ID: 1045222659

View in Genome Browser
Species Human (GRCh38)
Location 8:100213599-100213621
Sequence GGGAACATGCCGGCATTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222659_1045222666 8 Left 1045222659 8:100213599-100213621 CCTGGGAATGCCGGCATGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1045222666 8:100213630-100213652 ACGTTTGCCTCCGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1045222659_1045222670 20 Left 1045222659 8:100213599-100213621 CCTGGGAATGCCGGCATGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222659_1045222667 9 Left 1045222659 8:100213599-100213621 CCTGGGAATGCCGGCATGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1045222667 8:100213631-100213653 CGTTTGCCTCCGTCCCCGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 84
1045222659_1045222673 23 Left 1045222659 8:100213599-100213621 CCTGGGAATGCCGGCATGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1045222673 8:100213645-100213667 CCCGCCGGGTTTTCCCTTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222659 Original CRISPR GGGAACATGCCGGCATTCCC AGG (reversed) Intronic
902118393 1:14140840-14140862 GGGAAGATGCCCTCATTCTCTGG + Intergenic
902781953 1:18710800-18710822 GGGGACATCCTGGCATTACCAGG + Intronic
904377504 1:30090880-30090902 TGCAACATGTCTGCATTCCCAGG + Intergenic
905923307 1:41733148-41733170 GGGAAGATGCCAGCAGTCCCTGG - Intronic
908700142 1:66890173-66890195 TGGTACATGCCTGTATTCCCAGG + Intronic
911317864 1:96376543-96376565 GGGAAAAAGCCGGCAGTCACAGG - Intergenic
914677048 1:149913532-149913554 GGGAATATCAGGGCATTCCCCGG - Exonic
920845584 1:209590598-209590620 GAGAACAGGCCGTCATTCCATGG + Intronic
922333755 1:224601378-224601400 GGCAAAATGGCGGCATTCACTGG - Intronic
922472735 1:225886924-225886946 GGGCACCTGCCGGCAGCCCCCGG - Exonic
1063167122 10:3473663-3473685 GTGGATATGCCGGCATCCCCTGG + Intergenic
1064266790 10:13831826-13831848 GGGAACACCCAGGCATTCACCGG + Intronic
1064464865 10:15568902-15568924 GGGAACTTGCAGGGATTCTCAGG + Intronic
1065036330 10:21642522-21642544 TGGCACATGCCGGTAATCCCAGG + Intronic
1065721078 10:28629300-28629322 AGGAAGAGGCGGGCATTCCCAGG - Intergenic
1065988443 10:30981370-30981392 GGAAACATGACAGCATTTCCTGG + Intronic
1079607402 11:22387193-22387215 GGAAACACGCCACCATTCCCAGG - Intergenic
1081732270 11:45379952-45379974 GGGAACATTCTGGAGTTCCCAGG - Intergenic
1083120662 11:60509734-60509756 CGGCACATGCCTGCAATCCCAGG - Intergenic
1088665291 11:112087669-112087691 GGGAACATGCAGATGTTCCCTGG + Intronic
1093643496 12:21555356-21555378 GGATACATTCCTGCATTCCCAGG + Intronic
1095039309 12:37423846-37423868 GGGCACATGCCTGTAGTCCCAGG - Intergenic
1096035834 12:48469313-48469335 GGGAAAACGAAGGCATTCCCAGG - Intergenic
