ID: 1045222662

View in Genome Browser
Species Human (GRCh38)
Location 8:100213609-100213631
Sequence GTGCCTGGCCGGGAACATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222662_1045222666 -2 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222666 8:100213630-100213652 ACGTTTGCCTCCGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1045222662_1045222673 13 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222673 8:100213645-100213667 CCCGCCGGGTTTTCCCTTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 47
1045222662_1045222676 22 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222676 8:100213654-100213676 TTTTCCCTTGGTGGCTGTTGCGG 0: 1
1: 0
2: 3
3: 25
4: 258
1045222662_1045222667 -1 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222667 8:100213631-100213653 CGTTTGCCTCCGTCCCCGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 84
1045222662_1045222670 10 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222662_1045222677 23 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222677 8:100213655-100213677 TTTCCCTTGGTGGCTGTTGCGGG 0: 1
1: 0
2: 8
3: 17
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222662 Original CRISPR GTGCCTGGCCGGGAACATGC CGG (reversed) Intronic
900130509 1:1085280-1085302 CTGCCTGGCAGGGACCCTGCGGG + Intronic
900290880 1:1923127-1923149 GGGCCTGGCCGGGAGCTGGCTGG + Intronic
902552509 1:17227723-17227745 GTGCATGGGAGGGAACATTCTGG - Intronic
902637602 1:17744817-17744839 GTGCCAGGCAGGGAGCAGGCGGG + Intergenic
904260659 1:29285828-29285850 CTGCCTGGTGGGGAACATGGTGG - Intronic
905335814 1:37243880-37243902 GTGTCTTGCCGGGCACATGATGG - Intergenic
911246862 1:95527698-95527720 GGGGCTGGCAGGGAACCTGCTGG - Intergenic
912568437 1:110605592-110605614 GTGCCTGGCCAGGGGCATGCGGG + Exonic
913217506 1:116632742-116632764 GAGCCTGGCCTGGAGCATGAGGG + Intronic
915732690 1:158065480-158065502 GTGCCTGCCCAGGAAAAGGCAGG + Intronic
918877953 1:190074273-190074295 ATGGCTGGCCAGGCACATGCAGG + Intergenic
920693132 1:208161953-208161975 GTGCCTGGCAGGGTAGGTGCTGG + Intronic
1067027883 10:42859492-42859514 GTTACTGGACTGGAACATGCGGG + Intergenic
1067192419 10:44082483-44082505 GTGCCTGGCTGGGACCAGGGTGG + Intergenic
1070146976 10:73781788-73781810 GTACGGGGCCGGGGACATGCAGG - Intergenic
1070539724 10:77407382-77407404 TAGCCTTGCTGGGAACATGCAGG + Intronic
1076832963 10:133006207-133006229 GGGCCTGGCTGGGAACAAGGGGG - Intergenic
1079407670 11:20160121-20160143 CTGCCTGGGCGGCGACATGCTGG + Exonic
1081584761 11:44376718-44376740 GAGCATGGCCAGGAACAAGCAGG - Intergenic
1083849329 11:65355844-65355866 GTCCCTGGCCGAGAAGATCCAGG + Exonic
1084443578 11:69190273-69190295 ATGCCTGCCCTGGAACAGGCCGG - Intergenic
1090649462 11:128793582-128793604 GTGCCTGGCCTGGAGCCTTCTGG - Intronic
