCTTTAAGAAAAACAAC 0: 1
1: 1
2: 14
3: 96
4: 803
Right 1045219140 8:100180020-100180042 TGACCTTTCAAGTGCAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045219139 Original CRISPR GTTGTTTTTCTTAAAGCGAC AGG (reversed) Intronic
900248375 1:1650677-1650699 TTTTTTTTTTTTAAAGAGACAGG + Intronic
900712953 1:4126455-4126477 GTTGTTTTCCTTGAAGTGACAGG + Intergenic
901708641 1:11096480-11096502 TTTTTTTTTTTTAAAGAGACAGG + Intronic
901861134 1:12075255-12075277 TTTTTTTTTTTTAAAGAGACAGG + Intronic
901883783 1:12208938-12208960 TTTTTTTTTCTTTAAGAGACAGG - Exonic
901900199 1:12354526-12354548 GTTCTTTTTTTTTAAGAGACAGG - Intronic
902188658 1:14744718-14744740 GTTTTTATTTTTAAAGAGACTGG - Intronic
902355231 1:15893724-15893746 TTTGTTTTTTTTTAAGAGACAGG - Intronic
902600564 1:17538056-17538078 TTTGTTTTTTTTTAAGAGACTGG - Intergenic
903145804 1:21371233-21371255 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
903275713 1:22220109-22220131 TTTTTTTTTTTTAAAGAGACGGG + Intergenic
903862234 1:26371592-26371614 TTTTTTTTTTTTAAAGAGACAGG - Intronic
903914913 1:26756554-26756576 TTTTTTTTTTTTAAAGAGACAGG - Intronic
904071885 1:27806232-27806254 GTTGTTTTCCTTGAAGTGACAGG + Intronic
904126007 1:28239346-28239368 GTTTTTTTTTTTAAAGAGATGGG - Intronic
904712437 1:32440658-32440680 TTTGTATTTCTTATAGAGACAGG + Intergenic
904812120 1:33170311-33170333 TTTTTTTTTTTTAAAGAGACTGG - Intronic
905433998 1:37944598-37944620 GTTTTTTTTTTTATAGAGACAGG + Intronic
905880715 1:41461756-41461778 GTTTTTTTTTTCAAAGAGACGGG + Intergenic
906045079 1:42823515-42823537 GTTGCTTTTCCTGAAGTGACAGG + Intronic
906354307 1:45090816-45090838 TTTCTTTTTCTTAAAGAGACAGG - Intronic
906413169 1:45596068-45596090 GTTATTTCCCTTAAAGTGACAGG - Intronic
906424557 1:45699666-45699688 ATTTTTTTTCTTTAAGAGACAGG + Exonic
906449543 1:45933215-45933237 CTTTTTTTTTTTAAAGAGACAGG - Intronic
906500585 1:46339495-46339517 GTTATTTTCCTTGAAGTGACAGG - Intergenic
906970082 1:50503607-50503629 TTTTTTTTTTTTAAAGAGACAGG - Intronic
907375258 1:54032929-54032951 TTTTTTTTTTTTAAAGAGACGGG + Intronic
907376537 1:54047960-54047982 GTTGTTGTTTTTTAAGCAACAGG - Intronic
907455175 1:54571076-54571098 TTTTTTTTTTTTAAAGAGACAGG + Intronic
907478036 1:54719904-54719926 TTTTTTTTTTTTAAAGTGACAGG + Intronic
907630627 1:56077954-56077976 GTTGTTTTCCTTCAAGGGGCAGG - Intergenic
907694080 1:56703717-56703739 GTTGTTTTCCTTAAAGCGATGGG + Intronic
908749279 1:67403898-67403920 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
910575753 1:88761602-88761624 TTTTTTTTTTTTAAAGAGACAGG - Intronic
910685581 1:89912584-89912606 GGTGATTTTCTTCAAGCTACTGG - Intronic
910778749 1:90903321-90903343 GTTTTTTTTTTTTAAGAGACAGG - Intergenic
910798964 1:91126675-91126697 GTCATTTTTCTTGAAGTGACAGG + Intergenic
910933474 1:92465420-92465442 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
910938720 1:92509496-92509518 TTTTTTTTTTTTAAAGAGACAGG + Exonic
911018035 1:93356235-93356257 TTTTTTTTTTTTAAAGAGACAGG + Intronic
911034972 1:93532515-93532537 TTTTTTTTTTTTAAAGCAACTGG - Intronic
911045843 1:93626993-93627015 GTTGTTTTCCTTGAAGTAACAGG - Intronic
911186396 1:94908969-94908991 TTTTTTTTTTTTAAAGAGACGGG - Intronic
911200791 1:95041606-95041628 TTTTTTTTTTTTAAAGAGACGGG - Intronic
911594120 1:99781485-99781507 TTTGTTTTGCTTTAAGAGACAGG + Intergenic
912328652 1:108795481-108795503 TTTTTTTTTTTTAAAGAGACAGG - Intronic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
912767996 1:112433907-112433929 TTTTTTTTTTTTAAAGAGACGGG + Intronic
912925602 1:113910505-113910527 TTTGTTTTTTTTTAAGAGACAGG + Intronic
913455676 1:119028176-119028198 GTTGTTCTTCTTAAAGGGGGTGG + Intergenic
913541607 1:119826374-119826396 CTTGTTTTTCTTAAAGAGATTGG - Intergenic
915739951 1:158111656-158111678 GTTTTTTTTTTTTAAGAGACAGG + Intergenic
916234989 1:162577917-162577939 TTTGTTTTTTTTATAGAGACAGG + Intronic
916410549 1:164542978-164543000 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
916657316 1:166887635-166887657 GTGAATTTTCTTAAAGCGTCGGG - Intergenic
916756348 1:167773884-167773906 TTTTTTTTTTTTAAAGAGACAGG - Intronic
916810297 1:168299642-168299664 TGTGTTTTTTTTAAAGAGACAGG + Intronic
916897197 1:169177613-169177635 GAAGTTTTTCTTTAAGAGACAGG - Intronic
916966995 1:169957928-169957950 ACTTTTTTTCTTAAAGAGACAGG + Intronic
917162103 1:172068992-172069014 TTTTTTTTCCTTTAAGCGACAGG - Intronic
917178950 1:172272002-172272024 GTTGTTTTCCTTTAAATGACAGG + Intronic
917347659 1:174045184-174045206 TTTGTTTTTGTTAAAGAGAGTGG - Intergenic
917466816 1:175286469-175286491 ATTGTTTTCCTTGAAGTGACAGG + Intergenic
917837146 1:178950264-178950286 TTTTTTTTTTTTAAAGGGACAGG - Intergenic
917882880 1:179356700-179356722 GTTTTTGTTTTTAAAGAGACAGG + Exonic
918001167 1:180498296-180498318 GTTGTTTTCCTTGAAGTGACAGG + Intronic
918443103 1:184588212-184588234 GTTATTTTTCTTGAAGTGTCAGG - Intronic
918493820 1:185111619-185111641 GTTTTTGTTCTTTAAGAGACAGG - Intergenic
919059577 1:192614330-192614352 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
919705698 1:200673019-200673041 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
920079117 1:203359502-203359524 GGTGTGTTTCTTAAAGTGATTGG - Intergenic
920276059 1:204805278-204805300 GTTGGTTTTTTTAAAGAGATGGG + Intergenic
920389391 1:205589621-205589643 ATTGTTTTTTTTAGAGAGACAGG + Intronic
920541259 1:206779858-206779880 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
920668599 1:207985536-207985558 ATCGTTTTGCTTAAAGTGACAGG + Intergenic
920837447 1:209524835-209524857 TTTGTATTTGTTAAAGAGACGGG - Intergenic
920991988 1:210948193-210948215 TTTTTTTTTTTTAAAGAGACAGG - Intronic
921175848 1:212593733-212593755 TTTTTTTTTTTTAAAGAGACAGG - Intronic
921357665 1:214301663-214301685 GTTGTTTTCCTGGAAGTGACAGG + Intronic
921485212 1:215707299-215707321 GCTGTTTTGATTAAAGCGCCTGG - Intronic
921486568 1:215722057-215722079 TTTTTTTTTTTTAAAGAGACAGG - Intronic
921744710 1:218726507-218726529 GTTGTTCTCCTTGAAGTGACTGG + Intergenic
922313199 1:224415765-224415787 CATGTATTTCTTAAAGGGACAGG + Intronic
922601699 1:226860458-226860480 GTTGTTTCCCTTGAAGTGACAGG - Intergenic
922945058 1:229506811-229506833 TTTTTTTTTTTTAAAGAGACAGG - Intronic
923707310 1:236354565-236354587 GTGGTTTTTCTTGTAGCCACAGG - Intronic
923857050 1:237856522-237856544 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
924273767 1:242363444-242363466 TTTTTTTTTTTTAAAGAGACAGG - Intronic
924401627 1:243689493-243689515 TTTTTTTTTTTTAAAGAGACAGG + Intronic
924468720 1:244320722-244320744 GCTTTTTTTTTTAAAGAGACAGG - Intergenic
1062788962 10:289273-289295 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1063289575 10:4731415-4731437 GTTGTTTTCCTTGAAGTGACAGG + Intergenic
1063370546 10:5519348-5519370 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
1063406359 10:5799329-5799351 GTTGTTTGTTTTTAAGAGACAGG - Intronic
1063574293 10:7247650-7247672 TTTCTTTTTCTTAAAGATACGGG - Intronic
1063948066 10:11196639-11196661 TTTGTTTTTTTTAAAGAGAGAGG - Intronic
1063963902 10:11329752-11329774 GATCTGTTTCTTAAAGCTACAGG + Intronic
1064673546 10:17739371-17739393 TTTGTTTTTTTAAAAGAGACAGG + Intergenic
1065036791 10:21647482-21647504 ATTTTTGTTCTTAAAGAGACTGG - Intronic
1065204664 10:23345057-23345079 ATTGTTTTTCTGTAAACGACTGG + Intergenic
1065341903 10:24715393-24715415 GTTTTATTTCTTAAAACGAATGG - Intronic
1065797105 10:29317936-29317958 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1065808092 10:29413429-29413451 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1066275226 10:33862211-33862233 CTTGTTTTTTTTAAACTGACAGG + Intergenic
1066710941 10:38233210-38233232 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1067399582 10:45958648-45958670 GTTTTTTTTTTTAAAGAGACAGG - Intergenic
1067847055 10:49732921-49732943 TTTTTTTTTCCTAAAGAGACAGG + Intergenic
1067867912 10:49927956-49927978 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1068715724 10:60186354-60186376 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1068889724 10:62136178-62136200 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1069713375 10:70505256-70505278 GTTGTTTTCTTTGAAGGGACAGG + Intronic
1070045869 10:72835751-72835773 GTTTTTTGTCTTTAAGAGACTGG - Intronic
1070104600 10:73419527-73419549 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1070143596 10:73757350-73757372 TTTTTTTTTTTTATAGCGACAGG - Intronic
