ID: 1045222665

View in Genome Browser
Species Human (GRCh38)
Location 8:100213624-100213646
Sequence GGGACGGAGGCAAACGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222665_1045222673 -2 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222673 8:100213645-100213667 CCCGCCGGGTTTTCCCTTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 47
1045222665_1045222680 22 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50
1045222665_1045222676 7 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222676 8:100213654-100213676 TTTTCCCTTGGTGGCTGTTGCGG 0: 1
1: 0
2: 3
3: 25
4: 258
1045222665_1045222677 8 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222677 8:100213655-100213677 TTTCCCTTGGTGGCTGTTGCGGG 0: 1
1: 0
2: 8
3: 17
4: 193
1045222665_1045222670 -5 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222665 Original CRISPR GGGACGGAGGCAAACGTGCC TGG (reversed) Intronic
900318500 1:2070910-2070932 GGGCGGGAGGCAGACGGGCCAGG - Intronic
901663949 1:10815939-10815961 GGGGAGGAGGCAGGCGTGCCTGG + Intergenic
902866588 1:19284136-19284158 GGGACGGTGGCACAGGTGTCAGG + Intronic
904597293 1:31654933-31654955 GGGAGGAAGGCAAAGGTCCCAGG + Intronic
905506827 1:38486419-38486441 GGGACAGTGACAAACGTTCCTGG - Intergenic
907287717 1:53392736-53392758 GGGTCAGAGCCAAACCTGCCCGG + Intergenic
907290923 1:53412414-53412436 GGGAGCGAGACAAAGGTGCCGGG + Intergenic
911981210 1:104568986-104569008 GGGAAGGACACAAACGTGGCTGG + Intergenic
915549693 1:156624952-156624974 GGGATCGAGGCAAAAGTGCAGGG - Intronic
915607542 1:156962440-156962462 GGGATGGAGACCAAAGTGCCGGG - Intronic
918252482 1:182715720-182715742 GGGAGGGAGCCAAGCCTGCCAGG + Intergenic
918349300 1:183636516-183636538 GGGAGGGAGGGGAACGTGTCCGG + Intronic
920060261 1:203222432-203222454 GGGTCAGAGGCAAAGGTGGCAGG + Intronic
922753754 1:228082905-228082927 GGGGCGGACGCAGACGGGCCGGG + Intronic
1063154832 10:3369386-3369408 GGGACGAAGACAAGGGTGCCTGG + Intergenic
1063429550 10:5977220-5977242 GGGCAGGAGGGACACGTGCCGGG - Intronic
1063493368 10:6485461-6485483 GTGAAGGAGGCAAACGTGTTCGG - Intronic
1072998921 10:100271026-100271048 GGGACGGTGGAAACCGTGGCTGG - Intergenic
1077112188 11:866740-866762 GGGAGGGAGGGACAGGTGCCTGG + Exonic
1083803673 11:65060956-65060978 GGGACGGAGGCAAGTGTGTGGGG - Intergenic
1084322385 11:68380832-68380854 AGGACAGAGGCAAGTGTGCCAGG - Intronic
1085013523 11:73157693-73157715 AGGCCAGAGGCAAACATGCCTGG + Intergenic
1085300606 11:75456139-75456161 GGGAAGGAGGCAGACATGCTGGG + Intronic
1089223442 11:116895178-116895200 GGGAAGGAGGCCTGCGTGCCTGG - Intronic
1089359050 11:117874439-117874461 GGGAAGCAGGAAAACGTGCCAGG + Intronic
1089580493 11:119478911-119478933 GGGAAGGAAGCAAAGGTGCTGGG - Intergenic
1098388768 12:69946959-69946981 TGGACAGAGGCAAACTTGCCAGG - Intronic
1105316042 13:19264811-19264833 GGGAGGGAGGGAAAGGGGCCAGG - Intergenic