1091319499 11:134639891-134639913 GTGCCTGGCAGGGTAGAGGCGGG + Intergenic
1099539079 12:83883091-83883113 GTGCCTGAAGGGGAACATGAGGG + Intergenic
1101829225 12:108244131-108244153 GTGCCTGGCGGGGCACAGGCTGG - Intronic
1102710150 12:114918813-114918835 GTGCTTGGCAGGGATCATACTGG + Intergenic
1105000660 12:132687866-132687888 GCGCCGGGCCGGGACCAGGCTGG + Intronic
1105678862 13:22705343-22705365 GAGCTGGGCCGGGGACATGCAGG + Intergenic
1106431841 13:29688154-29688176 TTGCCTGCCAGGGAAGATGCTGG + Intergenic
1113296730 13:108967553-108967575 GTGCTTGGCCCGGACCCTGCGGG + Intronic
1116869346 14:50056741-50056763 GTGCCGGGACGGGAACACGCAGG - Intergenic
1117275236 14:54187245-54187267 GTGACTGGCTGGGACCATGGGGG + Intergenic
1118347958 14:64953403-64953425 GTGCAGGGCCGGGTACATGCGGG + Intronic
1122783033 14:104151679-104151701 CCGCCTGGCCGGGGACACGCAGG - Intronic
1122999221 14:105283286-105283308 GTGCCTGGCCCGGGGCAGGCGGG + Intronic
1123125955 14:105946121-105946143 GTGCCAGGCAGGGAACAAGGAGG - Intergenic
1125383139 15:39108835-39108857 GTGACTGGCCCAGAACAAGCAGG + Intergenic
1132384010 15:101387141-101387163 GTGCCTGGCAGGGAAAGTCCTGG - Intronic
1132686791 16:1165613-1165635 GTGCCTGGCGGGGAAAAGGGAGG - Intronic
1132864299 16:2085974-2085996 GTGCCTGGCCGGCAAAATCAGGG - Intronic
1132886713 16:2185393-2185415 GTGCCTGCTCGGGAACCTGTGGG + Exonic
1134977936 16:18585739-18585761 TTGCCTGGCCAGGATCCTGCAGG + Intergenic
1137341119 16:47606737-47606759 GGGCCTGGAAGAGAACATGCAGG - Intronic
1139901651 16:70333089-70333111 GGGCCTGGCAGTGAACATGGTGG + Exonic
1139906741 16:70371493-70371515 GGGCCTGGCAGTGAACATGGTGG + Exonic
1141608182 16:85167457-85167479 CTGCCCGGCTGGGGACATGCAGG - Intergenic
1143184128 17:5000368-5000390 GGGCCTGGCTGGGCACAGGCAGG + Intronic
1143595090 17:7909295-7909317 GTCGCTGGCGGGGAACAAGCCGG + Exonic
1143646396 17:8232937-8232959 GTGCTTGGCCAGGAGCAGGCAGG + Exonic
1144650254 17:17002776-17002798 GTGCTTGGCTGGGGAGATGCAGG + Intergenic
1145413772 17:22695543-22695565 GTGACTGGCTGGGGACCTGCTGG - Intergenic
1145722008 17:27082521-27082543 CTGCCTGGCCGGGGAGGTGCCGG - Intergenic
1150686345 17:67324126-67324148 GGGCCTGGCCTGAAGCATGCTGG - Intergenic
1151478686 17:74357502-74357524 GTTCCTGGCCTGGAACCTGTCGG - Exonic
1151700574 17:75740589-75740611 GTGCCTGGCAGGGGGCATCCTGG + Intronic
1152401969 17:80071786-80071808 GTGCCTGGCAGGAAATCTGCAGG + Intronic
1152407462 17:80105793-80105815 GTGCCCGGCTGTGGACATGCGGG - Intergenic
1152701085 17:81820031-81820053 CGGCCTGGCCAGGCACATGCTGG - Intergenic
1152785897 17:82247946-82247968 CTGGCTAGCCAGGAACATGCCGG - Intronic
1160782934 19:885775-885797 GTTCCTGGCCCGGGACATGTCGG - Exonic
1161206060 19:3042027-3042049 GGGCCTGTCGGGGAACACGCTGG - Intronic
1161513636 19:4684859-4684881 GGGCCTGGCAGGGGAGATGCCGG + Intronic
