ID: 1045222663

View in Genome Browser
Species Human (GRCh38)
Location 8:100213619-100213641
Sequence GGAGGCAAACGTGCCTGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222663_1045222677 13 Left 1045222663 8:100213619-100213641 CCCGGCCAGGCACGTTTGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1045222677 8:100213655-100213677 TTTCCCTTGGTGGCTGTTGCGGG 0: 1
1: 0
2: 8
3: 17
4: 193
1045222663_1045222673 3 Left 1045222663 8:100213619-100213641 CCCGGCCAGGCACGTTTGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1045222673 8:100213645-100213667 CCCGCCGGGTTTTCCCTTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 47
1045222663_1045222670 0 Left 1045222663 8:100213619-100213641 CCCGGCCAGGCACGTTTGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222663_1045222680 27 Left 1045222663 8:100213619-100213641 CCCGGCCAGGCACGTTTGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50
1045222663_1045222676 12 Left 1045222663 8:100213619-100213641 CCCGGCCAGGCACGTTTGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1045222676 8:100213654-100213676 TTTTCCCTTGGTGGCTGTTGCGG 0: 1
1: 0
2: 3
3: 25
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222663 Original CRISPR GGAGGCAAACGTGCCTGGCC GGG (reversed) Intronic
901853710 1:12031230-12031252 GGAGTTAAAAGTGCCTGACCTGG - Intronic
903233984 1:21937604-21937626 GGAGGCGAGAGCGCCTGGCCCGG - Intergenic
903896553 1:26609620-26609642 TGAGCCACAAGTGCCTGGCCTGG + Intergenic
903910023 1:26716906-26716928 TGAGCCAACTGTGCCTGGCCAGG + Intronic
904300664 1:29551343-29551365 GGAGGCAAATGTCCCTGGAAGGG - Intergenic
905396953 1:37672836-37672858 GGAGGCTCACGTTGCTGGCCTGG + Intergenic
905861323 1:41353934-41353956 GGCGGCACACGTGGCTGGCCTGG + Intergenic
906989393 1:50721904-50721926 GGAAGCCACTGTGCCTGGCCAGG + Intronic
907350180 1:53823057-53823079 GGAGGCAAACCTACCCTGCCAGG + Intronic
914703384 1:150152584-150152606 TGAGCCAACCGTGCCTGGCCAGG + Intronic
915602279 1:156929770-156929792 GGAGGGAAGAGTGCCGGGCCGGG + Intronic
918127276 1:181595665-181595687 AGAGGCATCCGTGGCTGGCCAGG + Intronic
1063994950 10:11611105-11611127 CGAGGGAGACGCGCCTGGCCGGG + Intronic
1065202473 10:23327542-23327564 GTGAGCCAACGTGCCTGGCCAGG - Intronic
1065709863 10:28505488-28505510 TGATGCAACCGTGCTTGGCCAGG - Intergenic
1067090196 10:43262508-43262530 TGTGGCAGAGGTGCCTGGCCTGG - Intronic
1067153002 10:43751880-43751902 GGAGGCACCCGTGGCTGGCAGGG - Intergenic
1067895148 10:50170927-50170949 TGAGGAAAACTTCCCTGGCCTGG + Intergenic
1069865899 10:71502644-71502666 AGAGGGAAATGTGCATGGCCAGG + Intronic
1071383537 10:85096908-85096930 GGAGACAAACGTTCCTGGGCCGG - Intergenic
1074342861 10:112651589-112651611 GTAAGCCACCGTGCCTGGCCTGG + Intronic
1074594180 10:114845047-114845069 GGAGGCCAACGTGCGTGGGTGGG - Intronic
