ID: 1045224785

View in Genome Browser
Species Human (GRCh38)
Location 8:100233875-100233897
Sequence CCTCCAACAGCAATCCTTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045224785_1045224797 29 Left 1045224785 8:100233875-100233897 CCGGCAAGGATTGCTGTTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 92
Right 1045224797 8:100233927-100233949 TGGGTGACCCAGCGGAAGTTGGG No data
1045224785_1045224794 10 Left 1045224785 8:100233875-100233897 CCGGCAAGGATTGCTGTTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 92
Right 1045224794 8:100233908-100233930 AAGGCATCAGAATAGAAGATGGG No data
1045224785_1045224793 9 Left 1045224785 8:100233875-100233897 CCGGCAAGGATTGCTGTTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 92
Right 1045224793 8:100233907-100233929 GAAGGCATCAGAATAGAAGATGG No data
1045224785_1045224796 28 Left 1045224785 8:100233875-100233897 CCGGCAAGGATTGCTGTTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 92
Right 1045224796 8:100233926-100233948 ATGGGTGACCCAGCGGAAGTTGG No data
1045224785_1045224795 21 Left 1045224785 8:100233875-100233897 CCGGCAAGGATTGCTGTTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 92
Right 1045224795 8:100233919-100233941 ATAGAAGATGGGTGACCCAGCGG No data
1045224785_1045224792 -9 Left 1045224785 8:100233875-100233897 CCGGCAAGGATTGCTGTTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 92
Right 1045224792 8:100233889-100233911 TGTTGGAGGTTGGGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045224785 Original CRISPR CCTCCAACAGCAATCCTTGC CGG (reversed) Intronic
900121571 1:1050597-1050619 CCTCCCAGAGCCACCCTTGCCGG - Intronic
901019237 1:6247602-6247624 TATCCAACGGCAATACTTGCAGG - Exonic
902600706 1:17539156-17539178 CCTCCAAGAACAACCCTGGCGGG - Intergenic
906680105 1:47720453-47720475 CCTCCCACTGCACTGCTTGCAGG + Intergenic
913174774 1:116263500-116263522 TCTCCAGGGGCAATCCTTGCTGG + Intergenic
916141642 1:161705092-161705114 CCATCTGCAGCAATCCTTGCAGG - Intergenic
918114639 1:181485477-181485499 CCTCCCACAGCAACCCCGGCTGG + Intronic
1072005703 10:91244725-91244747 AATCCACCAGCAAACCTTGCTGG - Intronic
1074625814 10:115185083-115185105 CCTCCAATTGCAATCCATCCAGG - Intronic
1079324306 11:19478346-19478368 CTTCCATCAGCAATTTTTGCAGG - Intronic
1085503944 11:77045251-77045273 CCACCAACTGCACTCCTTACTGG + Intergenic
1091396532 12:156955-156977 CCTCCAACACCCATTCTCGCTGG - Intronic
1095761992 12:45850308-45850330 CCTCCAACAGCAATACTAACAGG - Exonic
1097328144 12:58302570-58302592 CCCCAAACTGCAATCCTTTCTGG - Intergenic
1102227055 12:111236108-111236130 CCTCCAACAACAACCCTATCAGG - Intronic
1103691064 12:122774677-122774699 CCTCCGGCAGCCTTCCTTGCCGG + Exonic
1106401202 13:29432741-29432763 AGTCCAACAGCAACACTTGCTGG + Intronic
1109469369 13:62785412-62785434 CTTCCAACTGCAATAATTGCTGG - Intergenic
1114153650 14:20074371-20074393 CAACCAACAGCCATTCTTGCTGG + Intergenic
1114557058 14:23568094-23568116 CCGCCAACACCAAGTCTTGCAGG - Exonic
