ID: 1045222659

View in Genome Browser
Species Human (GRCh38)
Location 8:100213599-100213621
Sequence GGGAACATGCCGGCATTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222659_1045222670 20 Left 1045222659 8:100213599-100213621 CCTGGGAATGCCGGCATGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222659_1045222666 8 Left 1045222659 8:100213599-100213621 CCTGGGAATGCCGGCATGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1045222666 8:100213630-100213652 ACGTTTGCCTCCGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1045222659_1045222667 9 Left 1045222659 8:100213599-100213621 CCTGGGAATGCCGGCATGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1045222667 8:100213631-100213653 CGTTTGCCTCCGTCCCCGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 84
1045222659_1045222673 23 Left 1045222659 8:100213599-100213621 CCTGGGAATGCCGGCATGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1045222673 8:100213645-100213667 CCCGCCGGGTTTTCCCTTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222659 Original CRISPR GGGAACATGCCGGCATTCCC AGG (reversed) Intronic