ID: 1045222670

View in Genome Browser
Species Human (GRCh38)
Location 8:100213642-100213664
Sequence GTCCCCGCCGGGTTTTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222662_1045222670 10 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222659_1045222670 20 Left 1045222659 8:100213599-100213621 CCTGGGAATGCCGGCATGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222665_1045222670 -5 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222663_1045222670 0 Left 1045222663 8:100213619-100213641 CCCGGCCAGGCACGTTTGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58
1045222664_1045222670 -1 Left 1045222664 8:100213620-100213642 CCGGCCAGGCACGTTTGCCTCCG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222670 Original CRISPR GTCCCCGCCGGGTTTTCCCT TGG Intronic