1113811153 13:113143506-113143528 TGGACAGAGACAAACGGGCCGGG - Intronic
1114523829 14:23355682-23355704 GGGGAGGAGGCAAATGTGCAGGG + Intergenic
1122744180 14:103888301-103888323 GGTCAGGAGGCAAACGTGCAAGG - Intergenic
1123971282 15:25510129-25510151 GGGAGGGAGGGAAACGTGGCTGG + Intergenic
1125443703 15:39730753-39730775 GGGACAGAAGCAAAGGTGCAGGG + Intronic
1125736936 15:41933527-41933549 GGGACAGGGAGAAACGTGCCCGG + Intronic
1128153396 15:65377366-65377388 GAGACCGAGGGAAACGAGCCAGG - Intronic
1131158551 15:90089877-90089899 GGGACAGAGGCAGACCTGCAAGG + Intronic
1131839735 15:96424334-96424356 GGGTCGGAGGGAAACAAGCCTGG - Intergenic
1133688972 16:8194810-8194832 AGGACAGAAGCAAACATGCCAGG - Intergenic
1136179131 16:28538894-28538916 GGGAAGGTGGCCATCGTGCCTGG + Exonic
1137003512 16:35251623-35251645 GGGACAGAGGCCAACGGGGCAGG + Intergenic
1137231783 16:46573589-46573611 GGGAAGGAGGCAAACGGCCTCGG + Intergenic
1142088005 16:88194597-88194619 GGGCGGGAGGCAGCCGTGCCCGG + Intergenic
1143236876 17:5409933-5409955 GGCAAGGAGGCCAAGGTGCCTGG + Intronic
1148855877 17:50579068-50579090 GGGAGGGAGGCAATCTTTCCTGG + Intronic
1149362778 17:55911627-55911649 GGGAAGGAGGCAGACGGCCCTGG - Intergenic
1150846421 17:68663293-68663315 TGCAGGGAGGCCAACGTGCCTGG - Intergenic
1155424866 18:25696417-25696439 GGGACGGAGGCAAGCCAGCTGGG + Intergenic
1160437597 18:78863260-78863282 GGGAGGGAAGGAAACATGCCCGG - Intergenic
1166699606 19:44874583-44874605 GGGAGGGATGCAGACCTGCCTGG + Intronic
925351105 2:3201183-3201205 GGGCAGGAGGCAAAAGCGCCGGG + Intronic
926328818 2:11808200-11808222 GGGACCGAGGCCAACAAGCCAGG - Intronic
934968374 2:98742969-98742991 GGGACTGAGGCGAAGGTGCTTGG + Intergenic
937645885 2:124265575-124265597 GGGACTGAGGGCAACATGCCTGG + Intronic
938654158 2:133413519-133413541 GGGAAGGAGGGAAGGGTGCCTGG + Intronic
939463424 2:142526956-142526978 GGGACAGAGGAGAAGGTGCCAGG - Intergenic
946300463 2:218820857-218820879 GGCACGGAGGCAGCAGTGCCTGG + Intergenic
947009055 2:225546241-225546263 GGGAAGGACGCAAACATGGCTGG - Intronic
948794387 2:240394759-240394781 GGGAGGGAGGCACACAAGCCAGG - Intergenic
1169264977 20:4162078-4162100 GGGCAGGAGGCACACCTGCCAGG - Intronic
1172878062 20:38178131-38178153 GGCAGGGAGGCCAGCGTGCCGGG - Intergenic
1173165119 20:40682670-40682692 GGGACTGAGGGAAGCCTGCCTGG + Intergenic
1175811722 20:61861978-61862000 GGCAGGGAAGCAAACGTCCCAGG + Intronic
1176089149 20:63311389-63311411 GGGGCGGAGGCAGAGGTGCTGGG - Exonic
1182576297 22:31275345-31275367 TAGACAGAGGCAAACGTCCCAGG - Intronic
1183560786 22:38570699-38570721 GGGGCGGGGGGAAACGGGCCCGG - Intergenic
1183750936 22:39719861-39719883 GGAACGGAACCAAACCTGCCGGG - Intergenic
950206704 3:11086367-11086389 GGGACGGAAGGAAACTTACCAGG - Intergenic
953217302 3:40931245-40931267 GGGAGGGATGCAAACCTGGCTGG + Intergenic
962350188 3:134650770-134650792 GGCAAGGAGGCCAAGGTGCCGGG + Intronic
963003491 3:140705000-140705022 GAGAGAGAGGCAAAGGTGCCAGG + Intergenic
