ID: 1045227937

View in Genome Browser
Species Human (GRCh38)
Location 8:100268810-100268832
Sequence GCTATTCCTGCAATGATTAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045227937_1045227939 7 Left 1045227937 8:100268810-100268832 CCAATAATCATTGCAGGAATAGC 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1045227939 8:100268840-100268862 GCTATTAAAGCGATTCCGACAGG 0: 1
1: 0
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045227937 Original CRISPR GCTATTCCTGCAATGATTAT TGG (reversed) Exonic
900859004 1:5211675-5211697 GCTATTCCTGTAATGCCTATAGG - Intergenic
904780849 1:32946427-32946449 GCCATTCCTGCCATGGTCATTGG - Exonic
908625453 1:66035785-66035807 AATATTGCTGCAATGAATATGGG + Intronic
916346687 1:163799802-163799824 GGAATTCCTGTAGTGATTATAGG - Intergenic
917294082 1:173501129-173501151 GTTTTTCCTGAAATGTTTATAGG - Intronic
919139009 1:193546573-193546595 GCTTTTCCAGAAATAATTATTGG + Intergenic
919577525 1:199330322-199330344 GTAATTCTTGCAATGATTTTTGG + Intergenic
920429925 1:205911970-205911992 GCTATTCAGGCAATGATTTCAGG - Intergenic
924677341 1:246192959-246192981 GCTTTTAATGTAATGATTATAGG + Intronic
1063513410 10:6669808-6669830 GTAATTCTTGCAATAATTATGGG - Intergenic
1064344389 10:14517863-14517885 GCTACTCCTCAAATGATTTTTGG + Intergenic
1065223721 10:23521750-23521772 ACTATTCCTGCCATAATTCTTGG - Intergenic
1070620091 10:78002776-78002798 GATCTTCCTGCCTTGATTATAGG + Intronic
1077770428 11:5212395-5212417 GCTTTTGCTGCAATGACTGTTGG + Intergenic
1078327825 11:10394915-10394937 GCTATTCCTGGAAGGATTGCAGG + Intronic
1078394504 11:10968077-10968099 AATAATCCTGCAATGAATATGGG - Intergenic
1081474997 11:43420842-43420864 GCTATTCATCCAGTCATTATAGG + Intronic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1083488327 11:62997112-62997134 GCCATTCCTGCCATAATTCTCGG - Intronic
1083950301 11:65951143-65951165 AATATTCCTGCAATGAACATAGG + Intronic
1086023740 11:82264395-82264417 GGTATTCCTGCATTAATTGTTGG + Intergenic
1092637175 12:10464591-10464613 GCTTTTCCTGCAATTGTTTTTGG + Intergenic
1095654556 12:44653707-44653729 ACTAGGCCTGCATTGATTATTGG + Intronic
1098717539 12:73850491-73850513 GCTTTTCCTGCAAAAATTCTAGG - Intergenic
1100109520 12:91222150-91222172 CTTAATCCTGGAATGATTATGGG - Intergenic
1101915617 12:108893435-108893457 GCTTTTCCTGTCATTATTATTGG - Intronic
1107075309 13:36317124-36317146 GGCATCCCTGCAATGATTAAAGG - Intronic
1111965066 13:94852480-94852502 GCTCTTCCTGCAGTGATCCTGGG - Intergenic
1114421150 14:22584192-22584214 ACTATTCCTGACATGACTATAGG + Intronic
1115150291 14:30276705-30276727 TCTACTTCTGCCATGATTATAGG + Intergenic
1116959390 14:50954440-50954462 GCCATTCCTGCAGTAAGTATAGG - Intergenic
1118427875 14:65687071-65687093 GCTAGTCCTGGAATGATTCAAGG - Intronic
1118645885 14:67839344-67839366 TCAATTCCTTTAATGATTATAGG + Intronic
1121892855 14:97613204-97613226 GCTATTCCTCTACTGATTTTGGG + Intergenic
1124375519 15:29126672-29126694 GCCATTCCTGGAATGATTTCTGG - Intronic