1076527913 10:131123974-131123996 GGAGGAAAAGATGCCTGACCAGG + Intronic
1077266496 11:1653308-1653330 AGAGGCAGGCGAGCCTGGCCTGG + Intergenic
1077458377 11:2694574-2694596 GGAGGCACACTTTCCTGGCCTGG + Intronic
1077552571 11:3207585-3207607 GGAGGAAAGCTTGCATGGCCAGG + Intergenic
1078411804 11:11128325-11128347 TGAGGAAAACTTCCCTGGCCTGG - Intergenic
1079109252 11:17595103-17595125 GGAAGCAGTCGTGCATGGCCTGG + Intronic
1082814680 11:57500051-57500073 GGAGGGGAAGGTTCCTGGCCGGG - Intronic
1084169609 11:67394386-67394408 TGAAGCAAACGTCCCTGGCGAGG + Intronic
1087040964 11:93799456-93799478 GTGGGCCACCGTGCCTGGCCAGG + Intronic
1090010198 11:123039326-123039348 GTAAGCCACCGTGCCTGGCCTGG - Intergenic
1091626456 12:2124686-2124708 GGAGGCAAGCTTGCCTGGACGGG + Intronic
1095964642 12:47858611-47858633 GGGAGCAAAGGTGCCTGGCACGG + Intronic
1101210877 12:102534261-102534283 GGAGGCATGTATGCCTGGCCAGG - Intergenic
1102112890 12:110378374-110378396 GTAAGCCACCGTGCCTGGCCTGG + Intronic
1102378994 12:112447276-112447298 GGAGGGAAACGGGCCTGGGCAGG - Intronic
1102576206 12:113857686-113857708 GGAGACAAAGGTGGCTGGCGAGG + Intronic
1104121104 12:125800843-125800865 GTGGGCCACCGTGCCTGGCCTGG + Intergenic
1113759046 13:112834991-112835013 GGAGGCAAAGGGGCCTGGAGAGG - Intronic
1114032728 14:18589956-18589978 GTGAGCCAACGTGCCTGGCCTGG - Intergenic
1120277889 14:82400357-82400379 GGAGGTAAACGAGCCTGGTGGGG + Intergenic
1121054051 14:90838644-90838666 GGAGGAAAATGTCCCTGTCCTGG + Intergenic
1121221389 14:92288225-92288247 GGAGGCAAGCTGGCCTGCCCTGG - Intergenic
1121268025 14:92617014-92617036 GTGGGCCACCGTGCCTGGCCAGG - Intronic
1121352452 14:93184593-93184615 GGCGGCCAAGGTGCCTGGCCGGG + Exonic
1121637562 14:95464009-95464031 GGAAGCAGCAGTGCCTGGCCTGG + Intronic
1122517576 14:102319634-102319656 GAAGGCGACCGTGTCTGGCCGGG - Intronic
1123006679 14:105327184-105327206 GGAGGCCGGCGTGCCTGACCTGG + Intronic
1125383915 15:39115784-39115806 GTAGGCAACCCTGCCTGGTCTGG + Intergenic
1127306138 15:57707133-57707155 GCAGGCATACGTGCCTGGCCAGG - Intronic
1132363444 15:101237250-101237272 AGAGGCAAATGTGCAAGGCCTGG + Intronic
1134428235 16:14174398-14174420 GTAAGCCAACGTGCCTGGCCAGG - Intronic
1134731929 16:16469962-16469984 GTGGGCCACCGTGCCTGGCCAGG + Intergenic
1134935515 16:18242043-18242065 GCGGGCCACCGTGCCTGGCCAGG - Intergenic
1136427477 16:30178731-30178753 TGAGGAAAACGCACCTGGCCAGG + Intergenic
1139336391 16:66234699-66234721 ACAGGCAACCATGCCTGGCCTGG - Intergenic
1139491576 16:67288772-67288794 GCAGGCATTCATGCCTGGCCTGG + Intronic
1142503700 17:349244-349266 GGAGGGAAACTCGCCTGGGCAGG + Intronic
1142805532 17:2369363-2369385 CGAGTGAAAGGTGCCTGGCCTGG - Intronic
1142849756 17:2698676-2698698 GGAGGCAACCGGGCCTGCCTTGG + Intronic
1142960252 17:3548074-3548096 GGAGGCCACAGTCCCTGGCCAGG - Intronic
1143033171 17:3979294-3979316 GGTAGCAAAAGTGCCAGGCCCGG + Intergenic