1161687874 19:5712322-5712344 CAGCCTGGCCGGGCACAGGCTGG + Intronic
1162971139 19:14182289-14182311 GTGCCTGGCAGGGTCCATGCTGG + Intronic
1163184749 19:15629507-15629529 GGGCCTGGCTGGGAAGAGGCGGG + Exonic
1163295046 19:16406361-16406383 GTGCCAGGAAGGGAAGATGCTGG + Intronic
1163368415 19:16888918-16888940 GTGCCAGGCCAGCAAGATGCAGG - Exonic
1163581763 19:18143724-18143746 GTGCCTGGCAGGGGTGATGCAGG + Intronic
1166839441 19:45687724-45687746 GTGCCTGGTGGGGAACAGGGAGG + Exonic
1166988838 19:46678418-46678440 GGGGCTGGCCGGGTACATGAAGG + Exonic
925901046 2:8509782-8509804 GTGCCTGGCTGGGGACATACAGG + Intergenic
925906969 2:8545437-8545459 GTGCCTGGCCTAGACCAGGCAGG + Intergenic
926337050 2:11871652-11871674 GTGCCTGGCCAAGAAGATCCAGG + Intergenic
933833038 2:86225786-86225808 GTGCCTGGCCTGCAGCCTGCTGG - Intronic
935143799 2:100379880-100379902 GTACCTGGCTGGGAACACCCTGG - Intergenic
935237753 2:101152211-101152233 GTGGCTGGCCTGGAGCAGGCTGG + Intronic
946865565 2:224038973-224038995 GCGCCCGGCCGGGAAGCTGCGGG - Intronic
948097123 2:235344070-235344092 GTGCCTGTGCGAGAACGTGCAGG - Intergenic
948479223 2:238239868-238239890 GCGCCTGGCCGGGACCGTGTGGG - Exonic
948623668 2:239252895-239252917 GTTCCTGGCGGAGAACAGGCTGG - Intronic
1169195718 20:3681153-3681175 GTGCCTGGCCGGGAACAGGGAGG - Intronic
1171820359 20:29830988-29831010 GAGCGTGGCAGGGAACATGCTGG + Intergenic
1172767590 20:37359014-37359036 GTTCCTGGCCTGGGCCATGCTGG + Intronic
1174482447 20:50841237-50841259 GGGCCTGGCAGGAAACAAGCAGG - Intronic
1175242964 20:57563194-57563216 GTGGCTGGCAGAGCACATGCTGG + Exonic
1175258797 20:57662512-57662534 TCTCCTGGCCAGGAACATGCGGG - Intronic
1175763898 20:61579993-61580015 GTGACTGGCGGGGAAGGTGCTGG - Intronic
1176164997 20:63668121-63668143 GTGTGGGGCCGGGCACATGCTGG - Intronic
1178952438 21:36996129-36996151 GTTCCAGGCCGGGAGCATGGTGG + Intergenic
1179889570 21:44328742-44328764 GTGCCGGGAGGGGAACAGGCAGG + Intergenic
1182517002 22:30864680-30864702 GGGCCTGGCAGGGGACAGGCCGG - Intronic
1183544796 22:38449722-38449744 GTGGCTGGCTGGAAACAGGCTGG - Intronic
1184032540 22:41903436-41903458 GTGCCTCCCCAGGCACATGCTGG + Intronic
1184234438 22:43175396-43175418 TTTGCTGGCCAGGAACATGCTGG - Intronic
1184260521 22:43312758-43312780 GTGCCAGGCCAGGCACAGGCAGG - Intronic
1184260523 22:43312765-43312787 GTGCCTGGCCTGGCACGTGCTGG + Intronic
961176193 3:124837070-124837092 GAGCTTGGCTGGGTACATGCTGG - Intronic
967949551 3:194830272-194830294 GTGCCTGGCAGGCAACATGCAGG - Intergenic
968647568 4:1748219-1748241 GTGCCTGGCAGGGAACGCTCGGG - Intergenic
972374888 4:38460694-38460716 ATCCCTGGCCAGGAACAGGCAGG - Intergenic
972782472 4:42297957-42297979 GAGACTGTCCAGGAACATGCTGG + Intergenic
975272090 4:72447895-72447917 GTGCCTGGCAGGGAGAATGTTGG - Intronic
