ID: 1045222665

View in Genome Browser
Species Human (GRCh38)
Location 8:100213624-100213646
Sequence GGGACGGAGGCAAACGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222665_1045222673 -2 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222673 8:100213645-100213667 CCCGCCGGGTTTTCCCTTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 47
1045222665_1045222680 22 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50
1045222665_1045222676 7 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222676 8:100213654-100213676 TTTTCCCTTGGTGGCTGTTGCGG 0: 1
1: 0
2: 3
3: 25
4: 258
1045222665_1045222677 8 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222677 8:100213655-100213677 TTTCCCTTGGTGGCTGTTGCGGG 0: 1
1: 0
2: 8
3: 17
4: 193
1045222665_1045222670 -5 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222665 Original CRISPR GGGACGGAGGCAAACGTGCC TGG (reversed) Intronic