ID: 1045222664

View in Genome Browser
Species Human (GRCh38)
Location 8:100213620-100213642
Sequence CGGAGGCAAACGTGCCTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222664_1045222673 2 Left 1045222664 8:100213620-100213642 CCGGCCAGGCACGTTTGCCTCCG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1045222673 8:100213645-100213667 CCCGCCGGGTTTTCCCTTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 47
1045222664_1045222670 -1 Left 1045222664 8:100213620-100213642 CCGGCCAGGCACGTTTGCCTCCG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222664_1045222680 26 Left 1045222664 8:100213620-100213642 CCGGCCAGGCACGTTTGCCTCCG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50
1045222664_1045222676 11 Left 1045222664 8:100213620-100213642 CCGGCCAGGCACGTTTGCCTCCG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1045222676 8:100213654-100213676 TTTTCCCTTGGTGGCTGTTGCGG 0: 1
1: 0
2: 3
3: 25
4: 258
1045222664_1045222677 12 Left 1045222664 8:100213620-100213642 CCGGCCAGGCACGTTTGCCTCCG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1045222677 8:100213655-100213677 TTTCCCTTGGTGGCTGTTGCGGG 0: 1
1: 0
2: 8
3: 17
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222664 Original CRISPR CGGAGGCAAACGTGCCTGGC CGG (reversed) Intronic
901537186 1:9890179-9890201 CAGAGGCAAGAGTACCTGGCAGG + Intronic
902815227 1:18912878-18912900 CCCAGGCAAACCTGCCTGGTTGG - Intronic
904223358 1:28992405-28992427 CGTGAGCAACCGTGCCTGGCCGG - Intronic
904227454 1:29035262-29035284 CGTAAGCCACCGTGCCTGGCAGG + Intronic
904300665 1:29551344-29551366 GGGAGGCAAATGTCCCTGGAAGG - Intergenic
905475255 1:38221884-38221906 CGGTGGCAGAGGTGCCTGGTAGG - Intergenic
906856044 1:49305969-49305991 CGTAAGCCACCGTGCCTGGCCGG + Intronic
915010251 1:152678907-152678929 CTGAGGCAAATCTGCCTGGAAGG + Intergenic
917121164 1:171645813-171645835 AGGCAGCAAAAGTGCCTGGCTGG + Intronic
919180100 1:194069607-194069629 TGGAGTCACACGTGACTGGCAGG + Intergenic
919858744 1:201724379-201724401 AGGAGGCACACGTGCCTGATGGG + Intronic
1064681501 10:17814945-17814967 CGGGAGCCACCGTGCCTGGCCGG + Intronic
1067153003 10:43751881-43751903 AGGAGGCACCCGTGGCTGGCAGG - Intergenic
1074594181 10:114845048-114845070 GGGAGGCCAACGTGCGTGGGTGG - Intronic
1077442355 11:2574631-2574653 CGCAGGGACACGTGCCTGCCTGG - Intronic
1078252382 11:9626950-9626972 CGGGCGGAAGCGTGCCTGGCTGG + Intergenic
1084410536 11:69003839-69003861 CAGAGGCAAAAGGGCCAGGCAGG + Intergenic
1088218151 11:107536900-107536922 AGGGGTCAAACGTCCCTGGCTGG - Intronic
1091626455 12:2124685-2124707 AGGAGGCAAGCTTGCCTGGACGG + Intronic
1096412630 12:51388265-51388287 CCGAGGCAAAGGAGGCTGGCAGG - Intronic
1097179893 12:57165836-57165858 CACAGGCAAACTCGCCTGGCTGG - Exonic