998477312 5:142432679-142432701 GGGCCTGCCCAGGAACAGGCAGG - Intergenic
998506575 5:142677324-142677346 GTGCAAGGGCTGGAACATGCTGG + Intronic
1001506322 5:172283543-172283565 GGGCCTGGCCGGGAACAATGGGG + Intronic
1006582044 6:35082853-35082875 GTGCCTGGCCGAGAAGGAGCAGG - Intronic
1009537533 6:64908299-64908321 TTGCCTTGGCGGGAACATGGTGG + Intronic
1017705722 6:157120916-157120938 GTGCGTGGCCAGGCCCATGCAGG - Intronic
1018164009 6:161076818-161076840 GTGCCAGGCAGGCACCATGCGGG + Intronic
1022991652 7:35714582-35714604 GAGCCAGGCTGGGAACCTGCTGG + Intergenic
1023083254 7:36545278-36545300 GGGTGTGGCCTGGAACATGCTGG + Intronic
1024366761 7:48529044-48529066 GTGCTTGGTTGGGAACATTCAGG + Intronic
1026363375 7:69623522-69623544 GTGCCTGGCCTGGAACATTAGGG + Intronic
1027378460 7:77578043-77578065 GTGCCAGGCTGGCTACATGCAGG - Intronic
1029707275 7:102282618-102282640 GGGCCTGGCCTGGAACATAAAGG - Intronic
1033978737 7:147136555-147136577 GTGTGTGGCTGGGAGCATGCTGG + Intronic
1034421794 7:150994615-150994637 GTGCCAGGCCGGGGGCAGGCTGG + Intronic
1035443896 7:158926473-158926495 GGCCCAGGCCGGGCACATGCGGG + Intronic
1035644690 8:1210151-1210173 GAGCCTGGCCTGGAACCTGGGGG - Intergenic
1045222662 8:100213609-100213631 GTGCCTGGCCGGGAACATGCCGG - Intronic
1048997351 8:139802164-139802186 GTGCCAGGCGGGGAGCAAGCAGG + Intronic
1049182739 8:141231309-141231331 GTGCCTGGGCTGGGACACGCAGG + Intronic
1049286994 8:141781169-141781191 GAGCCTGGCAAGGGACATGCTGG - Intergenic
1049782178 8:144434118-144434140 GCGCCTGGCAGGGAACCGGCTGG - Exonic
1049782652 8:144435924-144435946 GTGCCTGGCCGGGGACTGGCTGG - Exonic
1052335461 9:27315055-27315077 CTGGCTGGCCTTGAACATGCTGG - Intergenic
1052986288 9:34490530-34490552 GTGCCTGGCAGGGAAGAAGCAGG + Intronic
1053750049 9:41243977-41243999 GAGTGTGGCAGGGAACATGCTGG - Intergenic
1054255545 9:62808315-62808337 GAGTGTGGCAGGGAACATGCTGG - Intergenic
1057499662 9:95586467-95586489 CTGCCTGCCAGGGAACATGCAGG - Intergenic
1060810117 9:126606958-126606980 GTGCCTGGGAGGGAACATGAAGG + Intergenic
1062070642 9:134553428-134553450 GCGCCAGGCCTGGCACATGCTGG - Intergenic
1062084321 9:134641161-134641183 GTGCTTGGACGGGAACATCTGGG - Intergenic
1203372019 Un_KI270442v1:316264-316286 GAGTGTGGCAGGGAACATGCTGG + Intergenic
1203375702 Un_KI270442v1:374783-374805 GAGTGTGGCAGGGAACATGCTGG + Intergenic
1186760502 X:12717624-12717646 GTGAGTGGCCAAGAACATGCGGG - Exonic
1188495545 X:30779741-30779763 TTGCCTGGAGGGGAACATGGCGG - Intergenic
1189864257 X:45307870-45307892 GTGACTGGCAGGGAAAATGAGGG + Intergenic
1194206819 X:91019882-91019904 GGGCCAGGCAGGGAACATGGAGG - Intergenic
1197199936 X:123739881-123739903 GTGCCTGGCTGAGAATAAGCAGG + Intergenic
1200073523 X:153540357-153540379 GTTCCTGGTGGGGAACAGGCGGG - Intronic
1200552570 Y:4594671-4594693 GGGCCAGGCAGGGAACATGGAGG - Intergenic