1125880934 15:43194783-43194805 TCTATTCATGCAATGATCAATGG - Exonic
1135620996 16:23955460-23955482 GCAAGTCCTTCAATGGTTATGGG + Intronic
1137667040 16:50256873-50256895 AATAATGCTGCAATGATTATGGG - Intronic
1140234062 16:73142737-73142759 ACTATTCATTGAATGATTATAGG + Intronic
1141300798 16:82813851-82813873 GCTATTCCTCAGATGATTGTGGG + Intronic
1144491551 17:15716533-15716555 CCTATACCTGCAATGAATGTGGG + Exonic
1144908933 17:18662672-18662694 CCTATACCTGCAATGAATGTGGG - Exonic
1147509599 17:41056066-41056088 GATATTTCTGGAATGAGTATTGG - Intergenic
1149274934 17:55023254-55023276 GCCACTCCTGCCATGAATATAGG + Intronic
1150540667 17:66095197-66095219 GCTATTGCTGCAGTGAACATGGG - Intronic
1151159633 17:72154034-72154056 GCTTTTCATAGAATGATTATAGG - Intergenic
1158251435 18:55492189-55492211 TCTATTCCTGTGATGATTATTGG - Intronic
1159210415 18:65314076-65314098 GGTATTTCTGTAATGATTAGTGG - Intergenic
1159873259 18:73782567-73782589 GCTATTCCTGAGATGACTGTGGG + Intergenic
1160224059 18:76998609-76998631 GCTATTCCTTCAAAGAATAAGGG - Intronic
1161465193 19:4425867-4425889 GCTATCACTGCAATTTTTATGGG + Intronic
1168139159 19:54373567-54373589 GCTCTTAGTGTAATGATTATGGG + Intergenic
926067103 2:9850932-9850954 GCTTTTCCTGAAATGGTTCTAGG - Intronic
928240251 2:29579869-29579891 GCTTTTCCTACAATGAGTCTGGG - Intronic
930080975 2:47448405-47448427 GCTATTAGTGGAATGATTTTAGG + Intronic
940634081 2:156276201-156276223 TTTATTACTGCAATGAATATGGG + Intergenic
942482974 2:176408871-176408893 GCTATTCCTTTAATGGTTATAGG + Intergenic
942663403 2:178290080-178290102 TGTATTCAGGCAATGATTATTGG - Intronic
945574810 2:211517109-211517131 GCTATCCCTGCAATAAGTTTTGG - Intronic
947309943 2:228790610-228790632 TCTATTCCTATATTGATTATTGG - Intergenic
1170929752 20:20758320-20758342 GTTACTCCTCCAGTGATTATTGG - Intergenic
1177980900 21:27914109-27914131 AATATTGCTGCAATGAATATGGG - Intergenic
1178262374 21:31111811-31111833 GTTATCACTGCAATTATTATTGG + Intergenic
952124715 3:30286963-30286985 GCTTTTGCTGCAATGATGCTGGG - Intergenic
956611206 3:71125110-71125132 GCCATTCCTGCATTGAGAATTGG - Intronic
960056758 3:113281430-113281452 TTTATTCCTGCAATGATATTTGG + Intronic
962707150 3:138055031-138055053 GCTATTCCTGCAAAAAATGTTGG - Intergenic
963552457 3:146741250-146741272 GCTTTACCTGCAATGTCTATAGG - Intergenic
965099932 3:164283197-164283219 AATAATGCTGCAATGATTATGGG - Intergenic
966650125 3:182291255-182291277 GCCATGCAGGCAATGATTATAGG - Intergenic
969278946 4:6156321-6156343 GCTATTCATTAAATGATGATGGG - Intronic
974705876 4:65514815-65514837 GCTATTCCTGCAATAATTCTTGG + Intronic
979996633 4:127439442-127439464 GCTTTTCTTCCAATGCTTATTGG - Intergenic
986131430 5:4935685-4935707 GCTAGTGCTGCAATGAGTGTGGG - Intergenic
986554433 5:8997266-8997288 ACTATTCCTGAAAAAATTATTGG + Intergenic
987577620 5:19751903-19751925 GCTATTCCTGCAGTCATTCTGGG - Intronic
990694791 5:58403865-58403887 GCTGTTCTAGGAATGATTATTGG + Intergenic