1144064329 17:11611161-11611183 AGCGGCAGACGTGCCTGTCCTGG + Intronic
1144495055 17:15740802-15740824 GGAGGCCACTGTGCCAGGCCTGG - Intronic
1144574391 17:16419908-16419930 GGAGGAAAAGGGGCCTGTCCAGG - Intronic
1145210825 17:21011721-21011743 GCAGGCCACCGGGCCTGGCCTGG - Intronic
1151596696 17:75082318-75082340 CGAGGCAAACCCGCCTGGCTTGG - Intergenic
1152944524 17:83191791-83191813 GGGGGCAATCCTGCGTGGCCAGG + Intergenic
1153314600 18:3709713-3709735 GGGGGAAATCGTGCCTGCCCTGG - Intronic
1153961482 18:10143667-10143689 GGAGGCAGAGGTGCCTTCCCTGG + Intergenic
1157606054 18:48926583-48926605 GGAGGCGGCCGTGCCTGCCCAGG - Intronic
1158634874 18:59147822-59147844 GGAGGAAAAGCTGCCAGGCCTGG + Intronic
1160376273 18:78414976-78414998 AGAGCAAGACGTGCCTGGCCAGG + Intergenic
1161744117 19:6044611-6044633 AGAGGCAAAGCTGCCTGGGCGGG - Intronic
1162635518 19:11964636-11964658 TGATGCAGTCGTGCCTGGCCTGG + Intronic
1163718608 19:18886875-18886897 GGAGACAACAGTGCCTGGACTGG - Intronic
1163861625 19:19746008-19746030 GGAGGCCACCGTGCCAGGCTTGG - Intergenic
1166125445 19:40713059-40713081 GGAAGCCACTGTGCCTGGCCTGG - Intronic
1166569306 19:43783618-43783640 GTAAGCCACCGTGCCTGGCCAGG + Intergenic
925051891 2:821862-821884 GGAGACAAACCAGCGTGGCCAGG + Intergenic
925809707 2:7687105-7687127 GGAGGAAATGGTGGCTGGCCAGG - Intergenic
930168646 2:48229298-48229320 GGAGGCAAACTGGCCAGGCGTGG - Intergenic
931136127 2:59403223-59403245 TGAGGAAAACTTCCCTGGCCTGG + Intergenic
933667076 2:84971904-84971926 GGAGGCAAAAGAGCCGGCCCGGG + Intronic
934639349 2:96018054-96018076 GTGAGCCAACGTGCCTGGCCAGG - Intergenic
934818091 2:97347873-97347895 GGAGGCAGACGAGCAGGGCCAGG + Intergenic
934819605 2:97360612-97360634 GGAGGCAGACGAGCAGGGCCAGG - Intergenic
937283023 2:120733379-120733401 GGAGGCAAACTGGTGTGGCCAGG - Intergenic
942072678 2:172329732-172329754 GGGGCCAAAGTTGCCTGGCCGGG + Intergenic
948188632 2:236041726-236041748 GGAGTCAAACGTGCATGGCGTGG + Intronic
948671838 2:239573977-239573999 GGAACCAAACAAGCCTGGCCTGG - Intergenic
948776466 2:240291423-240291445 GGAGGCAACAGTGCGTGGCAGGG + Intergenic
949027340 2:241772761-241772783 GGGGGCCAACGCGCCGGGCCAGG - Intergenic
949048825 2:241886082-241886104 GGAGGACAACGTGGCTGGCATGG - Intergenic
1169595377 20:7192520-7192542 GAAGGCAGACCTGCCAGGCCAGG - Intergenic
1172331911 20:34081296-34081318 GGAGGAGTACGTGCCAGGCCTGG - Intronic
1174383525 20:50172514-50172536 GGAGGCACAGGGGCCTGTCCCGG - Intergenic
1175374585 20:58515403-58515425 GGAGGAAAACCCGCCTGGTCGGG - Intergenic
1175479814 20:59302763-59302785 GGTGGCAAAGGTGCCTTTCCAGG - Intronic
1175748574 20:61478882-61478904 GCAGGCAAACCTGCATGGCCAGG - Intronic
1176064284 20:63186795-63186817 GGAGGAGGACCTGCCTGGCCTGG - Intergenic
1177579039 21:22995223-22995245 TGAGGAAAATGTTCCTGGCCTGG - Intergenic
