ID: 1045222680

View in Genome Browser
Species Human (GRCh38)
Location 8:100213669-100213691
Sequence TGTTGCGGGTAGCAGCTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 50}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045222663_1045222680 27 Left 1045222663 8:100213619-100213641 CCCGGCCAGGCACGTTTGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50
1045222664_1045222680 26 Left 1045222664 8:100213620-100213642 CCGGCCAGGCACGTTTGCCTCCG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50
1045222672_1045222680 1 Left 1045222672 8:100213645-100213667 CCCGCCGGGTTTTCCCTTGGTGG 0: 1
1: 0
2: 1
3: 4
4: 97
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50
1045222669_1045222680 6 Left 1045222669 8:100213640-100213662 CCGTCCCCGCCGGGTTTTCCCTT 0: 1
1: 0
2: 1
3: 7
4: 135
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50
1045222665_1045222680 22 Left 1045222665 8:100213624-100213646 CCAGGCACGTTTGCCTCCGTCCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50
1045222668_1045222680 9 Left 1045222668 8:100213637-100213659 CCTCCGTCCCCGCCGGGTTTTCC 0: 1
1: 0
2: 0
3: 22
4: 184
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50
1045222674_1045222680 0 Left 1045222674 8:100213646-100213668 CCGCCGGGTTTTCCCTTGGTGGC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50
1045222675_1045222680 -3 Left 1045222675 8:100213649-100213671 CCGGGTTTTCCCTTGGTGGCTGT 0: 1
1: 0
2: 0
3: 23
4: 218
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50
1045222671_1045222680 2 Left 1045222671 8:100213644-100213666 CCCCGCCGGGTTTTCCCTTGGTG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1045222680 8:100213669-100213691 TGTTGCGGGTAGCAGCTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045222680 Original CRISPR TGTTGCGGGTAGCAGCTCCG TGG Intronic