996415733 5:123208365-123208387 GCTAATCCTGCAATCATTACAGG + Intergenic
1003474022 6:6464901-6464923 GCTCTTCCTGCGATGATGACAGG - Intergenic
1005437701 6:25832643-25832665 GCTCTTCCTGCAATTACTGTAGG + Intergenic
1007196449 6:40065577-40065599 CCTATTCCTCCAATGGTCATGGG - Intergenic
1008062858 6:47016762-47016784 TCCATTTCTGCAGTGATTATGGG + Exonic
1009211411 6:60867716-60867738 GCTATGCCTGCAATTAACATGGG + Intergenic
1009648352 6:66439569-66439591 ACTATTCCTGCAATTAGTGTTGG + Intergenic
1010645473 6:78382887-78382909 GCTAATGCTGCAATGAACATGGG - Intergenic
1012148461 6:95716338-95716360 CCTTTTCCTTCAATGAGTATTGG + Intergenic
1015482988 6:133735007-133735029 GCTAGTACTGCAATGAACATGGG - Intergenic
1016308467 6:142708451-142708473 AATAATCCTGCAATGAATATTGG - Intergenic
1017637600 6:156457872-156457894 GCTATTCTTGCAATTACTGTTGG - Intergenic
1017749241 6:157474356-157474378 GATAATACTGCAATGAATATGGG + Intronic
1019787810 7:2989657-2989679 TCTATTCCTGTAATGTTTTTTGG - Intronic
1020444238 7:8251959-8251981 GTTATTACTGCCATGATTTTTGG - Intronic
1029048069 7:97652365-97652387 GCTATTTTTGCAATGATATTGGG - Intergenic
1030332426 7:108285292-108285314 GCTATTCCTGTGAGGATTAGTGG - Intronic
1030726315 7:112929630-112929652 AGTAATGCTGCAATGATTATAGG - Intronic
1031295873 7:120003279-120003301 GCTATTGTTGCAATGAACATTGG + Intergenic
1031327025 7:120414462-120414484 GCAATTCCTTCCATAATTATTGG + Intronic
1033477845 7:141707770-141707792 GATAATGCTGCAATGAATATGGG + Intergenic
1034176676 7:149105283-149105305 GCTATTCCTGCTATGTCTGTAGG - Exonic
1036031049 8:4973804-4973826 GCTGTTCCTGAACTGAGTATAGG + Intronic
1038086954 8:24208646-24208668 GCTATTTTTGCAATGGTTATTGG - Intergenic
1038496881 8:28009772-28009794 GCCATGCGTGCAGTGATTATAGG - Intergenic
1039016809 8:33158463-33158485 GATATTCATGCCCTGATTATTGG - Intergenic
1044348660 8:91136997-91137019 GCTATTACTGCAATGAGCATGGG + Intronic
1045227937 8:100268810-100268832 GCTATTCCTGCAATGATTATTGG - Exonic
1051529788 9:18088934-18088956 ACTAATCCTGCAATGAACATGGG - Intergenic
1059089967 9:111345920-111345942 CCTATTCCTGCAAGGTTTCTGGG - Intergenic
1188342202 X:29017800-29017822 GCTATCCTTGCCATGATGATAGG - Intronic
1188494823 X:30772740-30772762 GCTATTACTGCCATTATTACTGG - Intergenic
1189548671 X:42070825-42070847 GCTATGCCTTAAATGATTTTTGG + Intergenic
1193943071 X:87700466-87700488 GCAGTTCCAGCAATGATGATAGG - Intergenic
1194194533 X:90875962-90875984 GCTGCTACAGCAATGATTATAGG - Intergenic
1194415986 X:93612663-93612685 GCTATTGTTGCAATTATTTTTGG + Intergenic
1194438240 X:93895464-93895486 CCTATTTCTGTATTGATTATGGG + Intergenic
1195833026 X:109081356-109081378 ACTATTGCTGCAATAAATATGGG - Intergenic
1197434147 X:126404589-126404611 GTTATTCCTGGAATGCTTGTTGG + Intergenic
1198813092 X:140556236-140556258 ACTAATGCTGCAATGAATATGGG - Intergenic
1200541150 Y:4458363-4458385 GCTGCTACAGCAATGATTATAGG - Intergenic
1201423772 Y:13827653-13827675 GCTTTTCCTGCAAGGATAAAGGG + Intergenic