1070607901 10:77912196-77912218 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1070772031 10:79088191-79088213 GTTGTTTTGCCCAAAGCTACTGG + Intronic
1071220613 10:83460572-83460594 TTTGTTATTTTTAAAGAGACAGG - Intergenic
1071697304 10:87890045-87890067 TTTTTTTTTCTTAAAGATACTGG + Intronic
1071903339 10:90144599-90144621 CTTTTTTTTCTTGAAGTGACAGG + Intergenic
1072108847 10:92298879-92298901 TTTGTTTTTGTTAAAGAAACAGG + Intronic
1072130449 10:92489005-92489027 GTTTTTTTTTTTAAATAGACAGG - Intronic
1072509091 10:96100375-96100397 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1072666392 10:97395992-97396014 TTTCTTTTTTTTAAAGAGACAGG - Intronic
1072776509 10:98201890-98201912 TTTTTTTTTTTTAAAGAGACGGG + Intronic
1073241636 10:102062788-102062810 ATTTTTTTTTTTAAAGAGACAGG + Intergenic
1073389305 10:103159641-103159663 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1074345451 10:112681081-112681103 TTTTTTTTTTTTAAAGGGACAGG + Intronic
1074570059 10:114616159-114616181 TTTTTTTTTCTTATAGAGACAGG - Intronic
1074999588 10:118785622-118785644 GTTTTTGTTTTTAAAGAGACAGG - Intergenic
1075886135 10:125900977-125900999 GTTGTTGTTTTTAGAGAGACAGG + Intronic
1075965441 10:126607475-126607497 GTTGTTTTCCTTAAAGTGACAGG - Intronic
1076070846 10:127487509-127487531 GTTGCTTTCCTTGAAGTGACAGG - Intergenic
1076242143 10:128916648-128916670 TTTTTTTTTCTTAAAGCAAAGGG + Intergenic
1076757759 10:132582424-132582446 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1078288000 11:9977479-9977501 TTTTTTTTTCTTAAAGAGACAGG - Intronic
1078673280 11:13384140-13384162 GTCATTTTCCTTAAAGTGACAGG - Intronic
1078742834 11:14083812-14083834 GTTGTTTTCCTTGAAGTGACAGG + Intronic
1079438129 11:20478523-20478545 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1079550298 11:21688198-21688220 GTTGTTTTCCTTGATGTGACAGG - Intergenic
1079874707 11:25842353-25842375 TTTGTTTTTCATAAAGGGCCAGG + Intergenic
1080333152 11:31165334-31165356 TTTTTTTTTCTTAAAGAGACAGG + Intronic
1080528264 11:33148867-33148889 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1080559565 11:33450554-33450576 GTTGTTGTTGTTTAAGAGACAGG - Intergenic
1080562348 11:33475548-33475570 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1081205656 11:40272231-40272253 TTTGTTTTTCTTAAGGCCAATGG - Intronic
1081568296 11:44273945-44273967 TTTATTTTTTTTAAAGAGACTGG - Intronic
1081924819 11:46816799-46816821 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1081944597 11:46979125-46979147 TTTCTTTTTTTTAAAGAGACAGG + Intronic
1083231804 11:61326325-61326347 GTTTTTTTTTTTAAAGAGATGGG + Intronic
1083391376 11:62353348-62353370 TTTTTTTTTTTTAAAGGGACAGG + Intronic
1083845805 11:65332762-65332784 GTTTTTTTTTTTTAAGAGACAGG + Intergenic
1083894944 11:65615260-65615282 GTCGTCTTTCTTAAAGTGACAGG - Intronic
1084325803 11:68399364-68399386 GTTTTTTTTTTTAAAGAGGCAGG - Intronic
1084633089 11:70368959-70368981 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1084645044 11:70451671-70451693 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1084990269 11:72916313-72916335 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1085001306 11:73038334-73038356 TTTTTTTTTCTTAAAGAGACAGG - Intronic
1085077100 11:73600932-73600954 TTTTTTTTTCTTATAGAGACAGG + Intergenic
1085285292 11:75355792-75355814 TTTTTTTTTATTAAAGAGACAGG - Intergenic
1085377016 11:76073402-76073424 GTTGATTTCCTTTAAGAGACAGG - Intronic
1085833208 11:79925126-79925148 GTTTTATTTCTTAAAGGGAGGGG + Intergenic
1085985622 11:81784334-81784356 AATTTTTTTCTTAAAGCAACTGG + Intergenic
1085994584 11:81895280-81895302 ATTCTTATTCTTAAAACGACAGG - Intergenic
1086485884 11:87301257-87301279 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1087448476 11:98286287-98286309 TTTGTTTTTCTTAAAAATACAGG + Intergenic
1087887797 11:103500012-103500034 ATTGTATTTCTTAAAGAGACAGG - Intergenic
1088445127 11:109918116-109918138 TTTATTTTTTTTAAAGCAACAGG - Intergenic
1089031604 11:115335925-115335947 ATTGTTTCTCTTAAAATGACAGG + Intronic
1089448681 11:118574759-118574781 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1090013707 11:123066605-123066627 CTTTTTTTTCTTTAAGAGACAGG - Intergenic
1090252255 11:125259880-125259902 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1090297799 11:125604928-125604950 TTTGTATTTCTTATAGTGACAGG - Intronic
1090362188 11:126181366-126181388 TTTTTTTTTTTTAAAGAGACTGG - Intergenic
1090695108 11:129232450-129232472 GTTGTTTTCCTTGAAATGACTGG - Intronic
1090928469 11:131273760-131273782 GCTGTTTTCCTTTAAGTGACAGG + Intergenic
1091610719 12:2005484-2005506 CTTGTTTTCCTGAAAGTGACAGG - Intronic
1091771579 12:3155586-3155608 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1092841964 12:12551189-12551211 CCGGTTTTTCTTAAAGTGACAGG - Intronic
1093448312 12:19286010-19286032 GTTGTTTTCCTTGAAGTGACAGG - Intronic
1093520012 12:20038446-20038468 ATTGTTTTTCTTGAAGTAACTGG + Intergenic
1094016056 12:25865871-25865893 TTTGTATTTTTTATAGCGACAGG - Intergenic
1094653853 12:32402135-32402157 TTTTTTTTTTTTAAAGAGACGGG + Intronic
1094712373 12:32977771-32977793 GTTGTGTTTTTTAAAGTAACAGG - Intergenic
1096055657 12:48649280-48649302 TTTGTTTTTTTTAAAGCGACAGG + Intergenic
1096059061 12:48681337-48681359 GTCGTTTTTCTTAAAGCGAGGGG - Intronic
1096107943 12:49009127-49009149 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1096174778 12:49506826-49506848 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1096290741 12:50340667-50340689 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1096404326 12:51332177-51332199 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1096577560 12:52563050-52563072 TTTTTTTTTCTTTAAGAGACAGG + Intergenic
1097255519 12:57670970-57670992 GTTGCTTTCCTTGAAGCGACAGG - Intergenic
1097669648 12:62520406-62520428 GTTGTTTACCCTAAAGTGACAGG + Intronic
1098107876 12:67089799-67089821 TTTTTTTTTTTTAAAGAGACTGG - Intergenic
1098543050 12:71681245-71681267 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1098946522 12:76595442-76595464 GTTGTTTTCCTTGAAGTGACGGG + Intergenic
1100395890 12:94186070-94186092 GATTTTTTTCTTAAAGACACAGG - Intronic
1101094716 12:101325765-101325787 GTTGTTTTCCTTGAAGTGGCAGG - Intronic
1101363666 12:104051124-104051146 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1101397490 12:104361217-104361239 TTTGATTTTCCTAAAGCCACTGG - Intergenic
1101791397 12:107930926-107930948 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1102364004 12:112315722-112315744 TTTGTTTTTTTAAAAGAGACAGG + Intronic
1102893692 12:116581597-116581619 TTTGTTTTTCTTGTAGAGACGGG + Intergenic
1103073246 12:117962137-117962159 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1103417223 12:120750845-120750867 TTTTTTTTTCTTTAAGCAACAGG + Intergenic
1103464864 12:121133893-121133915 ATTTTTTTTTTTAAAGAGACGGG + Intronic
1103753014 12:123179706-123179728 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1104061198 12:125270021-125270043 GTTTTTTTTTTTTAAGAGACAGG - Intronic
1105065776 12:133196013-133196035 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1105272272 13:18888669-18888691 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1105530723 13:21217524-21217546 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1105752448 13:23433756-23433778 TTTTTTCTTCTTAAAGAGACAGG + Intergenic
1106211711 13:27654539-27654561 GTTGTTTTCCTAGAAGTGACAGG + Intronic
1106228622 13:27803966-27803988 GTTGTTTTTCTTAAAGTAACAGG - Intergenic
1106285916 13:28317964-28317986 TTTGTTTTTTTTGAAGAGACGGG + Intronic
1106496462 13:30282630-30282652 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1106529602 13:30577332-30577354 TTTTTTTTTTTTAAAGAGACTGG - Intronic
1106736934 13:32597519-32597541 TTTCTTTTTTTTAAAGAGACAGG - Intronic
1107068136 13:36239229-36239251 TTTCTTTTTTTTAAAGAGACAGG - Intronic
1107469214 13:40676580-40676602 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1107503677 13:41008339-41008361 GTTGTTTTCCTTGAAGTGATGGG - Intronic
1107504205 13:41015106-41015128 GGTGTTTTTCCTAAAGCCCCAGG + Intronic
1107856507 13:44620776-44620798 TTTTTTTTTCTTATAGAGACAGG + Intergenic
1108318581 13:49263198-49263220 GTTGTTTATCTGAAAGTGACAGG - Intronic
1108499114 13:51052983-51053005 GTTATTTTCCTTGAAGTGACAGG - Intergenic
1108585881 13:51869451-51869473 GTTTTTTAACTTAAAGTGACTGG - Intergenic
1109356831 13:61240848-61240870 GTTGTTTTTCTTGAAGTGATGGG - Intergenic
1110637909 13:77787748-77787770 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1110716219 13:78707451-78707473 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1110798704 13:79670162-79670184 GTTGTTGTTTTTAAAGAGACAGG - Intergenic
1111415561 13:87939111-87939133 GTTAATTTTCTTAAAACAACTGG - Intergenic
1111434017 13:88183006-88183028 GTTTTTTTTCCTAAAGTGACTGG + Intergenic
1111476067 13:88749551-88749573 GTTCTTCTTCTTTAAGCCACTGG + Intergenic
1112378249 13:98864064-98864086 TTTGTTTATCTTAAATCCACTGG - Intronic
1112393480 13:99006917-99006939 TTTGTATTTCTTATAGAGACGGG - Intronic
1112561136 13:100515159-100515181 GATGTTTTTCTTAAAGATACAGG + Intronic
1112893452 13:104267810-104267832 GATGTTTTTCTTAAAGTGGCAGG - Intergenic
1113515350 13:110891721-110891743 GTTGATTTTTTTAAACCAACGGG + Intronic
1114309144 14:21450650-21450672 TTTGTTTTTTTTTAAGAGACAGG - Intronic
1114449017 14:22812629-22812651 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1115213595 14:30992555-30992577 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1115237286 14:31219885-31219907 TTTATTTTTCTTAAAGAGATGGG - Intergenic
1115386430 14:32803270-32803292 GTTTTTTTTTTTATAGAGACGGG - Intronic
1116079266 14:40153076-40153098 ATTGTTTTCCTTGAAGTGACAGG + Intergenic
1116716481 14:48432450-48432472 GTTGTTGTTTTTTAAGAGACAGG + Intergenic
1116887401 14:50234245-50234267 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1117361176 14:54975702-54975724 GCTTTTTTTTTTAAAGAGACGGG + Intronic
1118031796 14:61825326-61825348 GTTGTTTCACTTAAAGTCACAGG - Intergenic
1118167523 14:63352334-63352356 GTTATTTTCCTTGAAGTGACAGG + Intergenic
1118388634 14:65278199-65278221 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
1118649466 14:67874668-67874690 GTTGTTTTTTTTTAACCTACTGG + Intronic
1118649925 14:67880254-67880276 CTTGTTTTTCTTGAAGTGTCGGG + Intronic
1118832225 14:69444960-69444982 ATTATTTTTTTTAGAGCGACAGG - Intronic
1119076445 14:71644784-71644806 GTTGTTTTTCCTGAAGTAACAGG + Intronic
1119136488 14:72225634-72225656 TTTCTTTTTCCTAAAGCGAATGG - Intronic
1119284570 14:73442178-73442200 TTTTTTTTTCTTACAGAGACAGG - Intronic
1119296341 14:73536506-73536528 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1119344005 14:73906648-73906670 GTTGTATTTCTTGTAGAGACCGG + Intronic
1119538752 14:75424986-75425008 TTTGTTTTTCTAAAAAAGACAGG - Intergenic
1120191818 14:81446572-81446594 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1120930545 14:89843970-89843992 GTTGTTTTCCTTGAAATGACAGG + Intronic
1121572286 14:94955965-94955987 ATTGTTTTCCTTGAAGTGACAGG + Intergenic
1121764190 14:96471323-96471345 TTTTTTTTTTTTAAAGAGACGGG - Intronic
1121858264 14:97290517-97290539 CTTTTTTTTCTTAGAGAGACAGG - Intergenic
1122134225 14:99623583-99623605 TTTTTGTTTCTTAAAGAGACAGG + Intergenic
1122165094 14:99817143-99817165 GTTGTTTTTCCTGGAGTGACGGG + Intronic
1122529099 14:102412589-102412611 CTTGTTTTCCTTGAAGTGACAGG + Intronic
1122567523 14:102671397-102671419 TTTGTTTGTTTTAAAGAGACAGG + Intronic
1202871939 14_GL000225v1_random:172966-172988 GTTGTTGTTTTTAGAGAGACAGG - Intergenic
1123773052 15:23548487-23548509 GTTTTTGTTTTTAAAGAGACGGG + Intergenic
1123816119 15:23981100-23981122 GTTTTTTTTTTTAGAGAGACAGG + Intergenic
1124358212 15:29014712-29014734 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1124933782 15:34150420-34150442 TTTGTATTTCCTATAGCGACAGG - Intronic
1125155690 15:36582124-36582146 GTTGTTTTCCTTGAAATGACAGG + Intronic
1125557676 15:40599803-40599825 TTTTTTTTTTTTAAAGAGACGGG + Intronic
1125597526 15:40896505-40896527 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1125666555 15:41435378-41435400 GTTTTTTTTTTTATAGAGACTGG + Intronic
1125675671 15:41501449-41501471 GTGGTTTTTCTGAAAGCGACAGG - Exonic
1126009743 15:44291112-44291134 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1126507320 15:49420332-49420354 TTTGTTTTTGTTATAGCTACAGG - Intronic
1126742889 15:51796050-51796072 GTTGGTTTTCTTAAAATGTCTGG + Intronic
1127081895 15:55388756-55388778 TTTTTTTTTTTTAAAGGGACAGG - Intronic
1127427776 15:58873233-58873255 GTTTTTGTTTTTAAAGAGACGGG + Intronic
1127440157 15:58998664-58998686 TTTGTTTTTCTTGAAGTGAACGG - Intronic
1127673868 15:61221944-61221966 TTTTTTTTTCTTAAAGAGATGGG - Intronic
1127962196 15:63898246-63898268 TTTGTCTTTCTTTAAGAGACAGG + Intergenic
1128018501 15:64369353-64369375 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1128147362 15:65339384-65339406 TTTGTATTTCTTATAGAGACAGG + Intronic
1128398520 15:67253746-67253768 TTTTTTTTTTTTAAAGAGACGGG - Intronic
1128949756 15:71865237-71865259 GTTGTTTTCCTTGAAGTGACAGG + Intronic
1129547270 15:76409805-76409827 TTTGTTTTTCTTTTAGAGACAGG + Intronic
1129997570 15:80019957-80019979 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1130428624 15:83824048-83824070 CTTTTTTTTTTTAAAGAGACAGG + Intronic
1131031797 15:89192513-89192535 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1131185034 15:90266595-90266617 GTTTTGTTTTTTAAAGAGACGGG + Intronic
1132077734 15:98836511-98836533 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1132911090 16:2312211-2312233 GTTGTTTTCCTTAAAAAGACAGG + Intronic
1132935768 16:2480134-2480156 ATTGTTTTTTTTTAAGAGACTGG + Intronic
1132990201 16:2788387-2788409 CTTTTTTTTTTTAAAGAGACAGG + Intergenic
1133091726 16:3409850-3409872 TTTGTTATTCTTAAAGCTAATGG - Intronic
1133341618 16:5040217-5040239 TTTTTTTTTTTTAAAGAGACGGG - Intronic
1133954770 16:10432562-10432584 TTTTTTTTTCTTTAAGAGACAGG - Intronic
1134137607 16:11689092-11689114 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1134593839 16:15479099-15479121 GTTGTTTTCCTTGAAGTGACAGG - Intronic
1135007618 16:18841052-18841074 GTTTTGTTTTTTAAAGGGACAGG - Intronic
1135050098 16:19185595-19185617 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1135383614 16:22015254-22015276 TTTTTTTTTCTTTAAGAGACAGG + Intronic
1135515198 16:23126310-23126332 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1135544488 16:23356616-23356638 GTTTTTTTTTTTTAAGAGACAGG - Intronic
1135616176 16:23912994-23913016 GTTGTATTTTTTATAGAGACTGG + Intronic
1136051381 16:27652991-27653013 GTTTTTTTTCTTTTAGAGACAGG - Intronic
1136089056 16:27905328-27905350 TTTTTTTTTTTTAAAGCGACAGG + Intronic
1136124579 16:28168605-28168627 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1136236720 16:28918657-28918679 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1136458136 16:30394034-30394056 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1136531049 16:30869515-30869537 TTTTTTTTTTTTAAAGAGACGGG + Intronic
1137263968 16:46853549-46853571 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1137895414 16:52206472-52206494 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1137942018 16:52697443-52697465 GTTGTTTGTTTTAAAGCTAAAGG + Intergenic
1137985416 16:53103150-53103172 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1138090009 16:54166161-54166183 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1138446288 16:57066297-57066319 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1138928144 16:61617353-61617375 GTGGTTTTTCTTACAGTGGCAGG - Intergenic
1139670620 16:68490646-68490668 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1139759087 16:69169835-69169857 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1139809174 16:69598370-69598392 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1139829416 16:69784870-69784892 GTTGTTTTCCTTGAAGTGTCGGG - Intronic
1139833002 16:69815474-69815496 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1139903089 16:70343400-70343422 GTTGTTGTTGTTACAGAGACAGG - Intronic
1140957486 16:79878748-79878770 GTTGTTTTTTTTAAAGAGAGGGG - Intergenic
1140999285 16:80293070-80293092 ATTGTTTTCCTTAAAATGACAGG + Intergenic
1142166631 16:88593752-88593774 GTTGTTCTCCTTGAAGCCACAGG - Intronic
1142527473 17:554288-554310 GTTATTTTTCTTTGAGCGCCAGG - Intronic
1142908006 17:3060734-3060756 TCAGTTTTTCTTACAGCGACAGG + Intergenic
1142926558 17:3243532-3243554 TCAGTTTTTCTTACAGCGACAGG - Intergenic
1143035368 17:3992495-3992517 GTTGTATTTTTTATAGAGACAGG - Intergenic
1143040033 17:4027603-4027625 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1143066347 17:4251440-4251462 GTTTTTGTTTTTAAAGAGACAGG - Intronic
1143695995 17:8618918-8618940 GTTGTTTTCTTTGAAGTGACAGG + Intronic