963053255 3:141160466-141160488 GGGATGGAGGAAAACCTACCAGG + Intergenic
963373838 3:144437916-144437938 AGGAAGGAAGCAAACTTGCCTGG + Intergenic
967494052 3:190122938-190122960 GGGACTGAGGGCAAAGTGCCAGG + Intergenic
968210376 3:196843827-196843849 GGCAGAGAGGGAAACGTGCCAGG + Intergenic
971474741 4:27062004-27062026 GGGACATAGGCAAATGTCCCTGG + Intergenic
973758280 4:54095737-54095759 AGGGCGGAGGGAAACGTCCCTGG - Intronic
976678991 4:87734249-87734271 GGAAAGGAGGCCAGCGTGCCTGG + Intergenic
979545455 4:121934813-121934835 GGGACTAAGGCAAATGTGGCCGG + Intronic
982256017 4:153452425-153452447 AGGCAGGAGGCAAACGGGCCGGG - Intergenic
983296639 4:165874895-165874917 AGGTCGGAGGCGCACGTGCCCGG + Intronic
985503919 5:267273-267295 GGGACAGAGCCAACCATGCCTGG - Intergenic
985942821 5:3152061-3152083 GGGACGGAGGGACCAGTGCCAGG + Intergenic
992130053 5:73682898-73682920 GGGAGGGAGGCAAGGGTGCAGGG + Intronic
994309993 5:98258862-98258884 GGGAAGGACACAAGCGTGCCTGG - Intergenic
997815340 5:137011613-137011635 GGGACTGAGGCAAAAGGACCTGG - Intronic
998291109 5:140915849-140915871 GGGAAGGATGCAAACTTGGCTGG - Intronic
998545792 5:143026481-143026503 GGGAGGGAGGGAAGCGTGTCAGG + Intronic
1003183406 6:3810788-3810810 GGGATGGAGGCAGAGGCGCCAGG - Intergenic
1005217300 6:23546081-23546103 GGCATGGAGGCAAGTGTGCCTGG - Intergenic
1008238978 6:49084948-49084970 GGGAAGGAGGCAAACTTGGCTGG + Intergenic
1009371250 6:62905815-62905837 GGGAAGGAGACAAACCTGGCTGG + Intergenic
1014180437 6:118378264-118378286 GGGAGGGAGGAACAGGTGCCAGG + Intergenic
1019216722 6:170448542-170448564 TGGATGGAGGCAAAGGGGCCAGG + Intergenic
1025250153 7:57346510-57346532 GGGAAGGAGGCCAGCGTGGCAGG + Intergenic
1028399236 7:90406864-90406886 GGGACTGTGGAAAACGTGCAAGG - Intronic
1034754278 7:153600457-153600479 GGGATGGAGGCCGACGTTCCTGG + Intergenic
1039491339 8:37949841-37949863 GGGTAGGAGGGAAAGGTGCCTGG - Intergenic
1041095509 8:54344968-54344990 GGGAGGGAGGCCAGCTTGCCTGG + Intergenic
1045222665 8:100213624-100213646 GGGACGGAGGCAAACGTGCCTGG - Intronic
1049336011 8:142085732-142085754 GGGAGGGAGGGAAATGGGCCTGG + Intergenic
1049489119 8:142883840-142883862 GGCAGGGAGGCAGACGTACCTGG - Intronic
1054994306 9:71367319-71367341 GGGACAGAGGCAGACATTCCAGG - Intronic
1058330626 9:103755832-103755854 AGGAATGAGGCAAACTTGCCTGG - Intergenic
1059469959 9:114497349-114497371 GGGAAGGAGCCAAAGGTGCTGGG + Intronic
1061144936 9:128791991-128792013 GGGAGGGAGGCTAAGCTGCCAGG + Intronic
1062146855 9:134994395-134994417 GGGAGGGTGGCAAACATGGCAGG - Intergenic
1186481626 X:9900791-9900813 TGGAGGGAAGCAAACGTGCTGGG - Intronic
1186660618 X:11664904-11664926 GGGACTCAGGCAAAGGTGCCAGG + Exonic
1194795966 X:98211163-98211185 GGGAAGGACGCAAACCTGGCTGG + Intergenic
1196534478 X:116826211-116826233 AGGAAGGAGGAAAACGTGTCTGG + Intergenic
1200126366 X:153816650-153816672 GGGACAGAGACAAAGCTGCCTGG + Intronic