ID: 1045222666

View in Genome Browser
Species Human (GRCh38)
Location 8:100213630-100213652
Sequence ACGTTTGCCTCCGTCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222662_1045222666 -2 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222666 8:100213630-100213652 ACGTTTGCCTCCGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1045222657_1045222666 23 Left 1045222657 8:100213584-100213606 CCTCAGTGAGCAGCACCTGGGAA 0: 1
1: 0
2: 2
3: 22
4: 291
Right 1045222666 8:100213630-100213652 ACGTTTGCCTCCGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1045222659_1045222666 8 Left 1045222659 8:100213599-100213621 CCTGGGAATGCCGGCATGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1045222666 8:100213630-100213652 ACGTTTGCCTCCGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1045222654_1045222666 28 Left 1045222654 8:100213579-100213601 CCTGACCTCAGTGAGCAGCACCT 0: 1
1: 0
2: 1
3: 35
4: 250
Right 1045222666 8:100213630-100213652 ACGTTTGCCTCCGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222666 Original CRISPR ACGTTTGCCTCCGTCCCCGC CGG Intronic