1144251590 17:13422016-13422038 GTTGTTTTCCTTAAAGTGCCAGG - Intergenic
1145185470 17:20790313-20790335 GTTTGTTTTTTTAAAGAGACAGG - Intergenic
1145222818 17:21103364-21103386 GTTGTTTTTTTTTAAGACACAGG - Intergenic
1145859965 17:28201390-28201412 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1145988969 17:29066672-29066694 GCTGTTTTTGTTAAAGGGACTGG - Intergenic
1146021339 17:29281679-29281701 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1146119381 17:30177365-30177387 TTTTTTTTTTTTAAAGCGATGGG - Intronic
1146172207 17:30642894-30642916 TTTCTTTTTCTTTAAGAGACGGG - Intergenic
1146356427 17:32138454-32138476 GTTGTTGTTGTTTAAGAGACGGG + Intergenic
1146388448 17:32398706-32398728 GTTGTTTTTCTTGAAGTGACAGG + Intergenic
1146432205 17:32808359-32808381 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1146736074 17:35240511-35240533 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1146767367 17:35535490-35535512 TTTTTTTTTTTTAAAGCAACAGG + Intronic
1147407431 17:40222354-40222376 CTTGTTTTCCTTTAAGAGACAGG - Intronic
1148081862 17:44971213-44971235 GTTTTTGTTCTTAATGAGACAGG - Intergenic
1148535293 17:48433555-48433577 GTTGTTTGTCTTTAAGGGGCAGG - Intergenic
1148739684 17:49885675-49885697 GTTTTATTTCTTATAGAGACGGG + Intergenic
1149457894 17:56803262-56803284 ATTGTTTTTCTTGAGGTGACAGG - Intronic
1149783594 17:59417416-59417438 TTTGTATTTCTTATAGAGACAGG + Intergenic
1150058899 17:62047036-62047058 TTTTTTTTTTTTAAAGAGACGGG + Intronic
1150112369 17:62513326-62513348 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1150424053 17:65063051-65063073 GTTGTTGTTGTTTAAGAGACAGG + Intergenic
1150733260 17:67714109-67714131 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1150966406 17:69974295-69974317 GTGGTTTTTCCTAAAGCTACAGG - Intergenic
1151095053 17:71487564-71487586 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
1151294511 17:73174733-73174755 GTTGTTGTTTTTAAATCAACAGG - Intergenic
1151693123 17:75699495-75699517 TTTTTTTTTTTTAAAGAGACGGG - Intronic
1151854713 17:76712485-76712507 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1151854715 17:76712520-76712542 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1152492053 17:80642009-80642031 GTTGTTTTCCTTAATGTGACAGG - Intronic
1152668651 17:81587620-81587642 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1153166402 18:2266660-2266682 GTTTTTTTTTTTAAAGAGACAGG - Intergenic
1153225654 18:2897854-2897876 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1153302081 18:3599923-3599945 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1153568492 18:6444832-6444854 GTGGTTTTTCTTATAGCCAAAGG + Intergenic
1154322445 18:13366077-13366099 TTTATTTTTTTTAAAGAGACAGG + Intronic
1154474710 18:14745144-14745166 TTTGTTTTTGTTTAAGAGACAGG - Intronic
1155326049 18:24665900-24665922 GTTTTTTTTTTTTAAGAGACAGG - Intergenic
1156119936 18:33831092-33831114 ATTTTTTTTTTTAAAGCTACAGG - Intergenic
1156172055 18:34497177-34497199 GTTGTTTTTGATAAAGTGCCAGG + Intronic
1156222202 18:35063990-35064012 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1156286472 18:35701075-35701097 TTTTTTTTTCTTTAAGAGACAGG + Intronic
1157610521 18:48952228-48952250 TTTTTTTTTTTTAAAGCGACAGG - Intergenic
1157750696 18:50175497-50175519 TTTGTTTTTCTTAAAGAAATAGG - Intronic
1157843838 18:50983845-50983867 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1157875005 18:51264568-51264590 GTTATTTTCCTTGAAGTGACAGG - Intergenic
1158225140 18:55193024-55193046 TTTTTTTTTTTTAAAGCAACTGG + Intergenic
1158337159 18:56425657-56425679 GTTGTTTCCCTTGAAGTGACAGG + Intergenic
1158369645 18:56785835-56785857 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1158607726 18:58910882-58910904 GTTTTTTTTTTTTAAGAGACAGG + Intronic
1158993802 18:62896603-62896625 GTTGTTGTTTTTAAAGAGATGGG + Intronic
1159052825 18:63437414-63437436 ATTTTTTTTTTTAAAGAGACAGG + Intergenic
1161488158 19:4546963-4546985 TTTTTTTTTCTTTAAGAGACAGG + Intronic
1161577361 19:5061819-5061841 GTTTTTTTTTTTTAAGAGACAGG - Intronic
1162800685 19:13108925-13108947 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1162821834 19:13227917-13227939 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1162866582 19:13552377-13552399 TTTTTTTTTTTTAAAGAGACGGG + Intronic
1162880838 19:13658028-13658050 TTTATTTTTTTTAAAGAGACAGG - Intergenic
1162890147 19:13726888-13726910 ATTATTATTTTTAAAGCGACAGG - Intergenic
1163215006 19:15870071-15870093 CTTTTTTTTCTGAAAGCGATGGG - Intergenic
1163240524 19:16060197-16060219 TCTTTTTTTCTTAAAGAGACAGG - Intergenic
1163449424 19:17367218-17367240 TTTGTTTTTTTTAAAGAGATGGG + Intronic
1163766916 19:19168597-19168619 TTTGTTTTTCTTTTAGAGACAGG + Intronic
1163772737 19:19200481-19200503 GTTGTTTTTTTAGAAGAGACAGG + Intronic
1163776428 19:19220895-19220917 TTTGTTTTTCTAATAGAGACAGG - Intronic
1163853175 19:19678218-19678240 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1164069406 19:21752831-21752853 GTTTTTTTTCTTTAAGAGATGGG + Intronic
1164194784 19:22946693-22946715 GTTGTTATTCTTACTGCGAATGG - Intergenic
1164440839 19:28278575-28278597 GTTGTTTTACTTGGAGGGACAGG - Intergenic
1164654948 19:29913888-29913910 GTTGTTTCCCTTGAAGTGACAGG - Intergenic
1165016776 19:32886865-32886887 TTTTTTTTTCTTAAAGAGACAGG + Intronic
1165442302 19:35836261-35836283 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1165487830 19:36106004-36106026 TTTGTTTTATTTAAAGAGACGGG - Intergenic
1165558892 19:36661270-36661292 TTTTTTTTTTTTAAAGAGACTGG - Intronic
1165662742 19:37596306-37596328 TTTGTTTGTTTTAAAGAGACAGG + Intronic
1165696541 19:37905566-37905588 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1165784311 19:38452263-38452285 GTTATTTTTTTTATAGAGACAGG - Intronic
1166238393 19:41473084-41473106 ATTGTTCTTCATAAAGCGAAGGG - Intergenic
1166769924 19:45275477-45275499 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1166892982 19:46005693-46005715 GCTGTTTTTCTTGAAGTGACAGG + Intronic
1167028719 19:46941866-46941888 TTTTTTTTTTTTAAAGAGACAGG - Intronic
925848768 2:8059622-8059644 GGTGTTTTTATTAAAGGGTCAGG - Intergenic
925908391 2:8554013-8554035 GTTATTTTTCCTGAAGCCACAGG + Intergenic
925947171 2:8876204-8876226 GTTTATTTTCTTTAAGCCACTGG - Intronic
926880211 2:17537315-17537337 TTTGTTTTTCTGAGAGAGACAGG - Intergenic
927167260 2:20336520-20336542 TTTTTTTTTTTTAAAGAGACAGG + Intronic
927548265 2:23973968-23973990 GTTGTTTTCCTTGAAGTGCCAGG - Intronic
927581230 2:24250318-24250340 GCTGTTTTCCTTGAAGGGACAGG - Intronic
927643087 2:24858004-24858026 TTTTTTTTTTTTAAAGAGACAGG + Intronic
927753126 2:25687455-25687477 TTTTTTTTTTTTAAAGAGACTGG - Intergenic
927803599 2:26124303-26124325 TTTTTTTTTCTTATAGCTACAGG + Intronic
927814501 2:26202567-26202589 TTTGTTTTTCTTATAGAGACGGG - Intronic
928144737 2:28762974-28762996 GTTGTTTTCCTTGAAATGACAGG + Intronic
928150042 2:28818430-28818452 TTTTTTTTTTTTAAAGAGACAGG - Intronic
928316080 2:30247466-30247488 GTTATTTTCCTTGAAGTGACAGG + Intronic
928912666 2:36438692-36438714 GTGGTTTTTGTTAAAGCTACCGG - Intronic
928936570 2:36685101-36685123 TTTGTTTTTTTTCAAGCCACAGG - Intergenic
928971216 2:37031440-37031462 TTTTTTTTTTTTAAAGAGACAGG + Intronic
929292077 2:40204465-40204487 GTTGTTTTTCTTTCAGCTAAGGG - Intronic
929703485 2:44186544-44186566 GTTTTTTTTTTTATAGAGACAGG + Intronic
930009395 2:46924196-46924218 TTTTTTTTTTTTAAAGAGACAGG - Intronic
930179866 2:48343751-48343773 TTTTTTTTTTTTAAAGAGACAGG - Intronic
930210099 2:48627577-48627599 TTAGTTTTTCTTAAAGTGATGGG + Intronic
930569282 2:53064622-53064644 TGTGTTTTTCTTATAGAGACAGG - Intergenic
930639111 2:53837320-53837342 GTTTTTTTTTTTTAAGAGACGGG + Intergenic
930769928 2:55120703-55120725 GTTGTTATTATTAGAGCAACGGG + Intergenic
930791774 2:55339835-55339857 TTTCTTTTTTTTAAAGAGACGGG + Intronic
930793916 2:55367525-55367547 CTTGTTTTTTTTTAAGAGACTGG + Intronic
930796918 2:55403134-55403156 GTTGTTTTCCCTGAAGTGACAGG + Intronic
930819168 2:55628064-55628086 GTTGTTGTTCTTTTAGAGACTGG - Intergenic
931358391 2:61556766-61556788 GTTGCTTTTCTTTTAGAGACAGG - Intergenic
931410498 2:62025522-62025544 TTTGTTTTTTTTAAAGAGACAGG - Intronic
931432106 2:62216409-62216431 TTTGTTTTTTTTAAAGAGATAGG + Intronic
931589414 2:63865542-63865564 TTTTTTTTTTTTAAAGAGACAGG + Intronic
931678461 2:64721564-64721586 GTTATTTTTCTTCAAGTGATAGG - Intronic
