ID: 1045224796

View in Genome Browser
Species Human (GRCh38)
Location 8:100233926-100233948
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045224785_1045224796 28 Left 1045224785 8:100233875-100233897 CCGGCAAGGATTGCTGTTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 92
Right 1045224796 8:100233926-100233948 ATGGGTGACCCAGCGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr