ID: 1045225745

View in Genome Browser
Species Human (GRCh38)
Location 8:100243928-100243950
Sequence CTGTAAATTGTGCATCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045225742_1045225745 27 Left 1045225742 8:100243878-100243900 CCTAAAGTATTTTAGTGGAATGT 0: 1
1: 0
2: 1
3: 26
4: 219
Right 1045225745 8:100243928-100243950 CTGTAAATTGTGCATCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045225745 Original CRISPR CTGTAAATTGTGCATCTGGA AGG Intronic
No off target data available for this crispr