931703399 2:64926782-64926804 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
932204634 2:69868226-69868248 TTTTTTTTTTTTAAAGAGACAGG - Intronic
932679471 2:73811710-73811732 GTTGTTTTTTTTTAAGCTATGGG + Intronic
932704897 2:74016295-74016317 TTTTTTTTTTTTAAAGAGACAGG - Intronic
933706236 2:85292747-85292769 TTTGTATTTCTTATAGAGACGGG + Intronic
933714286 2:85349059-85349081 TTTTTTTTTTTTAAAGAGACAGG + Intronic
935149413 2:100420238-100420260 TTTGTTTTTCTTGAAGTGACAGG - Intergenic
935466595 2:103405649-103405671 GTTGTTGTTTTTTAAGAGACAGG - Intergenic
935814730 2:106837081-106837103 GTTATTTTCCTAAAAGTGACAGG + Intronic
936015771 2:108957914-108957936 CTTGTTTATATTAAAGAGACAGG - Intronic
936651486 2:114432052-114432074 GTTGTTTTCCTTAAAGTGTTAGG + Intergenic
937118395 2:119425787-119425809 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
937636905 2:124166251-124166273 GTTGTTTTGTTTAAAACGAATGG + Intronic
937638120 2:124179767-124179789 GTTAATTTTGTTAAAGCTACAGG - Intronic
937938684 2:127267910-127267932 ATTTTTTTTCTTAAAGAGACTGG + Intronic
938048602 2:128146303-128146325 TTTGTTTTTTTTAACGGGACAGG - Intronic
938835342 2:135097221-135097243 TTTTTTTTTTTTAAAGAGACAGG + Intronic
938908061 2:135858184-135858206 GTTGTTGTTTTTTAAGAGACAGG - Intronic
938922649 2:136009162-136009184 GTTTTTTCTTTTAAAGAGACAGG - Intergenic
939314944 2:140536301-140536323 TTTTTTTTTTTTAAAGAGACGGG - Intronic
939612044 2:144323050-144323072 GTTGTTTTCCTTGAAGTGACAGG + Intronic
939614741 2:144349787-144349809 TTTGTTTTTCCTAAAGCCAGTGG + Intergenic
939826318 2:147019678-147019700 GTTGTTTTTCTTGAAATGGCAGG - Intergenic
940599385 2:155838570-155838592 GTTTATTTTCTTAAAGGGCCTGG + Intergenic
940607509 2:155945542-155945564 TTTATTTTTTTCAAAGCGACTGG - Intergenic
940901534 2:159130726-159130748 GTTTATTTTTTTAAAGAGACAGG + Intronic
941259553 2:163279642-163279664 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
941309112 2:163908312-163908334 GTTCTTTTCCTTAAAGTGACAGG - Intergenic
941403276 2:165058035-165058057 ATTGTTTTCCTTGAAGTGACAGG + Intergenic
941448664 2:165632501-165632523 GTTATTTTTTTTAAAGAGACAGG - Intronic
941737207 2:168991841-168991863 TTTTTTTTTTTTAAAGAGACGGG + Intronic
941972599 2:171368421-171368443 TTTGTTTTTCTTAATGTGATAGG - Intronic
942137115 2:172937213-172937235 TTTTTTTTTCTTTAAGAGACAGG - Intronic
943027630 2:182648692-182648714 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
943589388 2:189779170-189779192 TTTGTTTTTCTTACAGAGACAGG - Intronic
943716123 2:191154056-191154078 GTTGTTTTCCTTAAAGTGACAGG + Intergenic
944120376 2:196234283-196234305 TTTTTTTTTTTTAAAGAGACAGG + Intronic
944187497 2:196965685-196965707 GCTGTTTTCCTTGAAGTGACAGG + Intergenic
944343624 2:198634021-198634043 GTTTTTTTTCTTCAAGTAACAGG - Intergenic
944747720 2:202675218-202675240 GTTTTTTTTTTTTAAGAGACAGG - Intronic
944896150 2:204167218-204167240 GTTGTTTTCCTTTAAGTGAAAGG - Intergenic
944940111 2:204615626-204615648 GTTGTTATCCTTGAAGCGACAGG + Intronic
945092897 2:206192518-206192540 GTTGTTGTTGTTTAAGAGACAGG - Intronic
945985798 2:216352526-216352548 GTTGTTTTTTTAATAGAGACAGG + Intronic
946277253 2:218640938-218640960 TTTTTTTTTTTTAAAGAGACAGG + Intronic
946287532 2:218716216-218716238 GTTGGTTTCCTTGAAGTGACAGG + Intronic
946534614 2:220612781-220612803 GTTGTTTTTGGTCAAGCTACTGG + Intergenic
946838936 2:223800521-223800543 GATTTTTTTTTTAAAGAGACAGG - Intronic
947429778 2:230016976-230016998 CTTTTTTTTCTTTAAGAGACAGG - Intergenic
947512024 2:230764685-230764707 GTCGTTTTCCTTGAAGTGACAGG + Intronic
947579461 2:231304877-231304899 GTTGTTTTCCTTAAAGTGACAGG + Intronic
948044250 2:234930922-234930944 GTTGTGTTACTTAAAACGATGGG - Intergenic
948337868 2:237224750-237224772 ATTGTTTTCCTTGAAGTGACAGG + Intergenic
948452670 2:238086698-238086720 TTTTTTTTTTTTAAAGAGACAGG - Intronic
948561493 2:238856793-238856815 GTTGTTTTTCTGAGAACGGCAGG - Intronic
948748474 2:240112783-240112805 GTTGTGCTTCTTAAAGCCCCTGG + Intergenic
948862565 2:240760008-240760030 TTTTTTTTTCTTTAAGAGACAGG - Intronic
1169100135 20:2940325-2940347 TTTTTTTTTTTTAAAGAGACCGG + Intronic
1169390617 20:5187573-5187595 GTTGTTTTCTTTAAAGTGATAGG - Intronic
1169468177 20:5859796-5859818 GTTGTTTCTCTGAAGACGACTGG + Intronic
1172044770 20:32072553-32072575 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1172081786 20:32347236-32347258 GTTATTTTTTATAAAGAGACAGG + Intergenic
1172298728 20:33832782-33832804 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1172380705 20:34488179-34488201 GTTTTTTTTTTTAAAGCCAAAGG - Intronic
1172404096 20:34674934-34674956 TTTTTTTTTCTTCAAGAGACAGG - Intronic
1172547161 20:35771150-35771172 GTTGTATTTCTTGGAGAGACGGG + Intergenic
1172748408 20:37231704-37231726 TTTCTTTTTTTTAAAGAGACAGG - Intronic
1172858939 20:38032489-38032511 TTTGTTTTTCTTACTGCCACGGG - Intronic
1172979450 20:38929780-38929802 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1173423237 20:42921577-42921599 GTTGTTTTTATTTTAGAGACAGG - Intronic
1174254497 20:49244256-49244278 GTTGTTTTTTTTTAAGAGACAGG - Intronic
1174269632 20:49358310-49358332 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1174463110 20:50697124-50697146 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1175076699 20:56381094-56381116 TTTATTTTTTTTAAAGGGACAGG - Intronic
1175314473 20:58038005-58038027 TTTGTTTTTGTTAAAGGGAGGGG - Intergenic
1175864498 20:62167819-62167841 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1176312869 21:5163127-5163149 GTTGTTTTCTTTGAAGTGACAGG - Intergenic
1176726407 21:10438355-10438377 GTTGTTTTCCTTGAAGTGACAGG + Intergenic
1177014890 21:15774462-15774484 TTTGTTTTCCTTAAAGCAACAGG + Intronic
1177824596 21:26068369-26068391 TTTTTTTTTTTTAAAGAGACGGG + Intronic
1178448583 21:32669285-32669307 GTTGTTTTTCTTAAAGAGACAGG - Intronic
1178497637 21:33100950-33100972 GTTGTTGTTGTTATAGAGACAGG - Intergenic
1178563466 21:33661122-33661144 GTTGTTTTTCTTGCAGCATCAGG + Intronic
1178748448 21:35277062-35277084 GCTGTTTTTCTTGAAGTGACAGG + Intronic
1178936080 21:36862951-36862973 TTTTTTTTTTTTAAAGCGACGGG + Intronic
1179313743 21:40222066-40222088 GTTGTTTCCCTTGAAGTGACAGG - Intronic
1179844179 21:44098903-44098925 GTTGTTTTCTTTGAAGTGACAGG + Intronic
1180203012 21:46238400-46238422 ATTGTTTTTCTTGAAAAGACCGG - Intronic
1180286149 22:10746520-10746542 GTTGTTGTTTTTAGAGAGACAGG + Intergenic
1180287973 22:10768730-10768752 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
1180832729 22:18914155-18914177 GTTGCTTTTCTAAAAGCAACTGG + Intronic
1181659405 22:24332153-24332175 GTTGTTTTCCTTTAAGTGATAGG - Intronic
1181825130 22:25508842-25508864 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1181950952 22:26553375-26553397 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1181970364 22:26685202-26685224 TTTGTTTTTTTTTAAGAGACAGG - Intergenic
1182207407 22:28642965-28642987 TTTTTTTTTCCTAAAGAGACAGG + Intronic
1182220717 22:28756472-28756494 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1182542584 22:31052451-31052473 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1182642076 22:31776281-31776303 TTTGTATTTTTTATAGCGACAGG + Intronic
1182643444 22:31787804-31787826 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1183551939 22:38493356-38493378 TTTGTTTTTCTTTTAGAGACAGG + Intronic
1183853208 22:40609469-40609491 TTTTTTTTTGTTAAAGAGACAGG - Intronic
1184016874 22:41792908-41792930 TTTTTTTTTTTTAAAGCAACAGG - Intronic
1184214301 22:43056475-43056497 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1184635071 22:45821337-45821359 TTTTTTTTTTTTAAAGAGACGGG - Intronic
1203282814 22_KI270734v1_random:139460-139482 GTTGCTTTTCTAAAAGCAACTGG + Intergenic
949545114 3:5065997-5066019 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
950293305 3:11805441-11805463 TTTGTTATTTTTAAAGAGACAGG + Intronic
950779649 3:15380289-15380311 GTTGTTGTTGTTACAGAGACAGG - Intergenic
950803076 3:15570981-15571003 TTTGTTTTTCTTTTAGAGACAGG + Intronic
950889957 3:16395449-16395471 TTTTTTTTTTTTAAAGAGACAGG + Intronic
951119746 3:18911680-18911702 GTTGTTTTTCCTGAAGCCACAGG - Intergenic
951412698 3:22384168-22384190 GTTGTTTGTCTTAATGTGCCTGG - Intergenic
951553094 3:23895048-23895070 TTTGTTTTTTTTAAAGAGACAGG + Intronic
951560208 3:23958632-23958654 TTTTTTTTTTTTAAAGAGACAGG - Intronic
952280451 3:31918332-31918354 TTTTTTTTTTTTAAAGAGACAGG + Intronic
