ID: 1045222662

View in Genome Browser
Species Human (GRCh38)
Location 8:100213609-100213631
Sequence GTGCCTGGCCGGGAACATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222662_1045222677 23 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222677 8:100213655-100213677 TTTCCCTTGGTGGCTGTTGCGGG 0: 1
1: 0
2: 8
3: 17
4: 193
1045222662_1045222666 -2 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222666 8:100213630-100213652 ACGTTTGCCTCCGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1045222662_1045222667 -1 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222667 8:100213631-100213653 CGTTTGCCTCCGTCCCCGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 84
1045222662_1045222676 22 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222676 8:100213654-100213676 TTTTCCCTTGGTGGCTGTTGCGG 0: 1
1: 0
2: 3
3: 25
4: 258
1045222662_1045222673 13 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222673 8:100213645-100213667 CCCGCCGGGTTTTCCCTTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 47
1045222662_1045222670 10 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222662 Original CRISPR GTGCCTGGCCGGGAACATGC CGG (reversed) Intronic