1097228352 12:57492985-57493007 GGTAAGATGCTGGCATTCCAGGG - Intronic
1099890020 12:88579701-88579723 GGGAACCTGCCCGCCTGCCCGGG - Intronic
1102210789 12:111125444-111125466 TGGCACATGCCTGCAATCCCAGG - Intronic
1102902679 12:116650677-116650699 GGGAAGCTACCGGCATTCACAGG - Intergenic
1105380273 13:19880694-19880716 GGGCTCATGCCTGCAATCCCAGG - Intergenic
1112271622 13:97975356-97975378 TGGAACATGCCTGTAATCCCAGG + Intronic
1113589122 13:111485982-111486004 CGGAGCCTGCCGGCATTCGCTGG + Intergenic
1113912567 13:113850449-113850471 GGGAAGAAGCTGGGATTCCCAGG + Intronic
1117753138 14:58944552-58944574 GGGAGCATGCAGGCAGTCCTTGG + Intergenic
1121055045 14:90845489-90845511 GGAAACATGCCGTTGTTCCCAGG - Intergenic
1121240968 14:92429896-92429918 GGGAACATGCAGCCAGCCCCAGG - Intronic
1127669878 15:61185087-61185109 TGGAACATGCAGGCGTTACCTGG + Intronic
1133451009 16:5904053-5904075 GGGAACATGCTGGCCTTTTCGGG - Intergenic
1135559082 16:23461382-23461404 AGGCACATGCCACCATTCCCAGG + Intergenic
1137764578 16:50968005-50968027 GGGAACCTCCTGGCATTCCCTGG - Intergenic
1142522134 17:512486-512508 GGGAAGATGCCGGCGATCCATGG - Exonic
1143517978 17:7429560-7429582 GTGGACATGCCGGCGTTCCCAGG + Intergenic
1146940667 17:36842365-36842387 TGGCACATGCAGGCATTCCCTGG + Intergenic
1147804609 17:43121548-43121570 TGGCACATGCCTGCAATCCCAGG + Intronic
1150917207 17:69448977-69448999 GGGCAAAGGCCGGCACTCCCGGG + Intronic
1151939766 17:77285247-77285269 TGGAACTTGCCGTCATTCCCAGG + Intronic
1152630603 17:81409181-81409203 GGGGACATGGCAGCATCCCCTGG + Intronic
1153704202 18:7728502-7728524 GGGCACATGTGGGCATGCCCAGG + Intronic
1154472961 18:14722661-14722683 TGGAACCTGCCTGCATTCCCAGG + Intergenic
1155280634 18:24236002-24236024 AGGGACCTGCCTGCATTCCCTGG - Intronic
1166766600 19:45254810-45254832 TGGAACATGGAGTCATTCCCTGG + Intronic
925203299 2:1986414-1986436 GGGAAAATCCTGGGATTCCCTGG + Intronic
925216751 2:2103116-2103138 GGAAACATGCAGGCTTTCTCTGG - Intronic
925324469 2:3007167-3007189 AGGAACATGCCGCCATTACATGG - Intergenic
925754067 2:7116984-7117006 AGGAACCTGCTCGCATTCCCTGG - Intergenic
925841008 2:7992052-7992074 TAGAACATGCAGGCATTACCAGG - Intergenic
926387434 2:12350975-12350997 GGAAGTATGCCGGCATTGCCTGG + Intergenic
927568598 2:24137684-24137706 GGCAACATGCCTGCTCTCCCTGG - Intronic
928625515 2:33135729-33135751 GGCAACATGACAGCATTCCGTGG - Intronic
931346122 2:61448338-61448360 TGGCACATGCCTGCAGTCCCAGG + Intronic
933598567 2:84306631-84306653 GGGAAAATGAATGCATTCCCAGG - Intergenic
934576765 2:95406884-95406906 GGGAACAGGTGGGCAATCCCGGG - Intronic
934638984 2:96015052-96015074 GGGAACAGGTGGGCAATCCCGGG - Intergenic
934794664 2:97090360-97090382 GGGAACAGGTGGGCAATCCCGGG + Intronic