952305573 3:32143187-32143209 TTTTTTTTTTTTAAAGAGACAGG - Intronic
953115839 3:39991580-39991602 ATTGTTTATCTTAACGCAACAGG + Intronic
953991633 3:47488481-47488503 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
954128289 3:48545636-48545658 GTTTTTTTTTTTTAAGAGACAGG + Intronic
954723580 3:52587579-52587601 TTTTTTTTTTTTAAAGAGACTGG + Intronic
954728012 3:52632552-52632574 TTTCTTTTTGTTAAAGAGACAGG - Intronic
954802088 3:53193226-53193248 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
955809785 3:62775581-62775603 GTTGTTTTTCTTGAAGTAACAGG + Intronic
956161161 3:66354242-66354264 GTGGTTTTGCTTACAGCTACAGG + Intronic
956566006 3:70639472-70639494 TTTTTTTTTCTTATAGAGACAGG + Intergenic
956828425 3:73020662-73020684 TTTTTTTTTTTTAAAGAGACAGG - Intronic
956884974 3:73550075-73550097 GTTGTTTTACTTAAAAGCACAGG + Intronic
957195380 3:77060939-77060961 TTTTTTTTTTTTAAAGAGACAGG + Intronic
957487278 3:80878754-80878776 GGTTGTTTTCTTAAAGGGACTGG - Intergenic
959622894 3:108418062-108418084 GTTGCTTTCCTTGAAGTGACAGG + Intronic
960033191 3:113076160-113076182 GTTGTTTTAATTGAAGTGACAGG - Intergenic
960607446 3:119521685-119521707 TTTTTTTTTTTTAAAGAGACAGG - Intronic
960895427 3:122499749-122499771 TTTTTTTTTCTTGAAGAGACAGG - Intronic
960983452 3:123254191-123254213 TTTTTTTTTCTTAAAGAGACAGG + Intronic
961033203 3:123624317-123624339 TTTTTTTTTTTTAAAGAGACAGG - Intronic
961213083 3:125140723-125140745 CTTTTTTTTCTTAAAGAGGCAGG + Intronic
961322392 3:126084500-126084522 GTTGTTGTTTTTAAAGCAAAAGG - Intronic
961774246 3:129272578-129272600 ATTTTTTTTTTTAAAGAGACAGG + Intronic
962018827 3:131474775-131474797 TTTTTTTTTTTTAAAGAGACAGG + Intronic
962024265 3:131530568-131530590 GTTGTTTTTCTTGAAGTGACAGG - Intergenic
962150765 3:132890941-132890963 GTTGTTTTTCTTGAAGTAACAGG + Intergenic
962214556 3:133509894-133509916 TTTATTTTCCTTAAAGTGACAGG + Intergenic
963077416 3:141359923-141359945 GTTGTTTTTGTTTATGAGACAGG - Intronic
963241855 3:143011976-143011998 GTTGTTTTCCTTGAAGTAACAGG - Intronic
963417115 3:145010933-145010955 GTTGTTTTTTATAAAGTTACAGG - Intergenic
963510417 3:146240595-146240617 GTTGTTATTTTTCAAGAGACAGG - Intronic
964368772 3:155977009-155977031 GTTGTTTTCCTTGAAGTGATGGG + Intergenic
965593115 3:170381003-170381025 TTTTTTTTTTTTAAAGAGACTGG + Intronic
965851825 3:173036239-173036261 GTTGTGTTCCTTTAAGTGACAGG - Intronic
965859009 3:173124592-173124614 GTTGTTTTTCTTAAAAGAAAAGG - Intronic
966369113 3:179228076-179228098 GTTGTTTTCTTCAAAGAGACAGG - Intronic
966517246 3:180831429-180831451 GTTGTTTTTCTTGAAACGACAGG - Intronic
966528991 3:180952837-180952859 TTTTTTTTTTTTAAAGAGACAGG + Intronic
966683076 3:182663871-182663893 ATTATTATTCTTAAAGAGACAGG - Intergenic
966710290 3:182965652-182965674 GTTGTCTTTCTCAAAATGACTGG - Exonic
967085610 3:186092603-186092625 TTTTTTTTTTTTAAAGAGACGGG + Intronic
967472672 3:189880535-189880557 GTTGTTTTTCTAAAATTCACAGG + Intronic
968011616 3:195283623-195283645 GTTCTTTTTCTTTATGAGACAGG - Intronic
969143652 4:5101343-5101365 GTTGTTTCTCTGAAAGAGAGAGG + Intronic
969730395 4:8952924-8952946 GTTGTATTTCTAGAAGAGACTGG + Intergenic
971512595 4:27445630-27445652 GTTGTTCTACTTAAAGTGGCTGG - Intergenic
971774694 4:30947277-30947299 GTTTTTTTTCCCAAAACGACAGG - Intronic
972527530 4:39930262-39930284 GTTTTTTTTTTTTAAGAGACAGG + Intronic
972649033 4:40998071-40998093 GTTGTTTTCCTTGAAGTGACAGG - Intronic
973303546 4:48617352-48617374 TTTTTTTTTTTTAAAGAGACAGG + Intronic
973622309 4:52739662-52739684 TTTGTTTCTCATAAAGGGACAGG + Intronic
973665736 4:53156998-53157020 GTTGTTTTCCTTGAAGGAACAGG - Intronic
974800895 4:66816485-66816507 GTTGTTTTTCTTATAATGACAGG + Intergenic
974919576 4:68222225-68222247 TTTGTTTTTCTTGTAGAGACAGG - Intergenic
975123054 4:70750003-70750025 TTTTTTTTTTTTAAAGAGACAGG + Intronic
975136359 4:70878495-70878517 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
975198517 4:71555861-71555883 TTTGGTTTTTTTAAAGAGACAGG - Intronic
975338919 4:73215109-73215131 ATTGTTTTTCTTGAAATGACAGG - Intronic
975563611 4:75730818-75730840 TTTTTTTTTTTTAAAGAGACAGG + Intronic
975708776 4:77137822-77137844 GTTTTTTTCCTTGAAGTGACAGG - Intergenic
977655708 4:99518475-99518497 TTTTTTTTTTTTAAAGAGACAGG - Intronic
977713748 4:100157315-100157337 GTTGTTTTCCTTAAGGTAACAGG + Intergenic
977913075 4:102559930-102559952 TTTTTTTTTTTTAAAGGGACAGG - Intronic
977923917 4:102677233-102677255 GTTGTTTTTCTTGAAATGATAGG - Intronic
978106900 4:104913701-104913723 GTTGTTTGCCTTCAAGTGACAGG - Intergenic
980808571 4:137845513-137845535 GTTATTTTCCTTGAAGTGACAGG - Intergenic
981102160 4:140841072-140841094 TTTTTTTTTTTTAAAGCGACAGG - Intergenic
981510887 4:145556981-145557003 GATGTATTTCTTAAAACTACGGG + Intronic
982728483 4:158930378-158930400 TTTGTATTTCTTATAGAGACAGG + Intronic
983610905 4:169643902-169643924 GTTGTTTTACTTGAAAAGACAGG + Intronic
983913141 4:173262580-173262602 GTTGTTTTTGTTGAAGTGACAGG + Intronic
983970524 4:173866187-173866209 GTTTTTTTTTTTTAAGAGACAGG + Intergenic
984204797 4:176773686-176773708 GTTGTTGTTTTTTAAGAGACAGG + Intronic
984742427 4:183178571-183178593 TTTTTTTTTTTTAAAGAGACTGG - Intronic
985134387 4:186770747-186770769 GTTATTTTCCTTGAAGCAACAGG - Intergenic
986108413 5:4685094-4685116 GTTGTTTTCCTTGAAGTGTCAGG + Intergenic
986357129 5:6939755-6939777 GTTGTTTTTTTTGTAGAGACGGG + Intergenic
987691508 5:21272757-21272779 GTTATTTTTCTTTATGAGACAGG - Intergenic
988539288 5:32094870-32094892 TTTGTTTTTCTTTCAGAGACAGG - Intronic
988672956 5:33401625-33401647 GCTGTTTTTATTAAGGCTACAGG - Intergenic
990119484 5:52432447-52432469 GTTGCTTTCCTTGAAGTGACAGG + Intergenic
990337809 5:54792470-54792492 TTTGTATTTCTTGAAGAGACAGG + Intergenic
990412682 5:55556655-55556677 TTTTTTTTTCTTTAAGAGACAGG + Intergenic
991692489 5:69238456-69238478 GTTGTTCTTCTTGTAGAGACAGG + Intronic
991748871 5:69777380-69777402 GTTATTTTTCTTTATGAGACAGG + Intergenic
991800449 5:70357192-70357214 GTTATTTTTCTTTATGAGACAGG + Intergenic
991828151 5:70652849-70652871 GTTATTTTTCTTTATGAGACAGG - Intergenic
991892807 5:71356632-71356654 GTTATTTTTCTTTATGAGACAGG + Intergenic
992306746 5:75447779-75447801 TTTTTTTTTGTTAAAGAGACAGG + Intronic
992323553 5:75637808-75637830 CTTTTTTTTCTTATAGCGTCAGG + Intronic
992334140 5:75748059-75748081 GTTATTTTCCTTCAAGTGACTGG + Intergenic
992786079 5:80171873-80171895 GTCTTTTTTTTTAAAGAGACAGG - Intronic
993136373 5:83971281-83971303 TTTTTTTTTTTTAAAGAGACAGG + Intronic
993390172 5:87311243-87311265 GTTTTTTTCCTTGAAGTGACAGG - Intronic
993513660 5:88802450-88802472 GTTGTTGTTGTTAAACAGACAGG + Intronic
993702495 5:91135008-91135030 TTTGTTTTTCTTGTAGAGACGGG - Intronic
993992712 5:94679584-94679606 GTTTTTTTTTTTAAAGAGACAGG - Intronic
994144635 5:96380593-96380615 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
994563655 5:101411745-101411767 GTTGTGTTTCTTAAAGTATCAGG - Intergenic
995345412 5:111110173-111110195 GTTTTTTTTCTTAAAGGCAGTGG + Exonic
995493079 5:112712563-112712585 TTTTTTTTTTTTTAAGCGACCGG + Intronic
995958786 5:117813779-117813801 GTTGTTTTTCTTTAAACGGCAGG - Intergenic
996888724 5:128390801-128390823 GTTCCTTTTCTTAAAGTGACAGG - Intronic
997226931 5:132215840-132215862 TTTTTTTTTTTTAAAGGGACAGG - Intronic
997534781 5:134610888-134610910 TTTTTTTTTTTTAAAGAGACAGG + Intronic
997821612 5:137071026-137071048 TTTTTTTTTTTTAAAGAGACAGG + Intronic
998068750 5:139180048-139180070 TTTTTTTTTTTTAAAGAGACAGG - Intronic
998070164 5:139191609-139191631 TTTTTTTTTTTTAAAGAGACAGG - Intronic
998147298 5:139737213-139737235 GTTGTTTTCCTTGAAGTGACTGG + Intergenic
998156463 5:139789560-139789582 TTTGTTTTTCTTTTAGAGACAGG - Intergenic
998156778 5:139791412-139791434 TTTGTTTTTCTTTTAGAGACAGG - Intergenic
998234635 5:140387790-140387812 GGTGTTTTCCTTCAAGTGACAGG + Intergenic
998361257 5:141589920-141589942 TTTTTTTTTTTTAAAGAGACGGG + Intronic
998830026 5:146147392-146147414 TTTTTTTTTTTTAAAGAGACAGG - Intronic
998838203 5:146225131-146225153 TTTGTTGTTGTTAAAGAGACAGG + Intronic
999084563 5:148875725-148875747 GTGATTTTTCTTGAAGCGACAGG - Intergenic
999149835 5:149419571-149419593 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1000343031 5:160292054-160292076 GTTTTGTTTTTTAAAGAGACGGG - Intronic
1001090728 5:168738629-168738651 GTTGCTTTTTTTAAAGTGATGGG - Intronic
1001145262 5:169178232-169178254 GTGATTTTTCATTAAGCGACAGG - Intronic