1114646723 14:24260176-24260198 CCTCCCACAGCAGTCCTGTCAGG - Intronic
1119362992 14:74067442-74067464 CTTTCAACAGCAGTCCTTGTGGG - Exonic
1120047438 14:79823793-79823815 CCTCCAGCAGCTTTCCTTGCAGG - Intronic
1122815382 14:104309609-104309631 CCTCCAGCAGGAAGCCTTCCCGG + Intergenic
1124268850 15:28262424-28262446 CCTCCAACTACAATGCATGCTGG + Intronic
1126765360 15:52005862-52005884 CCCCCAGCAGTAATCCTTGGGGG - Intronic
1131730634 15:95276212-95276234 CCTCCTTCAACAAACCTTGCAGG + Intergenic
1133281936 16:4671516-4671538 CCGCGGACAGCAATGCTTGCCGG + Intronic
1137395146 16:48111775-48111797 CCTTGAACTGCAATCCTCGCAGG + Exonic
1138618822 16:58196375-58196397 CCTCCAAAAGGACTCCTTGCAGG - Intronic
1144696075 17:17304572-17304594 CCTCCAGCAGCAACCCTAGGTGG - Intronic
1149088643 17:52751289-52751311 CCTCCCACTGCAATCTCTGCAGG + Intergenic
1149439423 17:56662450-56662472 CTTCCAACAGCACTCCTTCCAGG + Intergenic
1153795011 18:8613698-8613720 GCTCCAACAGCATTGCATGCTGG + Intronic
1159619172 18:70618047-70618069 GCTCCAACACTAATCCTTGTTGG + Intergenic
1160677258 19:398046-398068 CCTCCAAGGGCAAGCCTTGCAGG + Intergenic
1162935810 19:13980917-13980939 CCACCATCAGCCAACCTTGCTGG - Intronic
1166524430 19:43502175-43502197 CCTCCAGCTGCTGTCCTTGCAGG + Exonic
926316188 2:11711993-11712015 CCTCAAACAACAACTCTTGCTGG - Intronic
926736294 2:16075765-16075787 CCACCAACGGCATTCCTTGTGGG + Intergenic
928070866 2:28214881-28214903 CCTCCCCAAGCACTCCTTGCAGG + Intronic
928932143 2:36635936-36635958 CTTCCAACAGCAATTCTTTCAGG + Intronic
929238896 2:39633419-39633441 TCTTCAACAGCAAGCCTTCCTGG - Intergenic
932335717 2:70930331-70930353 CCTCAAACCTCAAACCTTGCTGG - Intronic
932598934 2:73111287-73111309 CCTCCTCCAGCAAGCCTTCCTGG + Intronic
937077900 2:119120436-119120458 TCTCCAAAACCAATCCGTGCAGG + Intergenic
937650670 2:124315661-124315683 CCTCCTACAGCAAGCCTGACAGG + Intronic
938954291 2:136283923-136283945 CATACATCAGCAATCCTGGCTGG + Intergenic
941675491 2:168339493-168339515 TCTCCAACAGCAAACCATCCAGG - Intergenic
947368236 2:229418294-229418316 CCCCCAACTGCCTTCCTTGCAGG - Intronic
1172233409 20:33352513-33352535 CCTCCCACAGCAATACCTTCAGG + Intergenic
1172936392 20:38623460-38623482 CATCCAAAAGCCATCCATGCTGG - Exonic
1175692068 20:61072714-61072736 CCTCCTTCAGCGAACCTTGCAGG - Intergenic
1175702411 20:61149423-61149445 CCTCCAGCATCACTCCCTGCCGG - Intergenic
1176028802 20:63000300-63000322 CCTCCGAGAGCCACCCTTGCAGG - Intergenic
1179024146 21:37666406-37666428 CATCCAACCCCAACCCTTGCTGG + Intronic
1181034989 22:20165595-20165617 CCTCCCACTGCAATCCCGGCAGG + Intergenic
1181508833 22:23379764-23379786 CCTCCCACTGCAATCCCAGCAGG - Intergenic
1183749949 22:39714142-39714164 ACTGCAACAGAAATCATTGCAGG + Intergenic
1184812964 22:46849574-46849596 CCTCTCCCAGCAATCCTTGCAGG - Intronic
1184965486 22:47969038-47969060 CCTAGAAAAGCCATCCTTGCAGG + Intergenic
949376189 3:3392858-3392880 TCTGCAACAGCAAACATTGCAGG - Intergenic
949864109 3:8533088-8533110 CTTCCCAGAGCAATTCTTGCTGG - Intronic