1178309111 21:31515010-31515032 GTAGGCAGACGGGCCTTGCCTGG + Intronic
1178609314 21:34067235-34067257 GGGGGCAAGCGTGCCTGCTCTGG - Intergenic
1180456842 22:15517013-15517035 GTGAGCCAACGTGCCTGGCCTGG - Intergenic
1181322548 22:22019497-22019519 GGAGGCCAAACTGCCTGACCTGG - Intergenic
1182341442 22:29624488-29624510 GTGAGCCAACGTGCCTGGCCAGG + Intronic
1182715198 22:32352637-32352659 GGGGGCAGCCCTGCCTGGCCTGG - Intergenic
1183515163 22:38261267-38261289 CCAGGCAGAAGTGCCTGGCCAGG - Intronic
1184061679 22:42086658-42086680 TGATGCTAACGTGACTGGCCAGG + Intronic
1184245704 22:43234844-43234866 GGAGGCAAAGCAGCCTGGCCGGG - Intronic
1184745705 22:46454458-46454480 GGAGACAAGGCTGCCTGGCCGGG - Intronic
1184859082 22:47163101-47163123 GGAGGCAAACCTGCCCACCCTGG - Intronic
950595223 3:13974489-13974511 CGAGGAAAACTTTCCTGGCCTGG - Intronic
951734288 3:25847466-25847488 GGAGCCAAACCTGCTTGTCCTGG - Intergenic
955234931 3:57130970-57130992 GGGGACAAAGGCGCCTGGCCTGG - Intronic
958106630 3:89082282-89082304 TGAGCCAAACTAGCCTGGCCAGG - Intergenic
958441739 3:94164039-94164061 GCATGCTAAAGTGCCTGGCCGGG - Intergenic
968425073 4:517797-517819 GGAGACAAACGTTCCTCTCCTGG - Intronic
968592621 4:1466467-1466489 GAAGGCAGAGGTCCCTGGCCGGG + Intergenic
968858487 4:3147710-3147732 GGAGGCAGAATTGCCAGGCCTGG + Intronic
968939065 4:3628616-3628638 GGAGGCCAACGGGCTTGGCGGGG + Intergenic
971908090 4:32755268-32755290 TGAGGGAAACTTCCCTGGCCTGG + Intergenic
973167013 4:47090809-47090831 TGAGGCCTACATGCCTGGCCAGG + Intronic
973741308 4:53922142-53922164 GGAGCCAGATGGGCCTGGCCTGG - Intronic
975091246 4:70406880-70406902 GGAAGGAAACATGCCTGGCCAGG + Intronic
975146126 4:70968904-70968926 TGAGCCAACTGTGCCTGGCCAGG + Intronic
977754178 4:100646839-100646861 GGAGGCTCACCAGCCTGGCCTGG + Intronic
978784713 4:112596880-112596902 GGAGGCCACTGTGCATGGCCAGG + Intronic
983514357 4:168640924-168640946 GTAGGCCACCGTGCCCGGCCTGG - Intronic
985147280 4:186906192-186906214 GGAGCCAACCATGCCTGGACAGG + Intergenic
985995932 5:3596691-3596713 GGGGGCAAACTCGCCTGGCTCGG + Intronic
992639878 5:78760104-78760126 GGAGGAAAAAGTGCCAGGTCAGG + Intronic
997976584 5:138444920-138444942 GGATGCAAAGGGGCCTGGCCAGG - Intronic
998014113 5:138718653-138718675 GGAGCCAAATGCTCCTGGCCTGG - Intronic
998064994 5:139150858-139150880 GGAGCCAAGCTTGCCTTGCCTGG - Intronic
998156424 5:139789317-139789339 AGAGGCAGACCTGCCCGGCCTGG + Intergenic
999317063 5:150591045-150591067 TGAGGCAAAGGTGCCAGGCCTGG + Intergenic
999771569 5:154780033-154780055 GGAAGCAAGGCTGCCTGGCCAGG + Intronic
1000222166 5:159224542-159224564 AGAGGCAAAGGTGCCAGGTCAGG - Intergenic
1000383773 5:160654245-160654267 GTAAGCCATCGTGCCTGGCCAGG + Intronic
1002068477 5:176664635-176664657 GGAGGCAGGAGTACCTGGCCTGG + Intergenic
1002602469 5:180361866-180361888 GAAGGCAAACCTGCCAGGGCAGG - Intergenic