936080994 2:109432429-109432451 GGGGACCGGCCGGCATTCCTGGG - Intronic
936275266 2:111090680-111090702 GCTAACTGGCCGGCATTCCCAGG - Intronic
941995184 2:171595453-171595475 TGGACCATGCTGGCATTCACTGG - Intergenic
947883472 2:233543110-233543132 GGGAACATGTCAAAATTCCCCGG + Intronic
1170063721 20:12287897-12287919 GGGAACATCAGGGCATTTCCTGG - Intergenic
1171571061 20:26251879-26251901 GGGCACATGCCTGTAGTCCCAGG - Intergenic
1172859765 20:38039080-38039102 GGGAACATTACTGAATTCCCTGG - Intronic
1173279257 20:41613544-41613566 GGCAGCATTCAGGCATTCCCTGG - Intronic
1176140349 20:63542165-63542187 GGGAACCTGCAGGCCTTCCTGGG - Exonic
1176801523 21:13435188-13435210 TGGAACCTGCCTGCATTCCCAGG - Intergenic
1180573235 22:16748892-16748914 GGGCACATGCCTGTAGTCCCAGG - Intergenic
1182041544 22:27242171-27242193 GGGGACATGCAGCCTTTCCCAGG - Intergenic
1182754148 22:32665128-32665150 TGGAACATGCCTGTAGTCCCAGG - Intronic
1185371558 22:50463214-50463236 GGGAACAGGCGGGCAGACCCTGG - Intronic
949981433 3:9504237-9504259 GGCAACATGCCTGTAATCCCAGG + Intronic
953062154 3:39435921-39435943 TGGCTCATGCCTGCATTCCCAGG + Intergenic
953948712 3:47171041-47171063 AGGCACATGCCAGCATGCCCGGG - Intergenic
953984856 3:47433733-47433755 GGCAACATGCCTGTAGTCCCAGG + Intronic
954031236 3:47821396-47821418 TGGCACATGCCTGTATTCCCCGG - Intronic
954248413 3:49349740-49349762 GGGATCATGGGGGCTTTCCCAGG + Intergenic
954728730 3:52639115-52639137 TGGCACATGCCTGCAATCCCAGG - Intronic
956484746 3:69710595-69710617 TGGAACATGCAAGCATTCCCTGG + Intergenic
960967759 3:123116832-123116854 GGGAGAATGCCTGCATTCCCAGG - Intronic
968211016 3:196848846-196848868 GGGCACATGCCACCATGCCCAGG - Intergenic
968859777 4:3158114-3158136 TGGCACATGCCGGTAGTCCCAGG - Intronic
969396058 4:6922184-6922206 TGGCACATGCCTGCAGTCCCAGG - Intronic
981774527 4:148350125-148350147 GGAGATATGCCGGAATTCCCTGG - Intronic
981926380 4:150144717-150144739 TGGCACATGCCTGCAGTCCCAGG - Intronic
982707493 4:158725864-158725886 AGGCACATGCCGCCATGCCCAGG + Intergenic
983176652 4:164596501-164596523 GGGAACAACCCAGGATTCCCAGG + Intergenic
983765824 4:171482071-171482093 GGGAATCTGCCAGGATTCCCAGG - Intergenic
985919958 5:2962699-2962721 GTGCACATGCTGGCATGCCCAGG + Intergenic
985928089 5:3033564-3033586 AGCAGCATGCCGGCATCCCCAGG - Intergenic
989007417 5:36830245-36830267 TGGCACATGCCTGCAGTCCCAGG - Intergenic
989189988 5:38661238-38661260 GGGAAAATGCCTGGCTTCCCAGG + Intergenic
991298578 5:65105684-65105706 AGGAAGATGCCGGCAGTCCCGGG - Intergenic
991670845 5:69046046-69046068 TGGCACATGCCTGCAATCCCAGG + Intergenic
994107096 5:95960851-95960873 GGGGACACACCTGCATTCCCAGG - Intronic