952897042 3:38084714-38084736 CCCCCATCAGCAGTCCTTGAGGG + Intronic
953067173 3:39484284-39484306 CCTCCCACACCATTTCTTGCTGG - Intronic
953393689 3:42549494-42549516 CCTCACACAGCCAGCCTTGCTGG + Intronic
953791984 3:45954569-45954591 CCTATAACAGCAACCCTTGCTGG - Intronic
954569197 3:51626372-51626394 ACTCCAACCCCAGTCCTTGCTGG + Intronic
955747387 3:62153844-62153866 TCTCCAGCAGCAACCCTTGAAGG + Intronic
957109407 3:75933473-75933495 TTGCCAACAGCAATACTTGCAGG + Intronic
960090692 3:113635410-113635432 CCTCCAAAACCAATCTGTGCTGG + Intergenic
967713182 3:192732980-192733002 CATCAATCAGCAATCCTTGACGG + Intronic
968927145 4:3555522-3555544 CTTCCAAAAGCAATGCTGGCCGG - Intergenic
973699202 4:53520188-53520210 CCTCTCACAGCAACCCCTGCGGG + Intronic
986780511 5:11061163-11061185 CATCCATCAGCAAACCTTGCTGG + Intronic
988360101 5:30226446-30226468 CCTCAAAGAGCAATCCTTGGAGG + Intergenic
992081061 5:73234421-73234443 CCTACAAAAACAATCCTTCCCGG - Intergenic
998973125 5:147614439-147614461 CACCCAACAGAAAACCTTGCTGG + Intronic
999262092 5:150244643-150244665 CCAGCACCAGCAAGCCTTGCCGG + Intronic
1000625244 5:163530808-163530830 CTGCCAACAGCAATTCTTGGGGG + Intergenic
1002788018 6:419058-419080 CCCCCACCAGCAACCCATGCGGG + Intergenic
1004071266 6:12300161-12300183 CCTCACACAACAATCCTTTCGGG + Intergenic
1006414015 6:33892916-33892938 TCCCCAACAGCAATCCTCCCAGG - Intergenic
1006503515 6:34473370-34473392 CCTGCAGCAGCAATCCAAGCTGG - Intronic
1007844183 6:44740199-44740221 CCTCCCACAGCAATTCTTCATGG + Intergenic
1010443819 6:75929209-75929231 CATCCACCAGCAATGCTTGATGG + Intronic
1011310129 6:85972509-85972531 CCAGCAACAGCAACCCTTCCAGG - Intergenic
1015592529 6:134836072-134836094 CCTCCAACAGCATTCCTTCCTGG - Intergenic
1018480154 6:164181946-164181968 ACACCAACATCAATGCTTGCTGG + Intergenic
1019901652 7:4025889-4025911 TGTCCAACAGCAACCCTTCCTGG + Intronic
1023816522 7:43954562-43954584 ATTAAAACAGCAATCCTTGCTGG - Exonic
1025023912 7:55500380-55500402 GCACCAACAGCAATCCCAGCAGG + Intronic
1026440410 7:70438850-70438872 CCTCCAACAGCATCCCTGGTGGG - Intronic
1034573689 7:151979447-151979469 CCACCAAAAAAAATCCTTGCTGG - Intronic
1038060235 8:23904307-23904329 CCTCTAACAGCATTCTGTGCTGG - Intergenic
1041462848 8:58131000-58131022 CCTCCAACAGCAATCCATATAGG + Intronic
1045224785 8:100233875-100233897 CCTCCAACAGCAATCCTTGCCGG - Intronic
1049207826 8:141371595-141371617 CCTCCACCAGCAATCCCTCCCGG - Intergenic
1049648622 8:143751797-143751819 CCTCCTTGAGCATTCCTTGCAGG + Intergenic
1053410180 9:37911227-37911249 CCTCCCACAGGAAGCCTTTCTGG + Intronic
1055921793 9:81468441-81468463 CCTCCTGCAGAAATCCCTGCAGG - Intergenic
1185619140 X:1442743-1442765 CTTCCCACAGCCATCATTGCTGG - Intronic
1186072127 X:5833309-5833331 CCTCCAACCTGTATCCTTGCAGG - Intergenic
1186759038 X:12703809-12703831 CCTCCATCAACATTTCTTGCTGG - Intronic
1193993821 X:88341450-88341472 CCAGCAACGGCAATCCTTCCAGG + Intergenic
1198739749 X:139829106-139829128 CATCTAACAGCAATCACTGCCGG - Intronic