1001582451 5:172808037-172808059 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1001735982 5:174001958-174001980 CTTTTTTTTTTTAAAGAGACAGG + Intronic
1002203319 5:177544507-177544529 GTTGTTTTCCTTGAAGTGACAGG - Intronic
1003321689 6:5057766-5057788 TTTTTTTTTCTTAAAGAGACAGG + Intergenic
1004065963 6:12244503-12244525 GTTATTTTCCTTGAAGTGACAGG + Intergenic
1004427408 6:15515741-15515763 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1004598632 6:17126087-17126109 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1004908911 6:20263587-20263609 TTTGTTTTTTTTAAATAGACGGG - Intergenic
1004978201 6:20991842-20991864 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1005060772 6:21775286-21775308 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1005591546 6:27333756-27333778 GTTGTTTTCCTTGAAGTGGCAGG - Intergenic
1005979564 6:30826503-30826525 TTTATTTTTCTTTAAGAGACTGG + Intergenic
1006616419 6:35330760-35330782 GTGGTTTTTCCTATAGCCACAGG + Intergenic
1006696751 6:35937466-35937488 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1007545881 6:42694197-42694219 TTTGGTTTTTTTAAAGAGACAGG + Intergenic
1007757881 6:44112300-44112322 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1008754889 6:54782692-54782714 GTTGTTTTTTTAATAGAGACAGG - Intergenic
1009785354 6:68330650-68330672 ATTGTTTTCATTAAAGCGAGAGG + Intergenic
1009937419 6:70250087-70250109 GTTGTATTTTTTATAGAGACAGG - Intronic
1010807432 6:80254692-80254714 GTTGTGTTTTTTTAAGAGACAGG - Intronic
1011481006 6:87793642-87793664 GTTGTTTTTCTTGAAGTGACAGG - Intergenic
1011673132 6:89703703-89703725 ATTGTTTTTCTTGAAGTGACAGG - Intronic
1011673749 6:89710495-89710517 TTTTTTTTTTTTAAAGGGACAGG - Intronic
1011716464 6:90110650-90110672 GTTGTTTTTCTTGAAGTATCAGG + Intronic
1012370195 6:98495538-98495560 GTTTTTTTTCTTAATGAGTCTGG - Intergenic
1012462891 6:99484014-99484036 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1012623788 6:101381198-101381220 TTTGTTTTTCTTTAAGTGAATGG + Intergenic
1012993581 6:105950268-105950290 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1013029913 6:106323275-106323297 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1013223529 6:108101687-108101709 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1013402156 6:109808727-109808749 ATTGTTTTTCTTGAAGTGACAGG - Intronic
1013574922 6:111473230-111473252 TTTTTTTTTTTTAAAGAGACGGG + Intronic
1013639884 6:112063672-112063694 GTTGTTTTCCTTGAAGTGACAGG + Intronic
1013814971 6:114086709-114086731 TTGTTTTTTCTTAAAGCTACAGG - Intronic
1013967229 6:115969530-115969552 GTTGTTTCTCTGAAAGCGTGTGG + Intronic
1014083757 6:117317615-117317637 GTTGTTTTCCTGAAAGGGAGAGG - Intronic
1014458229 6:121663821-121663843 TTTTTTTTTCTTAGAGAGACAGG - Intergenic
1015224894 6:130846031-130846053 ATTGTTTCTCTTGAGGCGACAGG - Intronic
1015262190 6:131250741-131250763 TGTGTGTTTCTTAAAGGGACTGG + Intronic
1015753516 6:136585116-136585138 TTTGTTTTTTTTTAAGAGACAGG + Intronic
1015992059 6:138955430-138955452 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1016006466 6:139093805-139093827 GTTGTTATTTTTATAGCCACAGG - Intergenic
1016280112 6:142407160-142407182 TTTTTTTTTTTTAAAGAGACGGG - Intronic
1016565717 6:145451048-145451070 GTTGCTTTTCTTGAAGTGAGAGG - Intergenic
1016722597 6:147319845-147319867 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1016967926 6:149735965-149735987 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1017393947 6:153974659-153974681 TTTGTTATTCTTAAAGAGCCAGG - Intergenic
1017409447 6:154152908-154152930 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1017420344 6:154266213-154266235 GTTTTTTTTCTTTTAGGGACAGG - Intronic
1017420879 6:154271347-154271369 TTTTTTTTTCTTTAAGAGACAGG - Intronic
1017466220 6:154696304-154696326 CTTTTTTTTCTTTAAGAGACAGG - Intergenic
1017622401 6:156312828-156312850 GTTGTTTTACTAGAAGTGACAGG + Intergenic
1017851719 6:158309980-158310002 GTTGTTTTCCTTAAAGTGGCAGG + Intronic
1018790951 6:167147266-167147288 GTTTTTGTTCTTAAAGCCAAGGG + Intronic
1018894940 6:168007771-168007793 GTGGTTTTTCTTGTAGCCACAGG + Intronic
1019923291 7:4176338-4176360 GTTGTTGTTTTTTAAGAGACGGG + Intronic
1019973683 7:4562928-4562950 GTTTTTTTTTTTTAAGCGATGGG + Intergenic
1020198001 7:6057233-6057255 TTTTTTTTTCTTAAAGAGATGGG - Intronic
1020204923 7:6106737-6106759 TTTTTTTTTCTTAAAGAGACAGG + Intronic
1020880422 7:13755370-13755392 TTTGTTTCTCTTAAAGAGATGGG + Intergenic
1021063368 7:16141998-16142020 GGTGGTTTTCTTAAAGAGAAAGG - Intronic
1021201664 7:17734554-17734576 ATTGTTTTTCTTATATCTACTGG - Intergenic
1022107821 7:27209472-27209494 TTTGTGTTTTTTAAAGAGACTGG - Intergenic
1022404416 7:30073978-30074000 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1023179478 7:37467707-37467729 TTTTTTTTTCTTAATGCGAGTGG - Intergenic
1023326307 7:39061765-39061787 GTTGTTTTCTTTGAAGTGACAGG + Intronic
1023577458 7:41643812-41643834 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
1023605409 7:41926805-41926827 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1024535606 7:50428763-50428785 GTTGTTCTGCTTGAAGTGACAGG + Intergenic
1024992176 7:55243799-55243821 GTTATTTTCTTTAAAGCAACAGG - Intronic
1025962875 7:66239157-66239179 CTTTTCTTTCTTAAAGAGACAGG + Intronic
1026180897 7:68039937-68039959 CTTTTTTTTCTTATAGAGACAGG + Intergenic
1026218672 7:68372549-68372571 GTTTTTCTTTTTAAAGAGACAGG + Intergenic
1026261134 7:68756433-68756455 CTTATTTTTTTTAAAGAGACAGG + Intergenic
1026510141 7:71020734-71020756 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1026632072 7:72046139-72046161 TTTGTATTTCTTATAGAGACAGG - Intronic
1026662921 7:72317743-72317765 GTTCTTTTTCTTAGAAAGACTGG - Intronic
1026855053 7:73747972-73747994 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1026934261 7:74243606-74243628 TTTTTTTTTCTTAAAGAGACAGG + Intronic
1026958018 7:74390080-74390102 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1027200580 7:76061632-76061654 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1027332607 7:77115191-77115213 TTTTTTTTTCTTTAAGAGACAGG - Intergenic
1028165608 7:87534907-87534929 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1029278434 7:99421419-99421441 TTTTTTTTTTTTAAAGAGACGGG - Intronic
1029427081 7:100502542-100502564 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1029513977 7:101014483-101014505 TTTTTTTTTCTTTAAGAGACAGG + Intronic
1029552004 7:101241652-101241674 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1030290675 7:107869425-107869447 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1030295025 7:107915731-107915753 AGTGTTTTGCTTAAAGAGACAGG - Intronic
1031876037 7:127141986-127142008 TTTGTTTTTTTTTAAGAGACCGG + Intronic
1031881005 7:127198672-127198694 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1031909828 7:127504195-127504217 GTTGTTTTCCTTGAAGTTACAGG - Intergenic
1031975106 7:128088758-128088780 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1032015557 7:128378344-128378366 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1032269505 7:130390923-130390945 ATTGTTTTTTTTATAGAGACTGG - Intergenic
1032370949 7:131351240-131351262 TTTGTTTTTTTAAAAGAGACAGG - Intronic
1032812122 7:135430637-135430659 TTGGTTTTTTTTAAAGCGATAGG - Intronic
1032820701 7:135521660-135521682 TGTATTTTTCTTAAAGAGACAGG - Intergenic
1033143140 7:138845835-138845857 GTTGTTTTTCTTGAAGTGACAGG + Intronic
1033167460 7:139052748-139052770 GTTGTATTTTTTATAGAGACAGG - Intronic
1033874357 7:145795926-145795948 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1034047033 7:147940293-147940315 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1034134232 7:148750974-148750996 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1034149385 7:148902045-148902067 TTTGTTTTTCTCATAGAGACAGG + Intergenic
1034259087 7:149743017-149743039 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1034524771 7:151651019-151651041 GTTGTTTTCCTTGCAGTGACAGG - Intronic
1034585144 7:152084370-152084392 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1034603698 7:152289613-152289635 GTTGTTTTCCTTGAAGTGACAGG - Intronic
1035012273 7:155729729-155729751 TTTTTTTTTGTTAAAGAGACAGG - Intronic
1036187831 8:6639655-6639677 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1036928829 8:12932681-12932703 GTTGTTTTCTTTGAAGCAACAGG - Intergenic
1036997416 8:13674969-13674991 ATTGTTTTTCTTAGAGCTACAGG + Intergenic