995456119 5:112353904-112353926 GAGAACAGGCCTGCATTACCTGG - Intronic
997123380 5:131199666-131199688 GGGAAAATGTCTGCATTTCCAGG - Exonic
1003883512 6:10499750-10499772 GGGCTCATGCCGGTAATCCCAGG - Intronic
1004008804 6:11661429-11661451 AGGCACATGCCACCATTCCCAGG + Intergenic
1004092778 6:12521702-12521724 TGGATCATGCCGGTAATCCCAGG - Intergenic
1004101616 6:12617878-12617900 TGGCACATGCCTGCAGTCCCAGG + Intergenic
1004358937 6:14954023-14954045 TGGAACATGTGGGCATTCCCTGG + Intergenic
1004406690 6:15339452-15339474 GAGAAGATGCAGGTATTCCCAGG + Intronic
1005233506 6:23733456-23733478 AGGAACATGCCACCATGCCCGGG + Intergenic
1013807487 6:114011536-114011558 GGGAACATGATGGCATTTACGGG - Intergenic
1015763644 6:136692183-136692205 GGGAACATGCCACCACACCCAGG + Intronic
1015843724 6:137497192-137497214 GGGACCAGGCCGGGACTCCCTGG + Intergenic
1017030083 6:150213503-150213525 GGGGACACCCGGGCATTCCCTGG - Intronic
1017409443 6:154152867-154152889 TGGAACATGCCTGTAGTCCCAGG - Intronic
1019525637 7:1479274-1479296 GGGGACCTGCCGCCACTCCCTGG + Intronic
1026632079 7:72046178-72046200 GGGTACATGCCGACAGTCACAGG + Intronic
1029113119 7:98223464-98223486 GGGAGCCTGCGGGCATTTCCTGG + Intronic
1038407574 8:27333526-27333548 TGGAGCATGCAGGCATCCCCTGG + Intronic
1038643874 8:29348220-29348242 GGGAACATCCCGGCCAGCCCCGG + Intronic
1040312072 8:46241969-46241991 GGGAGGCTGCCAGCATTCCCTGG - Intergenic
1040467918 8:47712431-47712453 GGGAACAGGCCACCCTTCCCTGG - Intronic
1043437965 8:80252765-80252787 GAGAATATGACTGCATTCCCAGG - Intergenic
1045222659 8:100213599-100213621 GGGAACATGCCGGCATTCCCAGG - Intronic
1046780197 8:118206462-118206484 TGGACCATGCCTGTATTCCCAGG - Intronic
1046861318 8:119094722-119094744 GGGAATATGGGGGCATTTCCTGG - Intronic
1050677935 9:8077721-8077743 GGGAACCTGAAAGCATTCCCAGG - Intergenic
1055986226 9:82058480-82058502 GGGAACATGCAGGCTTCCCAGGG - Intergenic
1056528942 9:87469964-87469986 GGGCACATGCATTCATTCCCAGG + Intergenic
1056559993 9:87721794-87721816 GGGAACCTGCTGACCTTCCCTGG - Intergenic
1060518828 9:124282526-124282548 GGGAGCCTGCCCTCATTCCCAGG + Intronic
1061400553 9:130365945-130365967 GGGGACACCCCGGCATTCGCAGG - Intronic
1062558035 9:137125237-137125259 TGGAACATGCCTGTAATCCCAGG + Intergenic
1185720314 X:2375946-2375968 AGGAGCATCCCAGCATTCCCCGG + Intronic
1186692392 X:11992476-11992498 GGTGAGATGCCTGCATTCCCTGG + Intergenic
1187460552 X:19483123-19483145 TGGCACATGCCTGTATTCCCAGG + Intronic
1188882037 X:35501081-35501103 AGGCACATGCCGTCATGCCCAGG - Intergenic
1190923874 X:54883659-54883681 AGGCACATGCCGCCATGCCCAGG - Intergenic
1198395008 X:136211871-136211893 GGGAACATGCAGGGATGCCGTGG + Intergenic
1201500819 Y:14640745-14640767 GGGAAAATGCCTTCCTTCCCTGG + Intronic