ID: 1045222677

View in Genome Browser
Species Human (GRCh38)
Location 8:100213655-100213677
Sequence TTTCCCTTGGTGGCTGTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 8, 3: 17, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222668_1045222677 -5 Left 1045222668 8:100213637-100213659 CCTCCGTCCCCGCCGGGTTTTCC 0: 1
1: 0
2: 0
3: 22
4: 184
Right 1045222677 8:100213655-100213677 TTTCCCTTGGTGGCTGTTGCGGG 0: 1
1: 0
2: 8
3: 17
4: 193
1045222662_1045222677 23 Left 1045222662 8:100213609-100213631 CCGGCATGTTCCCGGCCAGGCAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1045222677 8:100213655-100213677 TTTCCCTTGGTGGCTGTTGCGGG 0: 1
1: 0
2: 8
3: 17
4: 193
1045222669_1045222677 -8 Left 1045222669 8:100213640-100213662 CCGTCCCCGCCGGGTTTTCCCTT 0: 1
1: 0
2: 1
3: 7
4: 135
Right 1045222677 8:100213655-100213677 TTTCCCTTGGTGGCTGTTGCGGG 0: 1
1: 0
2: 8
3: 17
4: 193
1045222663_1045222677 13 Left 1045222663 8:100213619-100213641 CCCGGCCAGGCACGTTTGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1045222677 8:100213655-100213677 TTTCCCTTGGTGGCTGTTGCGGG 0: 1
1: 0
2: 8
3: 17
4: 193
1045222664_1045222677 12 Left 1045222664 8:100213620-100213642 CCGGCCAGGCACGTTTGCCTCCG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1045222677 8:100213655-100213677 TTTCCCTTGGTGGCTGTTGCGGG 0: 1
1: 0
2: 8
3: 17
4: 193
1045222665_1045222677 8 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222677 8:100213655-100213677 TTTCCCTTGGTGGCTGTTGCGGG 0: 1
1: 0
2: 8
3: 17
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222677 Original CRISPR TTTCCCTTGGTGGCTGTTGC GGG Intronic