1101502314 12:105315645-105315667 GGGATGAAAACATGCCTGGCAGG + Intronic
1112130167 13:96514634-96514656 CAGAGGCAATCGTACCTTGCTGG + Intronic
1113853004 13:113428688-113428710 CGGAGGCAAATGTCCCCGGCAGG + Intronic
1113894302 13:113754024-113754046 AGGAGGCAGCCGTGCCAGGCAGG - Intergenic
1117602413 14:57389904-57389926 TGGAGGCAAAAGTGACTGACAGG - Intergenic
1118132930 14:62987730-62987752 CCAAGGCAAACGATCCTGGCTGG - Intronic
1120277888 14:82400356-82400378 AGGAGGTAAACGAGCCTGGTGGG + Intergenic
1120443737 14:84567412-84567434 GGGAGGGAAAGGTGCCTGGGGGG + Intergenic
1121352451 14:93184592-93184614 CGGCGGCCAAGGTGCCTGGCCGG + Exonic
1122267832 14:100554893-100554915 CGAAGGCCAGCGTGCCTGGCGGG - Intronic
1123893627 15:24806399-24806421 CGTGAGCCAACGTGCCTGGCCGG - Intergenic
1137712643 16:50577005-50577027 CGGAGGCCACCATACCTGGCTGG + Intronic
1139805877 16:69565580-69565602 CGGCGGCGGACGGGCCTGGCTGG - Intronic
1141073036 16:80975465-80975487 CGCAGGCTACCATGCCTGGCTGG - Exonic
1142356948 16:89605786-89605808 CAGTGGCAAACGGGCGTGGCTGG + Intergenic
1144371004 17:14591763-14591785 CGTGAGCCAACGTGCCTGGCCGG - Intergenic
1148858778 17:50593339-50593361 CTGAGGGAACCGTGGCTGGCAGG - Intronic
1150565237 17:66332970-66332992 CGTAAGCCAACGTGCCTGGCCGG + Intronic
1151952518 17:77363037-77363059 AGGAGGCAGATGTGGCTGGCAGG + Intronic
1152691398 17:81719734-81719756 CCCAGGCCACCGTGCCTGGCTGG + Intronic
1155125365 18:22870085-22870107 CGTAGGCAAACGTGCCTTGGTGG - Intronic
1161744118 19:6044612-6044634 CAGAGGCAAAGCTGCCTGGGCGG - Intronic
1165939224 19:39407005-39407027 GGGAGGCAAGCGTCCCGGGCTGG - Intronic
1168663683 19:58186268-58186290 CGTAAGCTACCGTGCCTGGCAGG - Intronic
926147242 2:10404294-10404316 GGGAGGCAAAAGGGCATGGCTGG - Intronic
928360453 2:30658365-30658387 CAGATGCAAACGTGTCTGGCAGG + Intergenic
929352848 2:40981385-40981407 CGTAAGCAATTGTGCCTGGCTGG - Intergenic
933195081 2:79380163-79380185 CTGAGGCACAAGTGCCTGGGAGG - Intronic
938073739 2:128321239-128321261 AGGAGGGAAATCTGCCTGGCTGG + Intergenic
939880989 2:147631238-147631260 CAGATGGAAATGTGCCTGGCAGG - Intergenic
945676005 2:212856436-212856458 CTGAGGCGAGTGTGCCTGGCAGG - Intergenic
948776465 2:240291422-240291444 GGGAGGCAACAGTGCGTGGCAGG + Intergenic
1169047777 20:2549459-2549481 CGTAAGCAACCATGCCTGGCTGG - Intronic
1170129139 20:13000257-13000279 CGGAGGCACAGGTGGGTGGCAGG + Intergenic
1171090280 20:22278824-22278846 CTGAGGCAAGTGTGCCTGCCTGG - Intergenic
1172122576 20:32607606-32607628 AGGAGGCAAACACCCCTGGCAGG - Intronic
1181804238 22:25365509-25365531 CAGAGGCAAGTGTGCCAGGCAGG + Intronic
1184245705 22:43234845-43234867 AGGAGGCAAAGCAGCCTGGCCGG - Intronic
956557994 3:70542677-70542699 CGGGGGGAAAGGTGCCTGACGGG + Intergenic