1002719299 5:181247920-181247942 TGAGGGAAAGGTGCGTGGCCAGG + Intronic
1003133735 6:3417153-3417175 GCAGGGAAAGGTGCCTGGCTGGG + Intronic
1004599419 6:17133148-17133170 GCAGGCAAACCTGCCTGGTCTGG + Intergenic
1005832735 6:29683547-29683569 GTAAGCCACCGTGCCTGGCCTGG + Intergenic
1006166692 6:32069637-32069659 GGAGGTCAGCGTGCCGGGCCTGG - Intronic
1006896157 6:37472422-37472444 GGAGCCACACGAGCCTGGTCTGG - Exonic
1006941358 6:37753957-37753979 GGGGGCACGCGGGCCTGGCCAGG + Intergenic
1007409011 6:41650919-41650941 GTGAGCCAACGTGCCTGGCCAGG - Intronic
1007437309 6:41824115-41824137 GGAGGCAAAAATAACTGGCCTGG - Intronic
1016302223 6:142645437-142645459 GGGAGCCACCGTGCCTGGCCTGG - Intergenic
1017255535 6:152329241-152329263 GGGAGCCACCGTGCCTGGCCAGG - Intronic
1018151084 6:160940253-160940275 GGAGGCAGGCCTGCCTGCCCAGG - Intergenic
1018669335 6:166166816-166166838 GAAGGTGAACGTGTCTGGCCTGG - Exonic
1019549913 7:1596919-1596941 GGGCGCAATCGTGCCTGGGCGGG + Intergenic
1019825612 7:3281873-3281895 GGAGGGAAAGGGACCTGGCCTGG + Intergenic
1020126063 7:5533044-5533066 GGAAGTAGAGGTGCCTGGCCAGG + Intronic
1020288788 7:6706667-6706689 GGACGCACACGGGCCGGGCCCGG + Exonic
1023913373 7:44570647-44570669 GGAGCCAAACCTTCCAGGCCTGG - Intronic
1029574058 7:101391280-101391302 GGAAGCATCCGGGCCTGGCCGGG + Intronic
1029737051 7:102470700-102470722 GGTGGCAAGGGTGCCTGGGCGGG + Intronic
1030218041 7:107066856-107066878 GTGGGCCACCGTGCCTGGCCAGG + Intronic
1031961599 7:127995003-127995025 TGAGCCAACCGCGCCTGGCCTGG + Intronic
1032239943 7:130152969-130152991 CGTGGCAAACGTGCCCTGCCTGG - Intergenic
1035173275 7:157032786-157032808 GGAGGCACAGGTGCCTGGGCGGG + Intergenic
1040310502 8:46234375-46234397 GGAGGCAAATTTGCGTGGGCGGG + Intergenic
1045222663 8:100213619-100213641 GGAGGCAAACGTGCCTGGCCGGG - Intronic
1046023218 8:108691163-108691185 GGAAGCAAATGTCCCAGGCCCGG - Intronic
1048318185 8:133377325-133377347 GGAGGCAAAGGTGCATGGTGAGG + Intergenic
1049098381 8:140562226-140562248 GGAGGCCAACGTTCCGGGCCAGG + Intronic
1049209790 8:141380486-141380508 GGGAGCAAACGTGCCTGCCATGG + Intergenic
1050077570 9:1881018-1881040 GGAGGCCAATGTGCCTGGAAAGG + Intergenic
1052352459 9:27471199-27471221 GGAGTCTGACATGCCTGGCCTGG + Intronic
1058330624 9:103755827-103755849 TGAGGCAAACTTGCCTGGAAGGG - Intergenic
1061136429 9:128736764-128736786 GGAGGAACACTTGCATGGCCTGG - Intronic
1061517144 9:131096550-131096572 GGAGGCACAGGCGCCTGGTCCGG - Exonic
1061707319 9:132463101-132463123 GGAGGAAAGGGTGCCTGGGCGGG + Intronic
1195705998 X:107738474-107738496 GGTGGCAAGAGTGCCAGGCCAGG - Intronic
1196424915 X:115560884-115560906 GAAGTCCAACGTGCCTGGCTCGG - Intergenic
1198764084 X:140063245-140063267 GTAAGCCACCGTGCCTGGCCTGG + Intergenic
1199704349 X:150411143-150411165 GGAGGCATACCAGCCAGGCCAGG + Intronic
1200092713 X:153643383-153643405 GGAGCCAGAGGTGCCTGGCAGGG - Intronic