1037691888 8:21188181-21188203 TTTTTTTTTCTTAAGGCTACTGG + Intergenic
1037813505 8:22100070-22100092 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1037982173 8:23262078-23262100 GTTCTTTCTCTTAAGGCCACAGG + Intergenic
1038304212 8:26383899-26383921 TTTTTTTTTTTTAAAGCGATGGG + Intronic
1038793512 8:30690181-30690203 TTTATTTTTCTTTAAGAGACAGG + Intronic
1038802337 8:30760447-30760469 TTTTTTTTTTTTAAAGTGACAGG + Intronic
1038802503 8:30762067-30762089 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1039097593 8:33903444-33903466 TTATTTTTTCTTAAAGAGACAGG + Intergenic
1039099401 8:33924758-33924780 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1040457661 8:47615074-47615096 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1041686587 8:60650957-60650979 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1041764605 8:61405225-61405247 CTTGTTTTTCTTAAAGTAACTGG + Intronic
1042026038 8:64424853-64424875 GTTGTTTTCCTTATAGCAAGAGG + Intergenic
1042251482 8:66760283-66760305 GTTGTTTTCCTTGATGTGACAGG + Intronic
1042580378 8:70270700-70270722 GTTGTTATTGTTAAAGGGATAGG - Intronic
1042581955 8:70289828-70289850 TTTTTTTTTCTTTAAGAGACTGG + Intronic
1043389200 8:79775532-79775554 GTTGTTTCACTTAAAGAGAATGG + Intergenic
1043406224 8:79936863-79936885 GTTGTTTTTCTTTTTGAGACAGG + Intronic
1044680172 8:94769679-94769701 TTTCTTTTTCTTTAAGAGACGGG - Intronic
1045219139 8:100179968-100179990 GTTGTTTTTCTTAAAGCGACAGG - Intronic
1045460222 8:102418883-102418905 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1045590745 8:103593088-103593110 GTTGTCTTCCTTTAAGTGACAGG - Intronic
1045765831 8:105667137-105667159 ATTGTTTTCCTTGAAGCGATAGG - Intronic
1046052577 8:109041110-109041132 GATGTTTTTCTTTAAGAGAGAGG - Intergenic
1046734320 8:117760334-117760356 GTTGTTTTCCTTGAAGTGACAGG - Intergenic
1047000406 8:120567423-120567445 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1047246035 8:123145682-123145704 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1047535888 8:125719268-125719290 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1048310272 8:133316953-133316975 GTTTTTTTTTTTTAAGAGACAGG + Intergenic
1048361099 8:133697736-133697758 GTTGTGTGGCTTAAAGCAACAGG + Intergenic
1048569107 8:135636032-135636054 GTTGTTTTACTTAAAGTGACAGG + Intronic
1048663618 8:136635094-136635116 GTTGTTGTTCTTAAAAGGAATGG - Intergenic
1048799071 8:138179697-138179719 TTTGTTTTTCTTTTAGTGACAGG + Intronic
1049568121 8:143353408-143353430 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1049589910 8:143453258-143453280 GTTTTTTTTTTTAAAGAGATGGG + Intronic
1049613016 8:143564390-143564412 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1049978179 9:880056-880078 GTTGTTTTCCTTGAAGTGACAGG + Intronic
1050312172 9:4364768-4364790 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1051076049 9:13237669-13237691 GTTGTCTTCCTTGAAGTGACAGG - Intronic
1051264381 9:15296979-15297001 TTCTTTTTTCTTAAAGAGACAGG - Intronic
1051367744 9:16333188-16333210 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1051435794 9:17030039-17030061 GTTGTTTACCTTAAAATGACAGG + Intergenic
1051805258 9:20985465-20985487 GGTATTTTTCTTGAAGTGACAGG + Intronic
1052276320 9:26680687-26680709 GTTGTTTTTGTTTTAGAGACAGG + Intergenic
1053318019 9:37069084-37069106 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1055025523 9:71715650-71715672 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1055371926 9:75609072-75609094 GTTGTTTTCCTTGAAGGGACAGG - Intergenic
1055396402 9:75879732-75879754 ATTGTTTCTCATAAAGCTACTGG + Intergenic
1057386760 9:94611743-94611765 TTTCTTTTTCTTAAAGAGGCAGG - Intronic
1058314387 9:103546597-103546619 TGTGTTTTTTTTAAAGAGACAGG + Intergenic
1058336726 9:103838517-103838539 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1058904584 9:109471673-109471695 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1058917607 9:109582678-109582700 GTTGTTTTTCTTGAAATGACAGG - Intergenic
1059023620 9:110601773-110601795 GGTGTTTGTATTAAAGGGACTGG - Intergenic
1059209697 9:112501435-112501457 TTTGTTTTTTTTCAAGAGACAGG - Intronic
1060384771 9:123215070-123215092 TTTTTTTTTCTTAAAGAGATGGG + Intronic
1060489957 9:124076277-124076299 GTTGATTTCCTTAAAGTGACAGG + Intergenic
1060646455 9:125284481-125284503 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1060997156 9:127881067-127881089 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1061273494 9:129557256-129557278 GTTGTTTTTCTGGAAGGGAGCGG - Intergenic
1061285721 9:129621346-129621368 GTTGTTGTTGTTAAAGAGATGGG + Intronic
1061567235 9:131449363-131449385 CTTTTTTTTTTTAAAGAGACAGG + Intronic
1061620447 9:131808123-131808145 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1061689788 9:132317632-132317654 CTTTTTTTTTTTAAAGGGACAGG + Intronic
1061753886 9:132799329-132799351 GTTTTTTATCTTTAAGCCACTGG - Intronic
1061769619 9:132908456-132908478 GTTGTTTTTCTTTTTGAGACAGG + Intronic
1062657394 9:137611375-137611397 TTTGTTTTTCTTATAGAGACAGG - Intronic
1062727800 9:138086528-138086550 ATTTTTTTTCTTAAAGAGATGGG - Intronic
1203732505 Un_GL000216v2:103629-103651 GTTGTTGTTTTTAGAGAGACAGG + Intergenic
1185812599 X:3124637-3124659 GTTGTTTTTCTTATAGCCGTAGG + Intergenic
1186043308 X:5505327-5505349 GTTGTATTTTTTATAGAGACAGG + Intergenic
1186894623 X:13993450-13993472 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1186953450 X:14654117-14654139 GTTTTGTTTCTTTAAGAGACAGG - Intronic
1187040449 X:15589463-15589485 GTTTTTTTTTTTAAAGAGAAAGG + Intronic
1187504358 X:19866682-19866704 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1187553552 X:20329669-20329691 GTTGTTTTCCTTGAAGAGACAGG - Intergenic
1188150168 X:26664398-26664420 GTTGTTGTTTTTTAAGAGACAGG + Intergenic
1188364074 X:29292832-29292854 CTTTTTTTTTTTAAAGGGACTGG - Intronic
1188550653 X:31361085-31361107 GTTATTTTTTTTTAAGAGACAGG - Intronic
1189472992 X:41328659-41328681 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1189502933 X:41581372-41581394 GTTTTTTTTTTTTAAGAGACGGG - Intronic
1189942553 X:46140286-46140308 GTTGTTTTCCTTGAAGTGACAGG + Intergenic
1190069566 X:47268544-47268566 GTTTTTTTTTTTTAAGGGACGGG - Intergenic
1190139799 X:47832893-47832915 TTTTTTTTTTTTAAAGAGACAGG + Intergenic
1192355497 X:70399333-70399355 GCTGTTTTCCTTAAAGCAACAGG - Intronic
1192551500 X:72058209-72058231 GCTGTTTTCCTTGAAGCAACAGG - Intergenic
1192574585 X:72232929-72232951 GTTTTTTTTTTTAAAGAGATGGG - Intronic
1193084416 X:77436631-77436653 ATTGTTTCTCTTAATGTGACAGG - Intergenic
1193371564 X:80704230-80704252 GGTGTTTTTTTTAAAGAGATGGG - Intronic
1193466841 X:81858966-81858988 GTTCTTTATGTTAAAGAGACAGG + Intergenic
1194491703 X:94558489-94558511 GTTGTTTTTCTTAACAAGCCTGG - Intergenic
1194776739 X:97974351-97974373 GTTTTTTTTTTTAAAGCAATAGG - Intergenic
1194832362 X:98639408-98639430 GTTGTTTTGCTTGATGCTACAGG - Intergenic
1195616055 X:106912789-106912811 GTTGTTTTCCTTGAGGTGACAGG - Intronic
1195623511 X:106983715-106983737 TTTTTTTTTTTTAAAGAGACAGG + Intronic
1195747547 X:108134039-108134061 TTTTTTTTTCTTAAAAAGACTGG + Exonic
1196092298 X:111758376-111758398 GTTATTTATCCTAAAGTGACAGG - Intronic
1196148038 X:112341522-112341544 GTTGGTTTTATTAAATTGACTGG + Intergenic
1196933426 X:120704797-120704819 GTTGTTTTTCACAAAGCTTCTGG + Intergenic
1197197938 X:123722055-123722077 GTTGTTTTCCTTGAAGTGACAGG - Intronic
1197689990 X:129488600-129488622 TTTTTTTTTTTTAAAGAGACAGG - Intronic
1197851609 X:130867712-130867734 GTTGTTTTCCTTAAAGTCACAGG + Intronic
1198123402 X:133618314-133618336 GATTTTTTTCTTAAACCGTCTGG + Intronic
1198132674 X:133713709-133713731 GTTGTTTTCCTTGAAGTAACAGG - Intronic
1198426599 X:136527209-136527231 TTTCTTTTTCTTAAAGGGATAGG - Intergenic
1198679790 X:139169473-139169495 CTTGTATTTTTTAAAGAGACAGG + Intronic
1198741555 X:139848492-139848514 GTTTTTTTTTTTTAAGAGACAGG + Intronic
1198887516 X:141355413-141355435 TTTTTTTTTCTTAAAGGGACTGG + Intergenic
1199676345 X:150192947-150192969 GTTGTTTTCCTTGAAGTGACAGG + Intergenic
1199830190 X:151541831-151541853 GTTTTTTTTTTTTAAGAGACAGG + Intergenic
1200419252 Y:2946119-2946141 GTTTTTTTTTTTAAAGAGATGGG + Intronic
1201586532 Y:15567277-15567299 ATTTTTTTTTTTAAAGAGACAGG - Intergenic
1201898381 Y:19018905-19018927 TTTTTTTTTTTTAAAGAGACAGG - Intergenic
1202628443 Y:56883991-56884013 GTTGTTGTTTTTAGAGAGACAGG - Intergenic