958682917 3:97353712-97353734 AGGAGGGAAACAAGCCTGGCTGG + Intronic
960471766 3:118075136-118075158 GGGAGGGAAACAGGCCTGGCTGG - Intergenic
963099322 3:141584049-141584071 CGTAAGCCACCGTGCCTGGCTGG - Intronic
968939064 4:3628615-3628637 TGGAGGCCAACGGGCTTGGCGGG + Intergenic
971978908 4:33728802-33728824 GGGAGGCCAACGTGGCTGGATGG + Intergenic
975940182 4:79634402-79634424 CTCACGCAAACGTGACTGGCTGG + Intergenic
979020798 4:115494587-115494609 CAGAGGCAAGATTGCCTGGCTGG + Intergenic
979539967 4:121870153-121870175 CGGAGGCGAAGGAGCCGGGCTGG - Intronic
981194181 4:141899380-141899402 TGGAAGCAGACATGCCTGGCTGG - Intergenic
984499851 4:180545542-180545564 CTGAGGGAAGTGTGCCTGGCGGG - Intergenic
996150634 5:120030152-120030174 CAGAGGCAAAAGTGCCTGTGTGG - Intergenic
1000624765 5:163526467-163526489 CGTAAGCCACCGTGCCTGGCTGG + Intergenic
1003133734 6:3417152-3417174 TGCAGGGAAAGGTGCCTGGCTGG + Intronic
1006831371 6:36970268-36970290 CGGAAGCCAGGGTGCCTGGCAGG + Intronic
1012997837 6:105991679-105991701 CGTAGGCAAAAGAGCCTGACTGG + Intergenic
1018620504 6:165725730-165725752 GGGAGGCAAACGTGACTTCCAGG - Intronic
1019426341 7:978910-978932 CGATGGCACACGTGGCTGGCAGG + Intergenic
1025607027 7:63046963-63046985 AGGAGGCAAAAGAGCATGGCTGG - Intergenic
1032670165 7:134075088-134075110 CCAAGGCAAACCTGCCTAGCAGG + Intergenic
1035173274 7:157032785-157032807 GGGAGGCACAGGTGCCTGGGCGG + Intergenic
1035906059 8:3511471-3511493 CGTGAGCCAACGTGCCTGGCTGG - Intronic
1037752975 8:21694597-21694619 CGGAGCCAACAGTGCATGGCGGG - Intronic
1045222664 8:100213620-100213642 CGGAGGCAAACGTGCCTGGCCGG - Intronic
1048593775 8:135845470-135845492 CTCAGGCAAAAGTGCCTAGCGGG + Intergenic
1049453480 8:142675263-142675285 TGGAGGCCAAGGGGCCTGGCTGG + Intronic
1049489117 8:142883836-142883858 GGGAGGCAGACGTACCTGGAGGG - Intronic
1049977290 9:871753-871775 CGTGAGCAACCGTGCCTGGCCGG + Intronic
1049979567 9:891803-891825 CGTGGGCCACCGTGCCTGGCTGG + Intronic
1051528125 9:18070352-18070374 GGCAGGCAAATGTGGCTGGCTGG + Intergenic
1057030121 9:91769066-91769088 CGGAGGCAGACAAGACTGGCAGG + Intronic
1058330625 9:103755828-103755850 ATGAGGCAAACTTGCCTGGAAGG - Intergenic
1059134889 9:111795375-111795397 AGGAGGCAAACGTGCCTCAGGGG + Intergenic
1061025184 9:128043784-128043806 GGGCTGCAGACGTGCCTGGCTGG - Intergenic
1062178809 9:135179666-135179688 CCGAGGCAGCTGTGCCTGGCAGG - Intergenic
1062686732 9:137817502-137817524 CGCAGACAAAGGTGCCTGGTGGG - Exonic
1185554374 X:1008864-1008886 CGTGAGCCAACGTGCCTGGCCGG + Intergenic
1186660620 X:11664908-11664930 CTCAGGCAAAGGTGCCAGGCGGG + Exonic
1192362701 X:70449537-70449559 GGGAGGAAAGCCTGCCTGGCAGG + Intronic
1200092714 X:153643384-153643406 GGGAGCCAGAGGTGCCTGGCAGG - Intronic