ID: 1045222670

View in Genome Browser
Species Human (GRCh38)
Location 8:100213642-100213664
Sequence GTCCCCGCCGGGTTTTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222664_1045222670 -1 Left 1045222664 8:100213620-100213642 CCGGCCAGGCACGTTTGCCTCCG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222662_1045222670 10 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222665_1045222670 -5 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222659_1045222670 20 Left 1045222659 8:100213599-100213621 CCTGGGAATGCCGGCATGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222663_1045222670 0 Left 1045222663 8:100213619-100213641 CCCGGCCAGGCACGTTTGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222670 Original CRISPR GTCCCCGCCGGGTTTTCCCT TGG Intronic
901011686 1:6206055-6206077 TTCCCCGCCGGGTGTCCTCTGGG - Intronic
901771231 1:11531358-11531380 GTCACCACCGGGGTGTCCCTGGG + Intronic
901811425 1:11768901-11768923 GCCCCTGCCTGGTGTTCCCTTGG + Intronic
903554279 1:24181714-24181736 GCCCAGGCCTGGTTTTCCCTGGG + Intronic
912709847 1:111942495-111942517 GTCCCCACTGGCTGTTCCCTTGG - Intronic
920108870 1:203573254-203573276 GGCCCTGCTGGGTTTTCCTTAGG - Intergenic
1064656073 10:17557581-17557603 GTCCCCCACTGGTTTTGCCTGGG + Intergenic
1073066452 10:100762284-100762306 GTCCACACCGGGGTTTCACTGGG + Intronic
1073763156 10:106652459-106652481 GCCCCCGCGGGGCTTTCCCTGGG + Exonic
1075007260 10:118839942-118839964 TACCCCACTGGGTTTTCCCTGGG - Intergenic
1076696713 10:132250749-132250771 GTCTCCGCCTGGCTTTCCATCGG + Intronic
1077271154 11:1682132-1682154 GTCCCAGCCTGTGTTTCCCTGGG - Intergenic
1084954011 11:72681870-72681892 GTCCCCGACTGCTCTTCCCTAGG + Intergenic
1093175758 12:15911511-15911533 GTCCCCGAGGGGTTTTCGCTGGG + Intronic
1100632138 12:96399946-96399968 GTCCGCGCCGCGCTTTCCCCTGG - Intronic
1103925424 12:124421195-124421217 GTCCCCGCCGGCCTCTCCGTTGG + Intronic
1103926604 12:124426865-124426887 GTCCCCTCTGTGTCTTCCCTGGG - Intronic
1104722795 12:131054745-131054767 GTCTCTGCCGGGTCTTGCCTAGG + Intronic
1117463774 14:55972396-55972418 GCCCCAGCCTGATTTTCCCTGGG + Intergenic
1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG + Intronic
1121438862 14:93936333-93936355 GTCTCTGCAGGGATTTCCCTGGG + Intronic
1129986418 15:79923299-79923321 GTCCCCTCGGGGCTTCCCCTTGG - Intronic
1132934586 16:2474226-2474248 GTCCCCGCCGGCAGCTCCCTCGG + Intergenic
1138331995 16:56222723-56222745 GTCGCCCCTGGGTTTTTCCTCGG - Intronic
1140700270 16:77575073-77575095 GTCCCCTCCAGGATTTCCCTGGG - Intergenic
1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG + Intergenic
1148582363 17:48752755-48752777 GCCCCCTCCGGGTTCTCCCACGG + Intergenic
1149550162 17:57533848-57533870 GTCCCCTCCAGGATTTCCCCAGG - Intronic
1154241392 18:12657387-12657409 GTCCCCGCCGGATCCTCCCGGGG + Intronic
1160575408 18:79850014-79850036 GACCCCGGCGGGTTTTCACACGG - Intergenic
1166924896 19:46260735-46260757 GTCCCAGCCGGGGGTCCCCTGGG + Intergenic
1168694490 19:58396842-58396864 GCCCCCGCCGGGGTCGCCCTGGG + Exonic
925034081 2:672757-672779 GTCCCTGCAGGGGTGTCCCTGGG - Intronic
931205198 2:60139929-60139951 GTCCACACCCTGTTTTCCCTTGG - Intergenic
938065165 2:128278083-128278105 GTACCTGCAGGATTTTCCCTGGG - Intronic
944620009 2:201504770-201504792 TTCCATGCCAGGTTTTCCCTGGG + Intronic
1169938965 20:10916507-10916529 GTCCCAGCCATGTTTTCCCATGG - Intergenic
1170753178 20:19170841-19170863 GTCTTCACCTGGTTTTCCCTAGG - Intergenic
1172951309 20:38724918-38724940 GTCCCCGCAGGGCTCTCCCTCGG - Exonic
1175664087 20:60843607-60843629 GTCCCCTGCCAGTTTTCCCTTGG - Intergenic
1182068982 22:27450174-27450196 GACCCCACTGGGATTTCCCTAGG + Intergenic
954468938 3:50675207-50675229 GTCCCCGCCGCGTTGTCGCCCGG + Intergenic
963070910 3:141304444-141304466 GGCCCCTCAGGGTTGTCCCTGGG - Intergenic
969711189 4:8845112-8845134 GTCCCTGCCGTGTTGTGCCTGGG + Intergenic
984731618 4:183073773-183073795 TTCCCATCCGGGTTTTACCTGGG - Intergenic
992088634 5:73299174-73299196 GTGCCGCCCGGGTTTGCCCTCGG - Intergenic
1001924619 5:175627191-175627213 GGCCTCGGCGGGGTTTCCCTAGG + Intergenic
1005618658 6:27600076-27600098 ATCCCCGTCGGGTTTTAGCTGGG + Intergenic
1006317588 6:33299384-33299406 ATCCCGGCCGGGTTTTCCGAAGG + Intergenic
1006813353 6:36835115-36835137 CGCCCCGCCGCGTCTTCCCTGGG + Intronic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1026738108 7:72961544-72961566 GTTCCCGCCCTGGTTTCCCTGGG - Intronic
1026789145 7:73320341-73320363 GTTCCCGCCCTGGTTTCCCTGGG - Intronic
1027105626 7:75403524-75403546 GTTCCCGCCCTGGTTTCCCTGGG + Intronic
1033249664 7:139747740-139747762 GGCACCCCCGGTTTTTCCCTTGG + Intronic
1034924236 7:155108098-155108120 ATAACCGCCGGGTTTTCCCGAGG - Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1046249506 8:111611760-111611782 CTCCCCGCCTGGCTTGCCCTCGG - Intergenic
1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG + Intergenic
1056787970 9:89606072-89606094 GTCCCCGCCGGGCTGTCACTCGG - Exonic
1057207474 9:93182364-93182386 GTCCCATCCTGGTTTTCCCTTGG + Intergenic
1059516786 9:114903286-114903308 GTCCCAGCCTGGTTTTCCCTGGG + Exonic
1185893199 X:3837984-3838006 GTCACCGCCTCGTGTTCCCTTGG - Intronic
1185898311 X:3876406-3876428 GTCACCGCCTCGTGTTCCCTTGG - Intergenic
1185903426 X:3914835-3914857 GTCACCGCCTCGTGTTCCCTTGG - Intergenic
1200411647 Y:2867663-2867685 CTCCACGCCTGGTTTGCCCTTGG - Intronic